Diese Präsentation wurde erfolgreich gemeldet.
Wir verwenden Ihre LinkedIn Profilangaben und Informationen zu Ihren Aktivitäten, um Anzeigen zu personalisieren und Ihnen relevantere Inhalte anzuzeigen. Sie können Ihre Anzeigeneinstellungen jederzeit ändern.
‫علمية‬ ‫نشرة‬
‫المركزي‬ ‫المختبر‬ ‫في‬ ‫الفنية‬ ‫و‬ ‫العلمية‬ ‫الوحدة‬
‫داغستاني‬ ‫عبدالعزيز‬ ‫حسن‬ ‫مها‬ .‫د‬
‫العتيبي‬ ...
‫و‬ ‫الجينية‬ ‫السباب‬
‫العظام‬ ‫لهشاشة‬ ‫الهرمونية‬
‫مقدمة‬‫مقدمة‬
•‫سلوك‬ ‫من‬ ‫بها‬ ‫يحيط‬ ‫ما‬ ‫بكل‬ ‫الحديثة‬ ‫العصرية‬ ‫الحياة‬ ‫في‬
‫غذائي‬‫بيئية‬ ‫وعوامل‬‫ضمن‬ ‫العظام...
‫العظام‬ ‫هشاشة‬
‫كلمة‬ ‫تعنى‬‫العظام‬ ‫ترقق‬( ‫العظام‬ ‫)هشاشة‬
‫يجعلها‬ ‫مما‬ ‫العظام‬ ‫لكتلة‬ ‫التدريجى‬ ‫الفقدان‬
‫سم...
‫الصامت‬ ‫اللص‬
•‫العظام‬ ‫هشاشة‬‫تظهر‬ ‫ل‬ ،‫حقا‬ ‫صامت‬ ‫مرض‬
‫ان‬ ‫اذ‬ ،‫كثيرا‬ ‫تقدمه‬ ‫بعد‬ ‫ال‬ ‫اعراضه‬
‫أي‬ ‫يولد‬...
‫كسر‬ ‫فان‬ ،‫للنساء‬ ‫كما‬ ،‫الرجال‬ ‫ولدى‬
‫الفقري‬ ‫العمود‬‫الشائعة‬ ‫النتائج‬ ‫اكثر‬ ‫هو‬
.‫العظام‬ ‫لهشاشة‬
‫التدري...
‫وضعية‬ ‫فان‬ ‫للمرض‬ ‫المتقدمة‬ ‫الحالت‬ ‫وفي‬‫المنحنية‬ ‫النتصاب‬‫المعهودة‬
‫و‬‫البارز‬ ‫الخصر‬‫بسبب‬ ‫الفقري‬ ‫العمود‬...
‫العظام‬ ‫هشاشة‬ ‫أنواع‬
•‫مرض‬‫العظام‬ ‫هشاشة‬‫يشمل‬ ‫أولها‬ ‫نوعين‬ ‫إلى‬ ‫يقسم‬‫اختزال‬
‫العظام‬ ‫كتلة‬ ‫في‬ ‫سريعا‬‫ان...
•‫في‬ ‫العظام‬ ‫هشاشة‬ ‫يسمى‬ ‫الثاني‬ ‫النوع‬‫سن‬
‫الشيخوخة‬‫في‬ ‫للتقدم‬ ‫طبيعية‬ ‫نتيجة‬ ‫ويحدث‬
.‫العمر‬
•‫النوع‬ ‫هذا...
‫الحدوث‬ ‫أسباب‬
•‫ظهور‬ ‫إلى‬ ‫تؤدى‬ ‫التى‬ ‫السباب‬ ‫من‬ ‫العديد‬ ‫هناك‬
‫أكثر‬ ‫الناس‬ ‫من‬ ‫فئات‬ ‫وهناك‬ ، ‫العظام‬ ‫...
•‫إن‬‫العظام‬ ‫هشاشة‬‫بالنساء‬ ‫خاص‬ ‫بشكل‬ ‫يحدق‬ ‫خطر‬‫سن‬ ‫بعد‬
‫اليأس‬‫سن‬ ‫في‬ ‫دخلن‬ ‫اللواتي‬ ‫والنساء‬‫لليأس‬ ‫مبك...
‫الجيني‬ ‫العامل‬‫الجيني‬ ‫العامل‬
•‫للعائلة‬ ‫المرضي‬ ‫التاريخ‬‫للتوارث‬ ‫تميل‬ ‫حالة‬ ‫العظام‬ ‫فهشاشة‬ :
