SlideShare a Scribd company logo
1 of 89
MapReduce 활용
bt22dr@gmail.com
목차
1. MapReduce 활용
1. 데이터 분석가
2. 계산 집약적 연산
3. OLAP 분석
4. 복잡한 분석 로직 구현
5. 각종 도메인 특화 기술 구현
2. 데모
1. RHadoop
2. K-means Clustering
3. K-mer Count
1.1 데이터 분석가
• 기존의 데이터 분석가도 빅데이터 분석을 위해 Hadoop을 활용할 수 있다.
• R과 Hadoop을 연동하는 여러 가지 방법에 대해 알아본다.
• 이러한 접근법의 장점과 그 한계점은 무엇인가?
전통적인 데이터 분석 도구
• 엑셀
• DBMS, DW
• SAS
• SPSS
• R
빅데이터 분석
• R
– SAS, SPSS의 대안
– 오픈소스, 최신 기술 적용
• Hadoop
– 대용량 데이터를 위한 파일 시스템
– 분산 컴퓨팅 프레임워크
– (비교적) 검증된 기술
• R + Hadoop
– R의 분석 능력, Visualization 능력
– Hadoop의 대용량 데이터 처리 능력
R + Hadoop = ?
• Iterative vs. batch processing
• In-memory vs. in parallel
R + Hadoop = 
• HDFS, HBase 활용
• MapReduce 정제 데이터 접근
R + Hadoop = 
• MapReduce 직접 연동
– apply family 작업
• crosstabs, summaries, data transformations
– 기타 복잡한 알고리즘들
• K-Means clustering, logistic regression, …
– 대용량 데이터 Visualization
RHadoop
• Collection of three R packages that allow users
to manage and analyze data with Hadoop.
• RHadoop consists of the following packages:
– rmr - functions providing Hadoop MapReduce
functionality in R
– rhdfs - functions providing file management of the
HDFS from within R
– rhbase - functions providing database management
for the HBase distributed database from within R
RHadoop
출처 : http://www.revolutionanalytics.com/why-revolution-r/whitepapers/R-and-Hadoop-Big-Data-Analytics.pdf
RHadoop의 장점
• 기존의 데이터 분석가도 Big Data 처리 가능
• 분석 결과 향상
– 간단한 모델 + 대용량 데이터
– 복잡한 모델 + 적은 데이터
• 벤더 종속성 탈피
1.2 계산 집약적 연산
• Data Intensive & Compute Intensive computation
• 대용량 데이터에 대해 계산 집약적 연산의 수행이 필요할 경우 Hadoop과
CUDA를 활용하여 빠르게 처리할 수 있다.
• Linear Algebra 연산 적용 시 문제점과 개선 방안
데이터 마이닝
통계 분석
추천 시스템
…
!!!
출처 : The Free Lunch Is Over
n = 10000
Back of the envelope calculation
• Evolution in performance of processor designs
출처 : Matrix Computations onGraphics Processors andClusters of GPUs
CUDA
• Compute Unified Device Architecture
– NVIDIA’s parallel computing architecture
– computing engine in Nvidia graphics processing units
(GPUs) that is accessible to software developers
through variants of industry standard programming
languages.
• GPU를 이용한 범용적인 프로그램을 개발할 수 있
도록 ‘프로그램 모델’, ‘프로그램 언어’, ‘컴파일러’,
‘라이브러리’, ‘디버거’, ‘프로파일러’를 제공하는 통
합 환경
출처 : http://en.wikipedia.org/wiki/CUDA
vs
• Sequential, complex data dependency
를 가진 code 수행에 적합
• 트랜지스터의 많은 부분을
– control logic : 비순차실행 제어, 분기 예
측 핸들링
– cache memory : reference의 지역성 이
용, 메모리 접근 지연 감춤
• 최적의 floating-point throughput을 뽑
아내기 위해 arithmetic unit 부분 확장
• memory bandwidth가 훨씬 크다
• high degree of data parallelism
(embarrassingly parallel)
• 분기가 없고, 메모리 트랜젝션당 계산
량이 많은 계산 집약적인 프로그램
n = 10000
Back of the envelope calculation
분산/병렬 컴퓨팅
• 병렬 아키텍처
출처 : http://webedu.ksc.re.kr/data/data/02.ParallelPrograming.pdf
분산/병렬 컴퓨팅
출처 : https://computing.llnl.gov/tutorials/parallel_comp/
• 공유 메모리 구조 • 분산 메모리 구조 • 하이브리드 구조
병렬 프로그래밍 모델
• 공유메모리 병렬 프로그래밍 모델
– 공유 메모리 아키텍처에 적합
– 다중 스레드 프로그램
– OpenMP, Pthreads
• 메시지 패싱 병렬 프로그래밍 모델
– 분산 메모리 아키텍처에 적합
– MPI, PVM
• 하이브리드 병렬 프로그래밍 모델
– 분산-공유 메모리 아키텍처
– OpenMP + MPI
병렬 프로그래밍 모델
H/W
SMP machine
Cluster machine
SMP Cluster
GPU machine
GPU cluster
S/W
OpenMP
MPI
MPI + OpenMP
CUDA
MPI/OpenMP + CUDAMPI/OpenMP
MapReduce
Pregel…
CUDA-MapReduce 연동
CUDA-MapReduce 연동
CUDA-MapReduce 연동
CUDA-MapReduce 연동 방법
• 별첨 자료 (MapReduce-CUDA 연동.docx) 참고
CUDA-MapReduce 연동 효과
• 성능 향상 효과
CUDA-MapReduce 연동 한계
• Matrix-Matrix 곱셈
Parallel Matrix Multiplication
• Node 간 데이터 전송이 필요한 경우
– Pregel 활용 (ex. CUDA-Giraph 연동)
Parallel Matrix Multiplication
• Node 간 데이터 전송이 필요한 경우
– Pregel 활용 (ex. CUDA-Giraph 연동)
1.3 OLAP 분석
생략…
1.4 복잡한 분석 로직 구현
• 대용량 데이터에서 가치 있는 정보를 얻기 위해 Hadoop을 이용하여 각종 기
계학습 알고리즘을 구현할 수 있다.
• Hadoop, Mahout을 이용하여 간단한 추천 시스템을 구현할 수 있다.
분석 기반 기술
• 데이터분석 : 축적된 대량의 데이터를 다양한 형태로 가공하여
업무에 숨어있는 과제와 문제점을 밝히고, 과제와 문제점의 요
인을 분석해서 대책을 세우고 개선하는 활동을 말한다.
• 데이터마이닝 : 데이터 마이닝은 데이터를 분석해서 패턴을 발
견하고 예측 모델을 만드는 자동화된 프로세스다. 수학, 통계,
기계학습 등 다양한 연구 영역에 기초를 두고 있다.
• 기계학습 : 컴퓨터가 스스로 학습하게 하는 알고리즘에 관련된
인공지능의 한 영역. 주어진 데이터의 집합(트레이닝 데이터)
을 이용해서 데이터의 속성에 관한 정보를 추론하는 알고리즘
이다. 이 정보를 이용하여 미래에 발견될 다른 데이터(테스트
데이터)에 관한 예측이 가능
용어 정리
• 데이터 분석 : 이미 알려진 모델에 데이터가 적합한지를
다루는 개념
– 데이터의 조회, 요약, 경향 분석하는 작업
– 리포팅, OLAP 등
• 데이터 마이닝 : 데이터를 분석해서 이전에 알려지지 않은
패턴이나 모델을 발굴하는데 목적을 둠.
• 둘 다 비즈니스 인텔리전스의 분야다.
데이터 분석
데이터 마이닝
• 데이터마이닝은 데이터베이스를 훈련 데이터로
간주하여 수학, 통계학, 기계학습 기법의 알고리
즘을 이용해 유용한 정보를 도출해내는 과정을 말
한다.
데이터 마이닝 분류
데이터 마이닝 분류
Clustering
• Cluster
– Object 들의 집합
– 비슷한 object끼리 같은 cluster에 묶음
• Clustering Algorithm
– 개체 (object) 집합을 여러 개의 group 으로 묶는 알고
리즘
• Requirements for Clustering Task
a.개체를 벡터로 표현할 feature 를 정의
b.두 개체의 가까운 정도를 측정할 measure를 정의
c.클러스터링을 수행할 알고리즘을 정의
Clustering
• Clustering
– Vector distance는 최대한 가깝게
– Cluster distance는 최대한 멀게
Vector
Distance
(between vectors)
Distance
(between clusters)
Cluster
K-Means Clustering
• 주어진 데이터를 k개의 클러스터로 묶는 알고리즘
• 각 클러스터와 거리 차이의 분산을 최소화 하는 방식으로 동작
• 즉, 주어진 데이터를 가장 거리가 가까운 것들끼리 k개의 클러스터로
군집하여 모든 데이터와 해당 클러스터의 centroid와의 거리합이 최
소가 되도록 반복연산
• 초기 seed는 랜덤하게 선택하여도 반복연산(iteration) 과정에서 어느
정도 적절한 중심값을 찾아가게 되지만 항상 옳지는 않으므로
canopy와 같은 rough한 알고리즘을 사용하거나 휴리스틱하게 초기
값을 선정함
• 클러스터 수 k와 수렴 임계값을 사용자가 결정해 주어야 하며 모든 데
이터는 단 하나의 클러스터에만 소속될 수 있음.
K-Means Clustering
1) 모든 D의 엘리먼트에 대해서 주어진 초기 seed 중 가
장 가까운 것을 찾고 추가
2) Seed C를 소속된 엘리먼트들의 평균으로 업데이트
3) C와 소속 엘리먼트들과의 거리의 합이 수렴임계값(th)
보다 작을 때까지 반복
given, dataSet D(1,2,...n) & seed C(1,2,...,k) & convergence delta th
Repeat
1)For each D, find nearest centroid in C and Add to C
2)Update C (calculate new centroids)
3)sum over all distance between D and corresponding C
Until sum < th
K-Means Clustering
1. Initial Centroid
(randomly selected)
2. Clustering
(using distance)
3. Recalculate
Centroid
(if converged : go to 4)
(if not converged : go to 2)
4. Done
K-Means Clustering 구현
• 총 4개의 Mapper와 Reducer로 구성되어 있으며, 전체 과
정은 크게 3가지 MapReduce 작업으로 이루어진다.
– generateSeed( ) : 최초 seed로 사용할 centroid를 생성
– kmeansIter( ) : centroid를 갱신하며 clustering. 반복 수행함
