Amino acids link together through peptide bonds to form proteins. The specific sequence of amino acids is determined by the DNA sequence. mRNA carries this code from DNA to the ribosome where tRNA brings the correct amino acids. Weak hydrogen bonds allow proteins to fold into complex 3D shapes like coils, pleats, and sheets that enable their many functions. Lipids are insoluble in water and include triglycerides, phospholipids, and cholesterol. Triglycerides store energy and are made of a glycerol molecule bonded to three fatty acid chains. Phospholipids form the structure of cell membranes with a hydrophilic head and hydrophobic tails. Carbohydrates include monosaccharides, disaccharides, and

2.  20 essential amino acids
 Linked together to make proteins
 Made of amine group, carboxylic
acid, and R group (side chain)

3.  Sequence of amino acids
 Depends on the DNA sequence
› mRNA is formed by pairing with DNA
› mRNA is then read by the ribosome
› tRNA with the mRNA to bring correct amino acid
to the right place
› as more tRNA comes in the amino acids produced
are then connected with a peptide bond
 ACAAUGGAACAUAGAUACAUA

4.  ACAAUGGAACAUAGAUACAUA

5.  Uses “weak” hydrogen bonds to form
 Types:
› Coils
› Pleats/sheets

6.  “Folding” of proteins
› Occur because different attractions
(bonds) form between alpha helices
and beta sheets

7.  2 or more amino acids put together
 Multiple tertiary proteins

9. Lipids

10.  Organic molecule insoluble in water
 3 types:
› Neutral fats (triglycerides)
› Phospholipids (cell membrane)
› Cholesterol

11.  Triglycerides
› 3 fatty acid chains
 Saturated/Unsaturated
› Glycerol molecule
 Store energy
 Insulate body tissue
 Protects organs

14.  Modified triglycerides
 Nonpolar fatty acid chain = tail
› Hydrophobic (“fears” water)
 Polar phosphate = head
› Hydrophilic (“loves” water)

15.  4 connected Carbon rings
 Stabilizes cell membranes

16. Carbohydrates

17.  Organic compound made of Carbon,
Hydrogen, & Oxygen in ratio of
› 1C : 2H : 1O
 Used for energy storage
 3 types:
› Monosaccharides
› Disaccharides
› Polysaccharides

18.  Simple sugars
 Soluble in water
 Examples: Glucose &Galactose

19.  Two monosaccharide sugars linked
together by dehydration synthesis
 Soluble in water
 Example: Sucrose

20.  More than 2 sugars linked together
 Formed by dehydration synthesis
 Usually not soluble in water
 Examples: Starch, cellulose, & Glycogen
 Starch:
› Sugars the same way
› Primary source of calories
 Cellulose:
› Sugars are opposite every other one
 Glycogen:
› Sugars are branched

21.  Monomers joined together to make
polymers
› Loss of water when they are joined
› Electrons are rearranged
› New bond is formed

22.  Adding water to a polymer to break it
apart

23.  Synthesis reactions: combining atoms
› Anabolic reactions
› Require more energy than produced
 Decomposition reactions: breaking apart
› Catabolic reactions
› More energy released than needed