‫في‬ ‫اكبر‬ ‫بنسب‬ ‫وجودها‬ ‫تلحظ‬ ‫وهي‬ ‫العائلت...
•‫عائلتك؟‬ ‫شجرة‬ ‫تعرفين‬ ‫هل‬
‫رضي؟‬َ‫يض‬ ‫م‬َ‫يض‬ ‫ال‬ ‫عائلتك‬ ‫تاريخ‬ ‫تعرفين‬ ‫هل‬ ‫أدق‬ ‫بمعنى‬ ‫أو‬
‫ما‬ ‫وذلك‬ ‫ا...
•‫الشهرية‬ ‫الدورة‬ ‫آل م‬
‫من‬ ‫الشهرية‬ ‫بالدورة‬ ‫المتعلقة‬ ‫الهرمونات‬ ‫الفتاة‬ ‫ترث‬ ‫ما‬ ‫ا‬ً ‫غالب‬
.‫وراثية‬ ‫آلمه...
‫الوراثية‬ ‫العوامل‬
•‫الوراثية‬ ‫العوامل‬‫نحو‬ ‫تفسر‬ ‫التي‬80‫اختلفات‬ ‫من‬ ‫المائة‬ ‫في‬
.‫العظام‬ ‫كثافة‬ ‫قمة‬ ‫قيم‬
...
A. Wild type
TGCCATCACGTGGTGAGTCC
B. Heterozygous
TGCCATCANGTGGTGAGTCC
C. Homozygous
TGCCATCATGTGGTGAGTCC
‫مرض‬ ‫بظهور‬ ‫ا...
‫في‬ ‫ا‬ً ‫دور‬ ‫تلعب‬ ‫التي‬ ‫الجينات‬ ‫أهم‬ ‫نستعرض‬ ‫دعونا‬
‫الهشاشة‬ ‫إحداث‬
‫الهشاشة‬ ‫إحداث‬ ‫في‬ ‫ا‬ً ‫دور‬ ‫تلعب‬ ‫التي‬ ‫الجينات‬ ‫أهم‬
•‫وهذا‬ ،‫اهمية‬ ‫الكثر‬ ‫هو‬ «‫»دي‬ ‫فيتامين‬ ‫نشاط‬ ‫ينظ...
‫الغدد‬ ‫تفرزها‬ ‫التي‬ ‫الهرمونات‬ ‫على‬ ‫سريعة‬ ‫نظرة‬ ‫لنلقي‬
‫جسمنا‬ ‫في‬ ‫الصماء‬
‫العظا م‬ ‫نمو‬ ‫في‬ ‫ل‬ً ‫ف‬ ‫فعا‬ ‫دور‬ ‫النمو‬ ‫هرمون‬ ‫يلعب‬
‫الهرمون‬ ‫و‬ ‫الدرقية‬ ‫الغدة‬ ‫من‬ ‫المفرز‬ ‫الكالسيتونين‬ ‫هرمون‬
‫على‬ ‫المحافظة‬ ‫في‬ ‫ا‬ً ‫دور‬ ‫يلعبان‬ ‫درقية‬ ‫ال...
•‫الهرموني‬ ‫النقص‬‫في‬ ‫تسبب‬ ‫حالة‬ ‫اي‬ ‫ان‬ :
‫في‬ ‫تسرع‬ ‫التستروجين‬ ‫مستويات‬ ‫انخفاض‬
‫في‬ ‫ا‬ً ‫واضح‬ ‫يكون‬ ‫وهذ...
‫البديلة‬ ‫الهرمونات‬ ‫إتستخدام‬ ‫يمكن‬ ‫هل‬
‫هرموني‬ ‫من‬ ‫خليط‬ ‫من‬ ‫المتكون‬ ‫البديل‬ ‫للهرمون‬ ‫يمكن‬
‫هشاشة‬ ‫من‬ ‫...
•‫الخطر‬ ‫عوامل‬ ‫اكثر‬ ‫وهذا‬ :‫العظمية‬ ‫للكتلة‬ ‫الناقص‬ ‫التشكيل‬
.‫اهمية‬
•‫تأثيرات‬ ‫فإن‬ ‫كافية‬ ‫عظمية‬ ‫كتلة‬ ‫ال...
............‫المأثور‬ ‫القول‬ ‫ماأجمل‬‫أغناك‬ ‫فقد‬ ‫عافاك‬ ‫إذا‬
‫و‬ ‫الدين‬ ‫في‬ ‫الدائمة‬ ‫المعافاة‬ ‫و‬ ‫والعافية‬ ‫ال...
‫داغستاني‬ ‫عبدالعزيز‬ ‫حسن‬ ‫مها‬ ‫د‬
‫الفائدة‬ ‫تعم‬ ‫أن‬ ‫أرجو‬
‫المركزي‬ ‫المختبر‬ ‫منسوبات‬ ‫تحيات‬ ‫مع‬
‫الطبية‬ ‫وا...
Nächste SlideShare
Wird geladen in …5
×