– resultKmeans( ) : 최종 결과 생성
K-Means Clustering 구현
• KmeansMapper
– setup( )
K-Means Clustering 구현
• KmeansMapper
– map ( )
K-Means Clustering 구현
• KmeansReducer
– reduce ( )
K-Means Clustering 결과
출처 : http://spiderspace.wordpress.com/2012/03/26/mapreduce-in-r/
Mahout
• Apache Mahout is an Apache project to produce free
implementations of distributed or otherwise scalable
machine learning algorithms on the Hadoop platform.
- Wikipedia
Mahout
• Supported Algorithms
– Classification
– Clustering
– Regression
– Recommender / Collaborative Filtering
– Dimension Reduction
– Similarity Vectors
– Evolutionary Algorithms
– Pattern Mining
– …
Mahout
• Supported Algorithms
– Classification
– Clustering
– Regression
– Recommender / Collaborative Filtering
– Dimension Reduction
– Similarity Vectors
– Evolutionary Algorithms
– Pattern Mining
– …
추천 시스템
• brick-and-mortar vs. on-line
• 다양한 사용자들에 대해 구매할 확률이 높
은 아이템들을 찾아내는 것이 중요한 이슈
Off-line On-line
물리적 공간의 제약 물리적 공간 제약 없음
제한된 고객 수 고객 수의 제한 없음
Pareto(80/20) 법칙 Long tail 법칙
개인화 불가능 개인화 가능
Brick-and-mortar
• 시,공간의 제약이 존재
– 슈퍼마켓
– 교보문고
– 종이 신문
• 전통적인 파레토 법칙을 따름
• 적합한 방식 : 베스트셀러 추천
On-line
• 시,공간의 제약이 없음(or 약함)
– 멜론
– 아마존
– 온라인 뉴스 사이트
• Long-tail 법칙을 따름
• 적합한 방식 : 검색, 개인화 서비스
추천 시스템
• Utility Matrix
• Utility Matrix의 공백을 채우는 것이 추천 시
스템의 본질
추천 시스템 분류
• Recommendation Systems
– 컨텐츠 기반(Content-based) system
– 협업 필터링(Collaborative filtering) system
• Memory-based
– User-based CF
– Item-based CF
• Model-based CF
• 일반적인 성능 및 결과 비교
Content-based < User-based CF <= Item-based CF < Model-based
Content-based RS
• 가장 직관적인 방법
– 특정 속성을 선호하는 사람에게 비슷한 속성을 가진 아
이템을 추천
• 아이템 자체 특성을 반영하는 프로파일에 근거하
여 유사도를 측정하고 추천
사용자 아이템아이템
메타데이터
아이템
메타데이터
구매
업데이트
User Based CF
 Concept
: 나와 비슷한 취향의 사람이 구매한 책 추천.
 Flow
1) Data Model 생성
- User와 Item간의 Utility Matrix로 표현
2) User Similarity 계산
- User가 평가한 공통 Item을 기반으로 User간 유사도 계산
- Euclidean Distance, Jaccard Distance, Cosine Similarity 등
3) 선호도 예측 및 추천
- Query User 와 유사한 N-Neighbor 선택
- N-Neighbor와 Query User간의 유사도와 N-Neighbor가 선택한 Item
에 대한 선호도를 기반으로 Query User의 Item에 대한 선호도 예측
- 높은 점수를 받은 Item들을 Query User에게 추천
User Based CF
 Similarity
- Jaccard Similarity Coefficient
: UserA와 UserB가 구매 항목들 중 공통으로 구매한 항목의 비율
 선호도 예측
A B
Px(I) = PA(I)*SAX + PBX(I)*SBX + …..
Px(I) : UserX의 Item I에 대한 선호도
Sx1x2 : UserX1과 User X2의 유사도
유사도
• Jaccard similarity coefficient
• Euclidean distance similarity
• Cosine similarity
• Pearson correlation coefficient
• Log-likelihood-based similarity
• …
유사도
1.5 도메인 특화 기술 구현
• 대용량 CDR 데이터, SNS 사용자 데이터, e-mail 데이터 등을 이용하여 소셜
네트워크 분석을 수행할 수 있다.
• Bioinformatics 분야의 각종 알고리즘들이 대용량 데이터 처리를 위하여
Hadoop을 이용하고 있는 추세이다.
CloudBurst
• CloudBurst : Highly Sensitive Short Read
Mapping with MapReduce
• New parallel read-mapping algorithm
optimized for mapping NGS data to the
human genome and other reference
genomes
• SNP discovery, genotyping, and personal
genomics
CloudBurst
• It is modeled after the short read mapping
program RMAP
• Reports either all alignments or the unambiguous
best alignment for each read with any number of
mismatches or differences
• This level of sensitivity could be prohibitively time
consuming, but CloudBurst uses the open-source
Hadoop implementation of MapReduce to
parallelize execution using multiple compute
nodes.
CloudBurst
• Running time
– scales linearly with the number of reads mapped
– with near linear speedup as the number of
processors increases.
• CloudBurst reduces the running time from
hours to mere minutes for typical jobs
involving mapping of millions of short reads to
the human genome.
Algorithm Overview
• CloudBurst uses seed-and-extend algorithms to
map reads to a reference genome.
• Seed
– k differences : the alignment must have a region of
length s=r/k+1 called a seed that exactly matches the
reference.
• Extend
– CloudBurst attempts to extend the alignment into an
end-to-end alignment with at most k mismatches or
differences
Algorithm Overview
• CloudBurst uses the Hadoop implementation of
MapReduce to catalog and extend the seeds
• Map phase emits
– all length-s k-mers from the reference sequences
– all non-overlapping length-s kmers from the reads
• Shuffle phase
– read and reference kmers are brought together
• Reduce phase
– the seeds are extended into end-to-end alignments
Algorithm Overview
K-mer 분석
• K-mer : 길이가 k인 염기서열내의 연속된 염기
Ex) ACGTACGTACGTACGTACGTACGT
AAAAAA
…
ACGTAC
…
CGTACG
…
…
GTACGT
…
TACGTA
…
TTTTTT
0
1
0
0
0
0
ACGTAC
K-mer 분석
• K-mer : 길이가 k인 염기서열내의 연속된 염기
Ex) ACGTACGTACGTACGTACGTACGT
AAAAAA
…
ACGTAC
…
CGTACG
…
…
GTACGT
…
TACGTA
…
TTTTTT
0
3
3
3
3
0
TACGTA
유전체 분석 실습
별첨 자료 (CloudBurst Tutorial.docx) 참고
SNA 분석
• 별첨 자료 (SNA&R.pptx) 참고
2.1 RHadoop
R 설치
# rpm -Uvh http://dl.fedoraproject.org/pub/epel/6/x86_64/epel-release-6-8.n
oarch.rpm
# yum install R
RHadoop 설치
# su - # RHadoop 패키지 설치 작업은 root 계정으로
# wget --no-check-certificate https://github.com/downloads/RevolutionAnalytics/RHadoop/rmr2_2.0.2.tar.gz
# wget --no-check-certificate https://github.com/downloads/RevolutionAnalytics/RHadoop/rhdfs_1.0.5.tar.gz
# export JAVA_HOME=/usr/local/jdk-<version> # 각자 환경에 맞게 수정할 것!
# export HADOOP_HOME=/home/hadoop/hadoop
# export HADOOP_CONF=$HADOOP_HOME/conf
# export HADOOP_CMD=$HADOOP_HOME/bin/hadoop
# export HADOOP_STREAMING=$HADOOP_HOME/contrib/streaming/hadoop-streaming-<version>.jar
# R CMD javareconf
# R
> install.packages(c('Rcpp', 'RJSONIO', 'itertools', 'digest', 'functional', 'stringr', 'plyr'))
> q()
# R CMD INSTALL rhdfs_1.0.5.tar.gz # Hadoop이 실행중인 상태에서 설치해야함
# R CMD INSTALL rmr2_2.0.2.tar.gz
rhdfs
• File Manipulations
hdfs.copy, hdfs.move, hdfs.rename, hdfs.delete,
hdfs.rm, hdfs.del, hdfs.chown, hdfs.put, hdfs.get
• File Read/Write
hdfs.file, hdfs.write, hdfs.close, hdfs.flush, hdfs.read,
hdfs.seek, hdfs.tell, hdfs.line.reader, hdfs.read.text.file
• Directory
hdfs.dircreate, hdfs.mkdir
• Utility