0

Teilen

Herunterladen, um offline zu lesen

الاسباب الهرمونية والجينية للهشاشة

Herunterladen, um offline zu lesen

الاسباب الهرمونية والجينية للهشاشة

Ähnliche Bücher

Kostenlos mit einer 30-tägigen Testversion von Scribd

Alle anzeigen

Ähnliche Hörbücher

Kostenlos mit einer 30-tägigen Testversion von Scribd

Alle anzeigen
  • Gehören Sie zu den Ersten, denen das gefällt!

الاسباب الهرمونية والجينية للهشاشة

  1. 1. ‫علمية‬ ‫نشرة‬ ‫المركزي‬ ‫المختبر‬ ‫في‬ ‫الفنية‬ ‫و‬ ‫العلمية‬ ‫الوحدة‬ ‫داغستاني‬ ‫عبدالعزيز‬ ‫حسن‬ ‫مها‬ .‫د‬ ‫العتيبي‬ ‫منير‬ ‫غدير‬ .‫أ‬ ‫داغستاني‬ ‫عبدالعزيز‬ ‫حسن‬ ‫مها‬ .‫د‬ ‫العتيبي‬ ‫منير‬ ‫غدير‬ .‫أ‬
  2. 2. ‫و‬ ‫الجينية‬ ‫السباب‬ ‫العظام‬ ‫لهشاشة‬ ‫الهرمونية‬
  3. 3. ‫مقدمة‬‫مقدمة‬ •‫سلوك‬ ‫من‬ ‫بها‬ ‫يحيط‬ ‫ما‬ ‫بكل‬ ‫الحديثة‬ ‫العصرية‬ ‫الحياة‬ ‫في‬ ‫غذائي‬‫بيئية‬ ‫وعوامل‬‫ضمن‬ ‫العظام‬ ‫هشاشة‬ ‫مرض‬ ‫دخل‬ ‫به‬ ‫تقدمت‬ ‫كلما‬ ‫السنسان‬ ‫تقلق‬ ‫باتت‬ ‫التي‬ ‫المراض‬ ‫قائمة‬ ‫إلى‬ ‫يتسلل‬ ‫المرض‬ ‫أن‬ ‫خاصة‬ ،‫العمر‬ ‫أيام‬‫العظام‬‫دون‬ .‫بقدومه‬ ‫واضحة‬ ‫اشارات‬ ‫اعطاء‬
  4. 4. ‫العظام‬ ‫هشاشة‬ ‫كلمة‬ ‫تعنى‬‫العظام‬ ‫ترقق‬( ‫العظام‬ ‫)هشاشة‬ ‫يجعلها‬ ‫مما‬ ‫العظام‬ ‫لكتلة‬ ‫التدريجى‬ ‫الفقدان‬ ‫سمى‬ ‫لذا‬ ، ‫بسهولة‬ ‫للكسر‬ ‫عرضه‬ ‫و‬ ‫ضعيفة‬ .‫الصامت‬ ‫اللص‬ ‫او‬ " ‫العظام‬ ‫هشاشة‬ " ‫ا‬ً ‫أيض‬
  5. 5. ‫الصامت‬ ‫اللص‬ •‫العظام‬ ‫هشاشة‬‫تظهر‬ ‫ل‬ ،‫حقا‬ ‫صامت‬ ‫مرض‬ ‫ان‬ ‫اذ‬ ،‫كثيرا‬ ‫تقدمه‬ ‫بعد‬ ‫ال‬ ‫اعراضه‬ ‫أي‬ ‫يولد‬ ‫ل‬ ‫العظام‬ ‫كثافة‬ ‫في‬ ‫السنخفاض‬ ‫من‬ ‫اقل‬ ‫الى‬ ‫قيمتها‬ ‫وصول‬ ‫حين‬ ‫الى‬ ‫اعراض‬ . ‫بسهولة‬ ‫للتكسر‬ ‫العظام‬ ‫تعرض‬ ‫التي‬ ‫القيمة‬ •‫فان‬ ،‫الحين‬ ‫ذلك‬ ‫الى‬ ‫وصولها‬ ‫وعند‬ ‫وحتى‬ ‫من‬ ‫مرضا‬ ‫غالبا‬ ‫تظل‬ ‫العظام‬ ‫هشاشة‬‫آلم‬ ‫دون‬ ‫الناعمة‬ ‫العظام‬ ‫فيه‬ ‫تتعرض‬ ‫الذي‬ ‫الوقت‬ ‫حتى‬ ‫إلى‬ ‫تؤدي‬ ‫صلب‬ ‫بأشياء‬ ‫للصطدام‬ ‫الى‬ .‫كسرها‬
  6. 6. ‫كسر‬ ‫فان‬ ،‫للنساء‬ ‫كما‬ ،‫الرجال‬ ‫ولدى‬ ‫الفقري‬ ‫العمود‬‫الشائعة‬ ‫النتائج‬ ‫اكثر‬ ‫هو‬ .‫العظام‬ ‫لهشاشة‬ ‫التدريجي‬ ‫والتناقص‬‫للطول‬‫يكون‬ ‫ربما‬ ‫عظام‬ ‫اسنضغاط‬ ‫على‬ ‫الوحد‬ ‫الدليل‬ .‫الفقرات‬ ‫ان‬ ‫ال‬‫الظهر‬ ‫آلم‬‫وقد‬ ‫كذلك‬ ‫شائعة‬ .‫جدا‬ ‫حادة‬ ‫تكون‬
  7. 7. ‫وضعية‬ ‫فان‬ ‫للمرض‬ ‫المتقدمة‬ ‫الحالت‬ ‫وفي‬‫المنحنية‬ ‫النتصاب‬‫المعهودة‬ ‫و‬‫البارز‬ ‫الخصر‬‫بسبب‬ ‫الفقري‬ ‫العمود‬ ‫في‬ ‫كسر‬ ‫وجود‬ ‫الى‬ ‫بشيران‬ .‫العظام‬ ‫هشاشة‬ ‫دواغر‬ ‫حدبة‬ ‫التشوهات‬ ‫هذه‬ ‫تسمى‬ ‫النساء‬ ‫ولدى‬dowager"s hump. ‫مسمى‬ ‫يوجد‬ ‫ل‬ ‫اسنه‬ ‫ال‬ ،‫ا‬ً ‫أيض‬ ‫الرجال‬ ‫لدى‬ ‫تحدث‬ ‫مشكلة‬ ‫اسنها‬ ‫ورغم‬ .‫بها‬ ‫خاص‬ ‫رجالي‬
  8. 8. ‫العظام‬ ‫هشاشة‬ ‫أنواع‬ •‫مرض‬‫العظام‬ ‫هشاشة‬‫يشمل‬ ‫أولها‬ ‫نوعين‬ ‫إلى‬ ‫يقسم‬‫اختزال‬ ‫العظام‬ ‫كتلة‬ ‫في‬ ‫سريعا‬‫انقطاع‬ ‫بعد‬ ‫السيدات‬ ‫لدى‬ ‫ويحدث‬ ‫لنقص‬ ‫نتيجة‬ ‫الشهرية‬ ‫الدورة‬‫الستروجين‬ ‫هرمون‬.‫الجسم‬ ‫في‬
  9. 9. •‫في‬ ‫العظام‬ ‫هشاشة‬ ‫يسمى‬ ‫الثاني‬ ‫النوع‬‫سن‬ ‫الشيخوخة‬‫في‬ ‫للتقدم‬ ‫طبيعية‬ ‫نتيجة‬ ‫ويحدث‬ .‫العمر‬ •‫النوع‬ ‫هذا‬ ‫في‬ ‫يحدث‬‫تدريجي‬ ‫اختزال‬‫في‬ ‫اختزال‬ ‫حدوث‬ ‫إلى‬ ‫يرجع‬ ‫كما‬ ‫العظام‬ ‫كتلة‬ ‫في‬‫العظام‬ ‫تبني‬ ‫التي‬ ‫الخليا‬ ‫ووظيفة‬ ‫عدد‬ ‫عملية‬ ‫نشاط‬ ‫في‬ ‫وكذلك‬‫العظام‬ ‫بناء‬‫سن‬ ‫في‬ ‫الشيخوخة‬