hdfs.ls, hdfs.list.files, hdfs.file.info, hdfs.exists
• Initialization
hdfs.init, hdfs.defaults
rhdfs (serialize)
# su - hadoop # RHadoop 패키지 테스트는 hadoop 계정으로
# export HADOOP_HOME=/home/hadoop/hadoop # 각자 환경에 맞게 수정
# export HADOOP_CONF=$HADOOP_HOME/conf
# export HADOOP_CMD=$HADOOP_HOME/bin/hadoop
# export HADOOP_STREAMING=$HADOOP_HOME/contrib/streaming/hadoop-streaming-<version>.jar
$ R
> library(rhdfs)
> hdfs.init()
Loading required package: rJava
HADOOP_HOME=/home/hadoop/hadoop
HADOOP_CONF=/home/hadoop/hadoop/conf
> model = lm(weight~height, women)
> model
> modelfilename <- "model_file"
> modelfile <- hdfs.file(modelfilename, "w")
> hdfs.write(model, modelfile)
[1] TRUE
> hdfs.close(modelfile)
[1] TRUE
> hdfs.ls('/user/hadoop')
permission owner group size modtime file
1 drwxr-xr-x hadoop supergroup 0 2012-06-04 15:53 /user/hadoop/input
2 -rw-r--r-- hadoop supergroup 3670 2012-06-04 18:36 /user/hadoop/model_file
rhdfs (deserialize)
$ R # hadoop 계정으로 R 실행
> library(rhdfs)
Loading required package: rJava
> modelfile = hdfs.file(modelfilename, "r")
> modelfile
DFS File: model_file [blocksize=67108864, replication=1, buffersize=5242880, mode='r']
> m <- hdfs.read(modelfile)
> model <- unserialize(m)
> model
> hdfs.close(modelfile)
[1] TRUE
> hdfs.delete('/user/hadoop/model_file')
Deleted hdfs://cudatest:9000/user/hadoop/model_file
[1] TRUE
> hdfs.ls('/user/hadoop')
permission owner group size modtime file
1 drwxr-xr-x hadoop supergroup 0 2012-06-04 15:53 /user/hadoop/input
>
rhdfs 활용 예
• Hadoop wordcount 결과를
이용하여 wordcloud 생성
• 오른쪽 그림은 $HADOOP_HOME의
README.txt 파일에 대한 수행 결과
$ bin/hadoop jar hadoop-examples-1.0.2.jar wordcount WordCount/input WordCount/output
$ R
> library(rhdfs)
> library(wordcloud)
> m<-hdfs.line.reader("/user/hadoop/WordCount/output/part-r-00000")
> lines <- m$read();
> splt <- strsplit(lines, split='t')
> m <- matrix(unlist(splt), byrow=TRUE, ncol=2)
> df <- data.frame(m)
> pal <- brewer.pal(8,"Dark2")
> wordcloud(df$X1, freq=tapply(df$X1, df$X2), min.freq=2, random.order=T,rot.per=.1,colors=pal)
rmr
• This R package allows an R programmer to perform
statistical analysis via MapReduce on a Hadoop cluster.
> library(rmr2)
요구된 패키지 RJSONIO를 로드중입니다
요구된 패키지 itertools를 로드중입니다
요구된 패키지 iterators를 로드중입니다
요구된 패키지 digest를 로드중입니다
> small.ints = to.dfs(1:10)
12/06/01 22:51:07 INFO util.NativeCodeLoader: Loaded the native-hadoop library
12/06/01 22:51:07 INFO zlib.ZlibFactory: Successfully loaded & initialized native-zlib library
12/06/01 22:51:07 INFO compress.CodecPool: Got brand-new compressor
> small.ints = from.dfs(small.ints)
12/06/04 19:01:54 INFO util.NativeCodeLoader: Loaded the native-hadoop library
12/06/04 19:01:54 INFO zlib.ZlibFactory: Successfully loaded & initialized native-zlib library
12/06/04 19:01:54 INFO compress.CodecPool: Got brand-new decompressor
> small.ints
rmr
> small.ints = to.dfs(1:10)
> out = mapreduce(input = small.ints, map = function(k,v) keyval(v, v^2))
Warning: $HADOOP_HOME is deprecated.
packageJobJar: [/tmp/RtmpKnwnj9/rhstr.map3fc53032703e, /tmp/RtmpKnwnj9/rmr-local-env,
/tmp/RtmpKnwnj9/rmr-global-env, /tmp/hadoop-root/hadoop-unjar3975456697311921286/] []
/tmp/streamjob3523992877229828328.jar tmpDir=null
12/06/01 22:54:15 INFO mapred.FileInputFormat: Total input paths to process : 1
12/06/01 22:54:16 INFO streaming.StreamJob: getLocalDirs(): [/tmp/hadoop-root/mapred/local]
12/06/01 22:54:16 INFO streaming.StreamJob: Running job: job_201206012240_0001
12/06/01 22:54:16 INFO streaming.StreamJob: To kill this job, run:
12/06/01 22:54:16 INFO streaming.StreamJob: /usr/local/hadoop/hadoop-1.0.2/libexec/../bin/hadoop job
-Dmapred.job.tracker=cudatest:9001 -kill job_201206012240_0001
12/06/01 22:54:16 INFO streaming.StreamJob: Tracking URL:
http://cudatest:50030/jobdetails.jsp?jobid=job_201206012240_0001
12/06/01 22:54:17 INFO streaming.StreamJob: map 0% reduce 0%
12/06/01 22:54:31 INFO streaming.StreamJob: map 100% reduce 0%
12/06/01 22:54:43 INFO streaming.StreamJob: map 100% reduce 100%
12/06/01 22:54:49 INFO streaming.StreamJob: Job complete: job_201206012240_0001
12/06/01 22:54:49 INFO streaming.StreamJob: Output: /tmp/RtmpKnwnj9/file3fc5272dca99
> result = from.dfs(out); result
Rhadoop 예제 (wordcount)
소스 코드
wordcount = function (input, output = NULL, pattern = " ") {
mapreduce(input = input ,
output = output,
input.format = "text",
map = function(k,v) {
lapply(
strsplit(
x = v,
split = pattern)[[1]],
function(w) keyval(w,1))},
reduce = function(k,vv) {
keyval(k, sum(unlist(vv)))}, combine = T)
}
Rhadoop 예제 (wordcount)
> file = to.dfs("I saw a saw saw a saw in a saw.", format="text")
> out = wordcount(file)
packageJobJar: [/tmp/RtmpSJ73OT/rhstr.map1a0966bb8d5a,
/tmp/RtmpSJ73OT/rhstr.reduce1a09315feee9, /tmp/RtmpSJ73OT/rhstr.combine1a091a3a4826,
/tmp/RtmpSJ73OT/rmr-local-env, /tmp/RtmpSJ73OT/rmr-global-env, /tmp/hadoop-hadoop/hadoop-
unjar4399993970582808045/] [] /tmp/streamjob7923541988067611842.jar tmpDir=null
… 중략 …
12/06/04 18:16:48 INFO streaming.StreamJob: /usr/local/hadoop/hadoop-1.0.2/libexec/../bin/hadoop job
-Dmapred.job.tracker=cudatest:9001 -kill job_201206012240_0014
12/06/04 18:16:48 INFO streaming.StreamJob: Tracking URL:
http://cudatest:50030/jobdetails.jsp?jobid=job_201206012240_0014
12/06/04 18:16:49 INFO streaming.StreamJob: map 0% reduce 0%
12/06/04 18:17:02 INFO streaming.StreamJob: map 50% reduce 0%
12/06/04 18:17:05 INFO streaming.StreamJob: map 100% reduce 0%
12/06/04 18:17:11 INFO streaming.StreamJob: map 100% reduce 33%
12/06/04 18:17:17 INFO streaming.StreamJob: map 100% reduce 100%
12/06/04 18:17:23 INFO streaming.StreamJob: Job complete: job_201206012240_0014
12/06/04 18:17:23 INFO streaming.StreamJob: Output: /tmp/RtmpSJ73OT/file1a096787a771
> result = from.dfs(out); result
> # out = wordcount("/user/hadoop/input/README.txt")
2.2 K-means Clustering
2.3 K-mer Counting
Q & A

More Related Content

What's hot

GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례
GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례
GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례
Gruter
 
하둡 타입과 포맷
하둡 타입과 포맷하둡 타입과 포맷
하둡 타입과 포맷
진호 박
 
Hadoop설명
Hadoop설명Hadoop설명
Hadoop설명
Ji Hoon Lee
 
알고 쓰자! HBase | Devon 2012
알고 쓰자!  HBase | Devon 2012알고 쓰자!  HBase | Devon 2012
알고 쓰자! HBase | Devon 2012
Daum DNA
 
Spark_Overview_qna
Spark_Overview_qnaSpark_Overview_qna
Spark_Overview_qna
현철 박
 

What's hot (20)

Tajo TPC-H Benchmark Test on AWS
Tajo TPC-H Benchmark Test on AWSTajo TPC-H Benchmark Test on AWS
Tajo TPC-H Benchmark Test on AWS
 
hadoop ch1
hadoop ch1hadoop ch1
hadoop ch1
 
Distributed Programming Framework, hadoop
Distributed Programming Framework, hadoopDistributed Programming Framework, hadoop
Distributed Programming Framework, hadoop
 
SQL-on-Hadoop with Apache Tajo, and application case of SK Telecom
SQL-on-Hadoop with Apache Tajo,  and application case of SK TelecomSQL-on-Hadoop with Apache Tajo,  and application case of SK Telecom
SQL-on-Hadoop with Apache Tajo, and application case of SK Telecom
 
빅데이터 구축 사례
빅데이터 구축 사례빅데이터 구축 사례
빅데이터 구축 사례
 
Hadoop Introduction (1.0)
Hadoop Introduction (1.0)Hadoop Introduction (1.0)
Hadoop Introduction (1.0)
 
GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례
GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례
GRUTER가 들려주는 Big Data Platform 구축 전략과 적용 사례: 인터넷 쇼핑몰의 실시간 분석 플랫폼 구축 사례
 
20180714 하둡 스터디 종료 보고 및 연구과제 발표자료
20180714 하둡 스터디 종료 보고 및 연구과제 발표자료20180714 하둡 스터디 종료 보고 및 연구과제 발표자료
20180714 하둡 스터디 종료 보고 및 연구과제 발표자료
 
Hadoop overview
Hadoop overviewHadoop overview
Hadoop overview
 
하둡 타입과 포맷
하둡 타입과 포맷하둡 타입과 포맷
하둡 타입과 포맷
 
Hadoop과 SQL-on-Hadoop (A short intro to Hadoop and SQL-on-Hadoop)
Hadoop과 SQL-on-Hadoop (A short intro to Hadoop and SQL-on-Hadoop)Hadoop과 SQL-on-Hadoop (A short intro to Hadoop and SQL-on-Hadoop)
Hadoop과 SQL-on-Hadoop (A short intro to Hadoop and SQL-on-Hadoop)
 
Hadoop설명
Hadoop설명Hadoop설명
Hadoop설명
 
하둡 설치(의사분산모드)
하둡 설치(의사분산모드)하둡 설치(의사분산모드)
하둡 설치(의사분산모드)
 
Hadoop발표자료
Hadoop발표자료Hadoop발표자료
Hadoop발표자료
 
알고 쓰자! HBase | Devon 2012
알고 쓰자!  HBase | Devon 2012알고 쓰자!  HBase | Devon 2012
알고 쓰자! HBase | Devon 2012
 
하둡 (Hadoop) 및 관련기술 훑어보기
하둡 (Hadoop) 및 관련기술 훑어보기하둡 (Hadoop) 및 관련기술 훑어보기
하둡 (Hadoop) 및 관련기술 훑어보기
 
Spark_Overview_qna
Spark_Overview_qnaSpark_Overview_qna
Spark_Overview_qna
 
HBase 훑어보기
HBase 훑어보기HBase 훑어보기
HBase 훑어보기
 
하둡 좋은약이지만 만병통치약은 아니다
하둡 좋은약이지만 만병통치약은 아니다하둡 좋은약이지만 만병통치약은 아니다
하둡 좋은약이지만 만병통치약은 아니다
 
Hdfs
HdfsHdfs
Hdfs
 

Similar to 5일차.map reduce 활용

2012 빅데이터 big data 발표자료
2012 빅데이터 big data 발표자료2012 빅데이터 big data 발표자료
2012 빅데이터 big data 발표자료
Wooseung Kim
 
google dinos
google dinosgoogle dinos
google dinos
juhyun
 

Similar to 5일차.map reduce 활용 (20)

빅데이터, big data
빅데이터, big data빅데이터, big data
빅데이터, big data
 
Mahout
MahoutMahout
Mahout
 
Apache Htrace overview (20160520)
Apache Htrace overview (20160520)Apache Htrace overview (20160520)
Apache Htrace overview (20160520)
 