  10. 10. ‫الحدوث‬ ‫أسباب‬ •‫ظهور‬ ‫إلى‬ ‫تؤدى‬ ‫التى‬ ‫السباب‬ ‫من‬ ‫العديد‬ ‫هناك‬ ‫أكثر‬ ‫الناس‬ ‫من‬ ‫فئات‬ ‫وهناك‬ ، ‫العظام‬ ‫ترقق‬ ‫ومن‬ ، ‫بالمرض‬ ‫للاصابة‬ ‫غيرهم‬ ‫من‬ ‫عرضه‬ :‫السباب‬ ‫هذه‬ ‫هرمونية‬ ‫أسباب‬ ‫غذائية‬ ‫اسباب‬ ‫جينية‬ ‫أسباب‬
  11. 11. •‫إن‬‫العظام‬ ‫هشاشة‬‫بالنساء‬ ‫خاص‬ ‫بشكل‬ ‫يحدق‬ ‫خطر‬‫سن‬ ‫بعد‬ ‫اليأس‬‫سن‬ ‫في‬ ‫دخلن‬ ‫اللواتي‬ ‫والنساء‬‫لليأس‬ ‫مبكر‬‫والنساء‬ ‫لعملية‬ ‫خضعن‬ ‫اللواتي‬‫المبيضين‬ ‫استئصال‬‫لعل ج‬ ‫تعرضن‬ ‫او‬ ‫والحوض‬ ‫البطن‬ ‫اسفل‬ ‫لمنطقة‬ ‫اشعاعي‬‫طويلة‬ ‫لفترة‬ ‫عانين‬ ‫او‬ ‫تدني‬ ‫من‬‫الستروجين‬ ‫مستويات‬‫أخرى‬ ‫عوامل‬ ‫هناك‬ ‫أن‬ ‫كما‬ ، :‫منها‬ ‫المرض‬ ‫لهذا‬ ‫تعرضهن‬ ‫قابلية‬ ‫من‬ ‫تزيد‬ ‫ان‬ ‫يحتمل‬
  12. 12. ‫الجيني‬ ‫العامل‬‫الجيني‬ ‫العامل‬
  13. 13. •‫للعائلة‬ ‫المرضي‬ ‫التاريخ‬‫للتوارث‬ ‫تميل‬ ‫حالة‬ ‫العظام‬ ‫فهشاشة‬ : ‫في‬ ‫اكبر‬ ‫بنسب‬ ‫وجودها‬ ‫تلحظ‬ ‫وهي‬ ‫العائلت‬ ‫نطاق‬ ‫ضمن‬ ‫القوقازيات‬ ‫النساء‬‫والسيويات‬.‫الخرى‬ ‫الشعوب‬ ‫من‬ ‫أكثر‬
  14. 14. •‫عائلتك؟‬ ‫شجرة‬ ‫تعرفين‬ ‫هل‬ ‫رضي؟‬َ‫يض‬ ‫م‬َ‫يض‬ ‫ال‬ ‫عائلتك‬ ‫تاريخ‬ ‫تعرفين‬ ‫هل‬ ‫أدق‬ ‫بمعنى‬ ‫أو‬ ‫ما‬ ‫وذلك‬ ‫ا‬ً ‫مع‬ ‫أبويك‬ ‫من‬ ‫تصيبك‬ ‫أمراض‬ ‫هناك‬ ‫أن‬ ‫ا‬ً ‫جيد‬ ‫فلتعلم‬ . ‫الحديثة‬ ‫الدراسات‬ ‫أثبتته‬ ‫الم‬ ‫عبر‬ ‫تنتقل‬ ‫أمراض‬ ‫إلى‬ ‫المراض‬ ‫هذه‬ ‫الطباء‬ ‫ويقسم‬ ‫الب‬ ‫عبر‬ ‫وأخرى‬ •‫الم‬‫المحتمل‬ ‫فمن‬ ‫التالية‬ ‫المراض‬ ‫تحمل‬ ‫والدتك‬ ‫كانت‬ ‫.....إذا‬ ‫بها‬ ‫إاصابتك‬ ‫المبكر‬ ‫الطمث‬ ‫انقطاع‬ •‫البنه‬ ‫ترث‬ ‫ما‬ ‫عادة‬‫الم‬ ‫وجينات‬ ‫هرمونات‬‫تلك‬ ‫ومنها‬ ‫انقطاعها‬ ‫وموعد‬ ‫الشهرية‬ ‫الدورة‬ ‫مدة‬ ‫تحدد‬ ‫التي‬ ‫الهرمونات‬ ‫لخطورة‬ ‫ا‬ً ‫ونظر‬‫المبكر‬ ‫الطمث‬ ‫انقطاع‬‫إنه‬ ‫حيث‬ ‫اصحتك‬ ‫على‬ ‫وهشاشة‬ ‫القلب‬ ‫وأمراض‬ ‫الدماغية‬ ‫بالسكتة‬ ‫للاصابة‬ ‫يؤدي‬ . ‫العظام‬