[코세나, kosena] 금융권의 머신러닝 활용사례
[코세나, kosena] 금융권의 머신러닝 활용사례[코세나, kosena] 금융권의 머신러닝 활용사례
[코세나, kosena] 금융권의 머신러닝 활용사례
 
DeView2013 Big Data Platform Architecture with Hadoop - Hyeong-jun Kim
DeView2013 Big Data Platform Architecture with Hadoop - Hyeong-jun KimDeView2013 Big Data Platform Architecture with Hadoop - Hyeong-jun Kim
DeView2013 Big Data Platform Architecture with Hadoop - Hyeong-jun Kim
 
Cuda intro
Cuda introCuda intro
Cuda intro
 
Introduction to ankus(data mining and machine learning open source)
Introduction to ankus(data mining and machine learning open source)Introduction to ankus(data mining and machine learning open source)
Introduction to ankus(data mining and machine learning open source)
 
빅데이터 기술 현황과 시장 전망(2014)
빅데이터 기술 현황과 시장 전망(2014)빅데이터 기술 현황과 시장 전망(2014)
빅데이터 기술 현황과 시장 전망(2014)
 
Big Data Overview
Big Data OverviewBig Data Overview
Big Data Overview
 
Cloudera Impala 1.0
Cloudera Impala 1.0Cloudera Impala 1.0
Cloudera Impala 1.0
 
2012 빅데이터 big data 발표자료
2012 빅데이터 big data 발표자료2012 빅데이터 big data 발표자료
2012 빅데이터 big data 발표자료
 
[D2 COMMUNITY] Spark User Group - 스파크를 통한 딥러닝 이론과 실제
[D2 COMMUNITY] Spark User Group - 스파크를 통한 딥러닝 이론과 실제[D2 COMMUNITY] Spark User Group - 스파크를 통한 딥러닝 이론과 실제
[D2 COMMUNITY] Spark User Group - 스파크를 통한 딥러닝 이론과 실제
 
2017 주요 기술 흐름 및 개요
2017 주요 기술 흐름 및 개요2017 주요 기술 흐름 및 개요
2017 주요 기술 흐름 및 개요
 
데이터 분석 프로세스
데이터 분석 프로세스데이터 분석 프로세스
데이터 분석 프로세스
 
DB관점에서 본 빅데이터 (2019년 8월)
DB관점에서 본 빅데이터 (2019년 8월)DB관점에서 본 빅데이터 (2019년 8월)
DB관점에서 본 빅데이터 (2019년 8월)
 
google dinos
google dinosgoogle dinos
google dinos
 
I rods분석(20170313,01,김선태)
I rods분석(20170313,01,김선태)I rods분석(20170313,01,김선태)
I rods분석(20170313,01,김선태)
 
Scalable system design patterns
Scalable system design patternsScalable system design patterns
Scalable system design patterns
 
Jco 소셜 빅데이터_20120218
Jco 소셜 빅데이터_20120218Jco 소셜 빅데이터_20120218
Jco 소셜 빅데이터_20120218
 
Apache spark 소개 및 실습
Apache spark 소개 및 실습Apache spark 소개 및 실습
Apache spark 소개 및 실습
 

More from 주영 송

Regression &amp; Classification
Regression &amp; ClassificationRegression &amp; Classification
Regression &amp; Classification
주영 송
 
MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)
MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)
MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)
주영 송
 
SNA & R (20121011)
SNA & R (20121011)SNA & R (20121011)
SNA & R (20121011)
주영 송
 
Recommendation system 소개 (1)
Recommendation system 소개 (1)Recommendation system 소개 (1)
Recommendation system 소개 (1)
주영 송
 
Cloud burst tutorial
Cloud burst tutorialCloud burst tutorial
Cloud burst tutorial
주영 송
 
Cloud burst 소개
Cloud burst 소개Cloud burst 소개
Cloud burst 소개
주영 송
 
Mongo db 활용 가이드 ch7
Mongo db 활용 가이드 ch7Mongo db 활용 가이드 ch7
Mongo db 활용 가이드 ch7
주영 송
 

More from 주영 송 (10)

R_datamining
R_dataminingR_datamining
R_datamining
 
Giraph
GiraphGiraph
Giraph
 
Regression &amp; Classification
Regression &amp; ClassificationRegression &amp; Classification
Regression &amp; Classification
 
MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)
MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)
MapReduce 실행 샘플 (K-mer Counting, K-means Clustering)
 
SNA & R (20121011)
SNA & R (20121011)SNA & R (20121011)
SNA & R (20121011)
 
Recommendation system 소개 (1)
Recommendation system 소개 (1)Recommendation system 소개 (1)
Recommendation system 소개 (1)
 
Cloud burst tutorial
Cloud burst tutorialCloud burst tutorial
Cloud burst tutorial
 