  15. 15. •‫الشهرية‬ ‫الدورة‬ ‫آل م‬ ‫من‬ ‫الشهرية‬ ‫بالدورة‬ ‫المتعلقة‬ ‫الهرمونات‬ ‫الفتاة‬ ‫ترث‬ ‫ما‬ ‫ا‬ً ‫غالب‬ .‫وراثية‬ ‫آلمها‬ ‫تكون‬ ‫ثم‬ ‫ومن‬ ‫والدتها‬ •‫الثدي‬ ‫سرطان‬ ‫للبناء‬ ‫السرطانية‬ ‫الورام‬ ‫تحملها‬ ‫التي‬ ‫الجينات‬ ‫لتوارث‬ ‫ا‬ً ‫نظر‬ ‫فحص‬ ‫إجراء‬ ‫المرض‬ ‫بهذا‬ ‫أمها‬ ‫تصاب‬ ‫التي‬ ‫الفتاة‬ ‫فعلى‬ ‫العمر‬ ‫من‬ ‫الثلثين‬ ‫بلوغها‬ ‫بعد‬ ‫سلمتها‬ ‫من‬ ‫للتأكد‬ ‫سنوي‬
  16. 16. ‫الوراثية‬ ‫العوامل‬ •‫الوراثية‬ ‫العوامل‬‫نحو‬ ‫تفسر‬ ‫التي‬80‫اختلفات‬ ‫من‬ ‫المائة‬ ‫في‬ .‫العظام‬ ‫كثافة‬ ‫قمة‬ ‫قيم‬ •‫في‬ ‫العظام‬ ‫هشاشة‬ ‫مرض‬ ‫ظهور‬ ‫الوراثية‬ ‫العوامل‬ ‫وتفسر‬ ‫السللت‬ ‫اعراق‬ ‫بين‬ ‫انتشاره‬ ‫تفسر‬ ‫كما‬ ،‫غيرها‬ ‫دون‬ ‫عائلت‬ ‫من‬ ‫المتحدرة‬‫القوقاز‬‫ومن‬ ،‫آسيا‬‫ذوي‬ ‫بين‬ ‫انتشاره‬ ‫من‬ ‫اكثر‬ ، .‫السوداء‬ ‫البشرة‬
  17. 17. A. Wild type TGCCATCACGTGGTGAGTCC B. Heterozygous TGCCATCANGTGGTGAGTCC C. Homozygous TGCCATCATGTGGTGAGTCC ‫مرض‬ ‫بظهور‬ ‫الجين‬ ‫في‬ ‫الشكلية‬ ‫التغيرات‬ ‫ترتبط‬ ‫الهشاشة‬ ‫مرض‬ ‫بظهور‬ ‫الجين‬ ‫في‬ ‫الشكلية‬ ‫التغيرات‬ ‫ترتبط‬ ‫الهشاشة‬
  18. 18. ‫في‬ ‫ا‬ً ‫دور‬ ‫تلعب‬ ‫التي‬ ‫الجينات‬ ‫أهم‬ ‫نستعرض‬ ‫دعونا‬ ‫الهشاشة‬ ‫إحداث‬
  19. 19. ‫الهشاشة‬ ‫إحداث‬ ‫في‬ ‫ا‬ً ‫دور‬ ‫تلعب‬ ‫التي‬ ‫الجينات‬ ‫أهم‬ •‫وهذا‬ ،‫اهمية‬ ‫الكثر‬ ‫هو‬ «‫»دي‬ ‫فيتامين‬ ‫نشاط‬ ‫ينظم‬ ‫الذي‬ ‫الجين‬ ‫ان‬ ‫ويبدو‬ ‫لن‬ ‫مقبول‬ ‫أمر‬«‫»دي‬ ‫فيتامين‬‫الكالسيوم‬ ‫امتصاص‬ ‫على‬ ‫المعاء‬ ‫يساعد‬ .