Cloud burst 소개
Cloud burst 소개Cloud burst 소개
Cloud burst 소개
 
R intro
R introR intro
R intro
 
Mongo db 활용 가이드 ch7
Mongo db 활용 가이드 ch7Mongo db 활용 가이드 ch7
Mongo db 활용 가이드 ch7
 

5일차.map reduce 활용

  • 2. 목차 1. MapReduce 활용 1. 데이터 분석가 2. 계산 집약적 연산 3. OLAP 분석 4. 복잡한 분석 로직 구현 5. 각종 도메인 특화 기술 구현 2. 데모 1. RHadoop 2. K-means Clustering 3. K-mer Count
  • 3. 1.1 데이터 분석가 • 기존의 데이터 분석가도 빅데이터 분석을 위해 Hadoop을 활용할 수 있다. • R과 Hadoop을 연동하는 여러 가지 방법에 대해 알아본다. • 이러한 접근법의 장점과 그 한계점은 무엇인가?
  • 4. 전통적인 데이터 분석 도구 • 엑셀 • DBMS, DW • SAS • SPSS • R
  • 5. 빅데이터 분석 • R – SAS, SPSS의 대안 – 오픈소스, 최신 기술 적용 • Hadoop – 대용량 데이터를 위한 파일 시스템 – 분산 컴퓨팅 프레임워크 – (비교적) 검증된 기술 • R + Hadoop – R의 분석 능력, Visualization 능력 – Hadoop의 대용량 데이터 처리 능력
  • 6. R + Hadoop = ? • Iterative vs. batch processing • In-memory vs. in parallel
  • 7. R + Hadoop =  • HDFS, HBase 활용 • MapReduce 정제 데이터 접근
  • 8. R + Hadoop =  • MapReduce 직접 연동 – apply family 작업 • crosstabs, summaries, data transformations – 기타 복잡한 알고리즘들 • K-Means clustering, logistic regression, … – 대용량 데이터 Visualization
  • 9. RHadoop • Collection of three R packages that allow users to manage and analyze data with Hadoop. • RHadoop consists of the following packages: – rmr - functions providing Hadoop MapReduce functionality in R – rhdfs - functions providing file management of the HDFS from within R – rhbase - functions providing database management for the HBase distributed database from within R
  • 11. RHadoop의 장점 • 기존의 데이터 분석가도 Big Data 처리 가능 • 분석 결과 향상 – 간단한 모델 + 대용량 데이터 – 복잡한 모델 + 적은 데이터 • 벤더 종속성 탈피
  • 12. 1.2 계산 집약적 연산 • Data Intensive & Compute Intensive computation • 대용량 데이터에 대해 계산 집약적 연산의 수행이 필요할 경우 Hadoop과 CUDA를 활용하여 빠르게 처리할 수 있다. • Linear Algebra 연산 적용 시 문제점과 개선 방안
  • 14. 출처 : The Free Lunch Is Over
  • 15. n = 10000 Back of the envelope calculation
  • 16. • Evolution in performance of processor designs 출처 : Matrix Computations onGraphics Processors andClusters of GPUs
  • 17. CUDA • Compute Unified Device Architecture – NVIDIA’s parallel computing architecture – computing engine in Nvidia graphics processing units (GPUs) that is accessible to software developers through variants of industry standard programming languages. • GPU를 이용한 범용적인 프로그램을 개발할 수 있 도록 ‘프로그램 모델’, ‘프로그램 언어’, ‘컴파일러’, ‘라이브러리’, ‘디버거’, ‘프로파일러’를 제공하는 통 합 환경 출처 : http://en.wikipedia.org/wiki/CUDA
  • 18. vs • Sequential, complex data dependency 를 가진 code 수행에 적합 • 트랜지스터의 많은 부분을 – control logic : 비순차실행 제어, 분기 예 측 핸들링 – cache memory : reference의 지역성 이 용, 메모리 접근 지연 감춤 • 최적의 floating-point throughput을 뽑 아내기 위해 arithmetic unit 부분 확장 • memory bandwidth가 훨씬 크다 • high degree of data parallelism (embarrassingly parallel) • 분기가 없고, 메모리 트랜젝션당 계산 량이 많은 계산 집약적인 프로그램
  • 19. n = 10000 Back of the envelope calculation
  • 20. 분산/병렬 컴퓨팅 • 병렬 아키텍처 출처 : http://webedu.ksc.re.kr/data/data/02.ParallelPrograming.pdf
  • 21. 분산/병렬 컴퓨팅 출처 : https://computing.llnl.gov/tutorials/parallel_comp/ • 공유 메모리 구조 • 분산 메모리 구조 • 하이브리드 구조
  • 22. 병렬 프로그래밍 모델 • 공유메모리 병렬 프로그래밍 모델 – 공유 메모리 아키텍처에 적합 – 다중 스레드 프로그램 – OpenMP, Pthreads • 메시지 패싱 병렬 프로그래밍 모델 – 분산 메모리 아키텍처에 적합 – MPI, PVM • 하이브리드 병렬 프로그래밍 모델 – 분산-공유 메모리 아키텍처 – OpenMP + MPI
  • 23. 병렬 프로그래밍 모델 H/W SMP machine Cluster machine SMP Cluster GPU machine GPU cluster S/W OpenMP MPI MPI + OpenMP CUDA MPI/OpenMP + CUDAMPI/OpenMP MapReduce Pregel…
  • 27.
  • 28.
  • 29. CUDA-MapReduce 연동 방법 • 별첨 자료 (MapReduce-CUDA 연동.docx) 참고
  • 30. CUDA-MapReduce 연동 효과 • 성능 향상 효과
  • 31. CUDA-MapReduce 연동 한계 • Matrix-Matrix 곱셈
  • 32. Parallel Matrix Multiplication • Node 간 데이터 전송이 필요한 경우 – Pregel 활용 (ex. CUDA-Giraph 연동)
  • 33. Parallel Matrix Multiplication • Node 간 데이터 전송이 필요한 경우 – Pregel 활용 (ex. CUDA-Giraph 연동)
  • 36. 1.4 복잡한 분석 로직 구현 • 대용량 데이터에서 가치 있는 정보를 얻기 위해 Hadoop을 이용하여 각종 기 계학습 알고리즘을 구현할 수 있다. • Hadoop, Mahout을 이용하여 간단한 추천 시스템을 구현할 수 있다.
  • 37. 분석 기반 기술 • 데이터분석 : 축적된 대량의 데이터를 다양한 형태로 가공하여 업무에 숨어있는 과제와 문제점을 밝히고, 과제와 문제점의 요 인을 분석해서 대책을 세우고 개선하는 활동을 말한다. • 데이터마이닝 : 데이터 마이닝은 데이터를 분석해서 패턴을 발 견하고 예측 모델을 만드는 자동화된 프로세스다. 수학, 통계, 기계학습 등 다양한 연구 영역에 기초를 두고 있다. • 기계학습 : 컴퓨터가 스스로 학습하게 하는 알고리즘에 관련된 인공지능의 한 영역. 주어진 데이터의 집합(트레이닝 데이터) 을 이용해서 데이터의 속성에 관한 정보를 추론하는 알고리즘 이다. 이 정보를 이용하여 미래에 발견될 다른 데이터(테스트 데이터)에 관한 예측이 가능
  • 38. 용어 정리 • 데이터 분석 : 이미 알려진 모델에 데이터가 적합한지를 다루는 개념 – 데이터의 조회, 요약, 경향 분석하는 작업 – 리포팅, OLAP 등 • 데이터 마이닝 : 데이터를 분석해서 이전에 알려지지 않은 패턴이나 모델을 발굴하는데 목적을 둠. • 둘 다 비즈니스 인텔리전스의 분야다.
  • 40. 데이터 마이닝 • 데이터마이닝은 데이터베이스를 훈련 데이터로 간주하여 수학, 통계학, 기계학습 기법의 알고리 즘을 이용해 유용한 정보를 도출해내는 과정을 말 한다.
  • 43. Clustering • Cluster – Object 들의 집합 – 비슷한 object끼리 같은 cluster에 묶음 • Clustering Algorithm – 개체 (object) 집합을 여러 개의 group 으로 묶는 알고 리즘 • Requirements for Clustering Task a.개체를 벡터로 표현할 feature 를 정의 b.두 개체의 가까운 정도를 측정할 measure를 정의 c.클러스터링을 수행할 알고리즘을 정의
  • 44. Clustering • Clustering – Vector distance는 최대한 가깝게 – Cluster distance는 최대한 멀게 Vector Distance (between vectors) Distance (between clusters) Cluster
  • 45. K-Means Clustering • 주어진 데이터를 k개의 클러스터로 묶는 알고리즘 • 각 클러스터와 거리 차이의 분산을 최소화 하는 방식으로 동작 • 즉, 주어진 데이터를 가장 거리가 가까운 것들끼리 k개의 클러스터로 군집하여 모든 데이터와 해당 클러스터의 centroid와의 거리합이 최 소가 되도록 반복연산 • 초기 seed는 랜덤하게 선택하여도 반복연산(iteration) 과정에서 어느 정도 적절한 중심값을 찾아가게 되지만 항상 옳지는 않으므로 canopy와 같은 rough한 알고리즘을 사용하거나 휴리스틱하게 초기 값을 선정함 • 클러스터 수 k와 수렴 임계값을 사용자가 결정해 주어야 하며 모든 데 이터는 단 하나의 클러스터에만 소속될 수 있음.
  • 46. K-Means Clustering 1) 모든 D의 엘리먼트에 대해서 주어진 초기 seed 중 가 장 가까운 것을 찾고 추가 2) Seed C를 소속된 엘리먼트들의 평균으로 업데이트 3) C와 소속 엘리먼트들과의 거리의 합이 수렴임계값(th) 보다 작을 때까지 반복 given, dataSet D(1,2,...n) & seed C(1,2,...,k) & convergence delta th Repeat 1)For each D, find nearest centroid in C and Add to C 2)Update C (calculate new centroids) 3)sum over all distance between D and corresponding C Until sum < th
  • 47. K-Means Clustering 1. Initial Centroid (randomly selected) 2. Clustering (using distance) 3. Recalculate Centroid (if converged : go to 4) (if not converged : go to 2) 4. Done
  • 48. K-Means Clustering 구현 • 총 4개의 Mapper와 Reducer로 구성되어 있으며, 전체 과 정은 크게 3가지 MapReduce 작업으로 이루어진다. – generateSeed( ) : 최초 seed로 사용할 centroid를 생성 – kmeansIter( ) : centroid를 갱신하며 clustering. 반복 수행함 – resultKmeans( ) : 최종 결과 생성
  • 49. K-Means Clustering 구현 • KmeansMapper – setup( )
  • 50. K-Means Clustering 구현 • KmeansMapper – map ( )
  • 51. K-Means Clustering 구현 • KmeansReducer – reduce ( )
  • 52. K-Means Clustering 결과 출처 : http://spiderspace.wordpress.com/2012/03/26/mapreduce-in-r/
  • 53. Mahout • Apache Mahout is an Apache project to produce free implementations of distributed or otherwise scalable machine learning algorithms on the Hadoop platform. - Wikipedia
  • 54. Mahout • Supported Algorithms – Classification – Clustering – Regression – Recommender / Collaborative Filtering – Dimension Reduction – Similarity Vectors – Evolutionary Algorithms – Pattern Mining – …
  • 55. Mahout • Supported Algorithms – Classification – Clustering – Regression – Recommender / Collaborative Filtering – Dimension Reduction – Similarity Vectors – Evolutionary Algorithms – Pattern Mining – …
  • 56. 추천 시스템 • brick-and-mortar vs. on-line • 다양한 사용자들에 대해 구매할 확률이 높 은 아이템들을 찾아내는 것이 중요한 이슈 Off-line On-line 물리적 공간의 제약 물리적 공간 제약 없음 제한된 고객 수 고객 수의 제한 없음 Pareto(80/20) 법칙 Long tail 법칙 개인화 불가능 개인화 가능
  • 57. Brick-and-mortar • 시,공간의 제약이 존재 – 슈퍼마켓 – 교보문고 – 종이 신문 • 전통적인 파레토 법칙을 따름 • 적합한 방식 : 베스트셀러 추천
  • 58. On-line • 시,공간의 제약이 없음(or 약함) – 멜론 – 아마존 – 온라인 뉴스 사이트 • Long-tail 법칙을 따름 • 적합한 방식 : 검색, 개인화 서비스
  • 59. 추천 시스템 • Utility Matrix • Utility Matrix의 공백을 채우는 것이 추천 시 스템의 본질
  • 60. 추천 시스템 분류 • Recommendation Systems – 컨텐츠 기반(Content-based) system – 협업 필터링(Collaborative filtering) system • Memory-based – User-based CF – Item-based CF • Model-based CF • 일반적인 성능 및 결과 비교 Content-based < User-based CF <= Item-based CF < Model-based
  • 61. Content-based RS • 가장 직관적인 방법 – 특정 속성을 선호하는 사람에게 비슷한 속성을 가진 아 이템을 추천 • 아이템 자체 특성을 반영하는 프로파일에 근거하 여 유사도를 측정하고 추천 사용자 아이템아이템 메타데이터 아이템 메타데이터 구매 업데이트
  • 62. User Based CF  Concept : 나와 비슷한 취향의 사람이 구매한 책 추천.  Flow 1) Data Model 생성 - User와 Item간의 Utility Matrix로 표현 2) User Similarity 계산 - User가 평가한 공통 Item을 기반으로 User간 유사도 계산 - Euclidean Distance, Jaccard Distance, Cosine Similarity 등 3) 선호도 예측 및 추천 - Query User 와 유사한 N-Neighbor 선택 - N-Neighbor와 Query User간의 유사도와 N-Neighbor가 선택한 Item 에 대한 선호도를 기반으로 Query User의 Item에 대한 선호도 예측 - 높은 점수를 받은 Item들을 Query User에게 추천
  • 63. User Based CF  Similarity - Jaccard Similarity Coefficient : UserA와 UserB가 구매 항목들 중 공통으로 구매한 항목의 비율  선호도 예측 A B Px(I) = PA(I)*SAX + PBX(I)*SBX + ….. Px(I) : UserX의 Item I에 대한 선호도 Sx1x2 : UserX1과 User X2의 유사도
  • 64. 유사도 • Jaccard similarity coefficient • Euclidean distance similarity • Cosine similarity • Pearson correlation coefficient • Log-likelihood-based similarity • …
  • 66. 1.5 도메인 특화 기술 구현 • 대용량 CDR 데이터, SNS 사용자 데이터, e-mail 데이터 등을 이용하여 소셜 네트워크 분석을 수행할 수 있다. • Bioinformatics 분야의 각종 알고리즘들이 대용량 데이터 처리를 위하여 Hadoop을 이용하고 있는 추세이다.
  • 67. CloudBurst • CloudBurst : Highly Sensitive Short Read Mapping with MapReduce • New parallel read-mapping algorithm optimized for mapping NGS data to the human genome and other reference genomes • SNP discovery, genotyping, and personal genomics
  • 68. CloudBurst • It is modeled after the short read mapping program RMAP • Reports either all alignments or the unambiguous best alignment for each read with any number of mismatches or differences • This level of sensitivity could be prohibitively time consuming, but CloudBurst uses the open-source Hadoop implementation of MapReduce to parallelize execution using multiple compute nodes.
  • 69. CloudBurst • Running time – scales linearly with the number of reads mapped – with near linear speedup as the number of processors increases. • CloudBurst reduces the running time from hours to mere minutes for typical jobs involving mapping of millions of short reads to the human genome.
  • 70. Algorithm Overview • CloudBurst uses seed-and-extend algorithms to map reads to a reference genome. • Seed – k differences : the alignment must have a region of length s=r/k+1 called a seed that exactly matches the reference. • Extend – CloudBurst attempts to extend the alignment into an end-to-end alignment with at most k mismatches or differences
  • 71. Algorithm Overview • CloudBurst uses the Hadoop implementation of MapReduce to catalog and extend the seeds • Map phase emits – all length-s k-mers from the reference sequences – all non-overlapping length-s kmers from the reads • Shuffle phase – read and reference kmers are brought together • Reduce phase – the seeds are extended into end-to-end alignments
  • 73. K-mer 분석 • K-mer : 길이가 k인 염기서열내의 연속된 염기 Ex) ACGTACGTACGTACGTACGTACGT AAAAAA … ACGTAC … CGTACG … … GTACGT … TACGTA … TTTTTT 0 1 0 0 0 0 ACGTAC
  • 74. K-mer 분석 • K-mer : 길이가 k인 염기서열내의 연속된 염기 Ex) ACGTACGTACGTACGTACGTACGT AAAAAA … ACGTAC … CGTACG … … GTACGT … TACGTA … TTTTTT 0 3 3 3 3 0 TACGTA
  • 75. 유전체 분석 실습 별첨 자료 (CloudBurst Tutorial.docx) 참고
  • 76. SNA 분석 • 별첨 자료 (SNA&R.pptx) 참고
  • 78. R 설치 # rpm -Uvh http://dl.fedoraproject.org/pub/epel/6/x86_64/epel-release-6-8.n oarch.rpm # yum install R
  • 79. RHadoop 설치 # su - # RHadoop 패키지 설치 작업은 root 계정으로 # wget --no-check-certificate https://github.com/downloads/RevolutionAnalytics/RHadoop/rmr2_2.0.2.tar.gz # wget --no-check-certificate https://github.com/downloads/RevolutionAnalytics/RHadoop/rhdfs_1.0.5.tar.gz # export JAVA_HOME=/usr/local/jdk-<version> # 각자 환경에 맞게 수정할 것! # export HADOOP_HOME=/home/hadoop/hadoop # export HADOOP_CONF=$HADOOP_HOME/conf # export HADOOP_CMD=$HADOOP_HOME/bin/hadoop # export HADOOP_STREAMING=$HADOOP_HOME/contrib/streaming/hadoop-streaming-<version>.jar # R CMD javareconf # R > install.packages(c('Rcpp', 'RJSONIO', 'itertools', 'digest', 'functional', 'stringr', 'plyr')) > q() # R CMD INSTALL rhdfs_1.0.5.tar.gz # Hadoop이 실행중인 상태에서 설치해야함 # R CMD INSTALL rmr2_2.0.2.tar.gz
  • 80. rhdfs • File Manipulations hdfs.copy, hdfs.move, hdfs.rename, hdfs.delete, hdfs.rm, hdfs.del, hdfs.chown, hdfs.put, hdfs.get • File Read/Write hdfs.file, hdfs.write, hdfs.close, hdfs.flush, hdfs.read, hdfs.seek, hdfs.tell, hdfs.line.reader, hdfs.read.text.file • Directory hdfs.dircreate, hdfs.mkdir • Utility hdfs.ls, hdfs.list.files, hdfs.file.info, hdfs.exists • Initialization hdfs.init, hdfs.defaults
  • 81. rhdfs (serialize) # su - hadoop # RHadoop 패키지 테스트는 hadoop 계정으로 # export HADOOP_HOME=/home/hadoop/hadoop # 각자 환경에 맞게 수정 # export HADOOP_CONF=$HADOOP_HOME/conf # export HADOOP_CMD=$HADOOP_HOME/bin/hadoop # export HADOOP_STREAMING=$HADOOP_HOME/contrib/streaming/hadoop-streaming-<version>.jar $ R > library(rhdfs) > hdfs.init() Loading required package: rJava HADOOP_HOME=/home/hadoop/hadoop HADOOP_CONF=/home/hadoop/hadoop/conf > model = lm(weight~height, women) > model > modelfilename <- "model_file" > modelfile <- hdfs.file(modelfilename, "w") > hdfs.write(model, modelfile) [1] TRUE > hdfs.close(modelfile) [1] TRUE > hdfs.ls('/user/hadoop') permission owner group size modtime file 1 drwxr-xr-x hadoop supergroup 0 2012-06-04 15:53 /user/hadoop/input 2 -rw-r--r-- hadoop supergroup 3670 2012-06-04 18:36 /user/hadoop/model_file
  • 82. rhdfs (deserialize) $ R # hadoop 계정으로 R 실행 > library(rhdfs) Loading required package: rJava > modelfile = hdfs.file(modelfilename, "r") > modelfile DFS File: model_file [blocksize=67108864, replication=1, buffersize=5242880, mode='r'] > m <- hdfs.read(modelfile) > model <- unserialize(m) > model > hdfs.close(modelfile) [1] TRUE > hdfs.delete('/user/hadoop/model_file') Deleted hdfs://cudatest:9000/user/hadoop/model_file [1] TRUE > hdfs.ls('/user/hadoop') permission owner group size modtime file 1 drwxr-xr-x hadoop supergroup 0 2012-06-04 15:53 /user/hadoop/input >
  • 83. rhdfs 활용 예 • Hadoop wordcount 결과를 이용하여 wordcloud 생성 • 오른쪽 그림은 $HADOOP_HOME의 README.txt 파일에 대한 수행 결과 $ bin/hadoop jar hadoop-examples-1.0.2.jar wordcount WordCount/input WordCount/output $ R > library(rhdfs) > library(wordcloud) > m<-hdfs.line.reader("/user/hadoop/WordCount/output/part-r-00000") > lines <- m$read(); > splt <- strsplit(lines, split='t') > m <- matrix(unlist(splt), byrow=TRUE, ncol=2) > df <- data.frame(m) > pal <- brewer.pal(8,"Dark2") > wordcloud(df$X1, freq=tapply(df$X1, df$X2), min.freq=2, random.order=T,rot.per=.1,colors=pal)
  • 84. rmr • This R package allows an R programmer to perform statistical analysis via MapReduce on a Hadoop cluster. > library(rmr2) 요구된 패키지 RJSONIO를 로드중입니다 요구된 패키지 itertools를 로드중입니다 요구된 패키지 iterators를 로드중입니다 요구된 패키지 digest를 로드중입니다 > small.ints = to.dfs(1:10) 12/06/01 22:51:07 INFO util.NativeCodeLoader: Loaded the native-hadoop library 12/06/01 22:51:07 INFO zlib.ZlibFactory: Successfully loaded & initialized native-zlib library 12/06/01 22:51:07 INFO compress.CodecPool: Got brand-new compressor > small.ints = from.dfs(small.ints) 12/06/04 19:01:54 INFO util.NativeCodeLoader: Loaded the native-hadoop library 12/06/04 19:01:54 INFO zlib.ZlibFactory: Successfully loaded & initialized native-zlib library 12/06/04 19:01:54 INFO compress.CodecPool: Got brand-new decompressor > small.ints
  • 85. rmr > small.ints = to.dfs(1:10) > out = mapreduce(input = small.ints, map = function(k,v) keyval(v, v^2)) Warning: $HADOOP_HOME is deprecated. packageJobJar: [/tmp/RtmpKnwnj9/rhstr.map3fc53032703e, /tmp/RtmpKnwnj9/rmr-local-env, /tmp/RtmpKnwnj9/rmr-global-env, /tmp/hadoop-root/hadoop-unjar3975456697311921286/] [] /tmp/streamjob3523992877229828328.jar tmpDir=null 12/06/01 22:54:15 INFO mapred.FileInputFormat: Total input paths to process : 1 12/06/01 22:54:16 INFO streaming.StreamJob: getLocalDirs(): [/tmp/hadoop-root/mapred/local] 12/06/01 22:54:16 INFO streaming.StreamJob: Running job: job_201206012240_0001 12/06/01 22:54:16 INFO streaming.StreamJob: To kill this job, run: 12/06/01 22:54:16 INFO streaming.StreamJob: /usr/local/hadoop/hadoop-1.0.2/libexec/../bin/hadoop job -Dmapred.job.tracker=cudatest:9001 -kill job_201206012240_0001 12/06/01 22:54:16 INFO streaming.StreamJob: Tracking URL: http://cudatest:50030/jobdetails.jsp?jobid=job_201206012240_0001 12/06/01 22:54:17 INFO streaming.StreamJob: map 0% reduce 0% 12/06/01 22:54:31 INFO streaming.StreamJob: map 100% reduce 0% 12/06/01 22:54:43 INFO streaming.StreamJob: map 100% reduce 100% 12/06/01 22:54:49 INFO streaming.StreamJob: Job complete: job_201206012240_0001 12/06/01 22:54:49 INFO streaming.StreamJob: Output: /tmp/RtmpKnwnj9/file3fc5272dca99 > result = from.dfs(out); result
  • 86. Rhadoop 예제 (wordcount) 소스 코드 wordcount = function (input, output = NULL, pattern = " ") { mapreduce(input = input , output = output, input.format = "text", map = function(k,v) { lapply( strsplit( x = v, split = pattern)[[1]], function(w) keyval(w,1))}, reduce = function(k,vv) { keyval(k, sum(unlist(vv)))}, combine = T) }
  • 87. Rhadoop 예제 (wordcount) > file = to.dfs("I saw a saw saw a saw in a saw.", format="text") > out = wordcount(file) packageJobJar: [/tmp/RtmpSJ73OT/rhstr.map1a0966bb8d5a, /tmp/RtmpSJ73OT/rhstr.reduce1a09315feee9, /tmp/RtmpSJ73OT/rhstr.combine1a091a3a4826, /tmp/RtmpSJ73OT/rmr-local-env, /tmp/RtmpSJ73OT/rmr-global-env, /tmp/hadoop-hadoop/hadoop- unjar4399993970582808045/] [] /tmp/streamjob7923541988067611842.jar tmpDir=null … 중략 … 12/06/04 18:16:48 INFO streaming.StreamJob: /usr/local/hadoop/hadoop-1.0.2/libexec/../bin/hadoop job -Dmapred.job.tracker=cudatest:9001 -kill job_201206012240_0014 12/06/04 18:16:48 INFO streaming.StreamJob: Tracking URL: http://cudatest:50030/jobdetails.jsp?jobid=job_201206012240_0014 12/06/04 18:16:49 INFO streaming.StreamJob: map 0% reduce 0% 12/06/04 18:17:02 INFO streaming.StreamJob: map 50% reduce 0% 12/06/04 18:17:05 INFO streaming.StreamJob: map 100% reduce 0% 12/06/04 18:17:11 INFO streaming.StreamJob: map 100% reduce 33% 12/06/04 18:17:17 INFO streaming.StreamJob: map 100% reduce 100% 12/06/04 18:17:23 INFO streaming.StreamJob: Job complete: job_201206012240_0014 12/06/04 18:17:23 INFO streaming.StreamJob: Output: /tmp/RtmpSJ73OT/file1a096787a771 > result = from.dfs(out); result > # out = wordcount("/user/hadoop/input/README.txt")
  • 88. 2.2 K-means Clustering 2.3 K-mer Counting
  • 89. Q & A