‫الدم‬ ‫من‬ •‫الول‬ ‫النوع‬ ‫الكولجين‬ ‫جين‬ά1(Collagen Type 1 α1‫يعتبر‬ ( ‫ان‬ ‫حيث‬ ‫الهشاشة‬ ‫إحداث‬ ‫في‬ ‫دور‬ ‫تلعب‬ ‫التي‬ ‫الجينات‬ ‫اهم‬ ‫من‬ ‫الجين‬ ‫هذا‬ .‫للعظام‬ ‫المكونة‬ ‫البروتينات‬ ‫أهم‬ ‫أحد‬ ‫الجين‬ ‫يشفره‬ ‫الذي‬ ‫البروتين‬ •‫اللستروجين‬ ‫هرمون‬ ‫مستقبل‬ ‫جين‬ESR1 gene‫المسئول‬ ‫اللجين‬ ‫هو‬ ‫و‬ .‫الهرمون‬ ‫مستقبلت‬ ‫تكوين‬ ‫عن‬ •Transforming Growth Factor Beta-1gene •Lipoprotein Receptor-Related Protein-5 gene
  20. 20. ‫الغدد‬ ‫تفرزها‬ ‫التي‬ ‫الهرمونات‬ ‫على‬ ‫سريعة‬ ‫نظرة‬ ‫لنلقي‬ ‫جسمنا‬ ‫في‬ ‫الصماء‬
  21. 21. ‫العظا م‬ ‫نمو‬ ‫في‬ ‫ل‬ً ‫ف‬ ‫فعا‬ ‫دور‬ ‫النمو‬ ‫هرمون‬ ‫يلعب‬
  22. 22. ‫الهرمون‬ ‫و‬ ‫الدرقية‬ ‫الغدة‬ ‫من‬ ‫المفرز‬ ‫الكالسيتونين‬ ‫هرمون‬ ‫على‬ ‫المحافظة‬ ‫في‬ ‫ا‬ً ‫دور‬ ‫يلعبان‬ ‫درقية‬ ‫الجار‬ ‫الغدة‬ ‫من‬ ‫المفرز‬ ‫الدم‬ ‫في‬ ‫الكالسيوم‬ ‫مستوى‬
  23. 23. •‫الهرموني‬ ‫النقص‬‫في‬ ‫تسبب‬ ‫حالة‬ ‫اي‬ ‫ان‬ : ‫في‬ ‫تسرع‬ ‫التستروجين‬ ‫مستويات‬ ‫انخفاض‬ ‫في‬ ‫ا‬ً ‫واضح‬ ‫يكون‬ ‫وهذا‬ ‫العظمية‬ ‫الكتلة‬ ‫خسارة‬ ‫حالت‬‫التبويض‬ ‫اضطرابات‬‫يحدث‬ ‫كما‬ ‫المزمن‬ ‫حالت‬ ‫في‬‫للمبيضين‬ ‫المتعددة‬ ‫التكيسات‬‫وفي‬ ‫حالت‬‫الدرقية‬ ‫الغذة‬ ‫هرمونات‬ ‫اضطرابات‬.
  24. 24. ‫البديلة‬ ‫الهرمونات‬ ‫إتستخدام‬ ‫يمكن‬ ‫هل‬ ‫هرموني‬ ‫من‬ ‫خليط‬ ‫من‬ ‫المتكون‬ ‫البديل‬ ‫للهرمون‬ ‫يمكن‬ ‫هشاشة‬ ‫من‬ ‫المرأة‬ ‫يحمي‬ ‫أن‬ ‫البروجسترون‬ ‫و‬ ‫التستروجين‬ ‫على‬ ‫اجريت‬ ‫دراتسة‬ ‫في‬ ‫العلماء‬ ‫وجد‬ ‫لكن‬ ‫العظام‬10000 :‫الاصابة‬ ‫نسبة‬ ‫إزدياد‬ ‫البديل‬ ‫الهرمون‬ ‫يستخدمن‬ ‫إمرأة‬ ‫الثدي‬ ‫بسرطان‬ ‫الدم‬ ‫تجلط‬ ‫القلب‬ ‫أمراض‬ ‫الدماغية‬ ‫السكتات‬
  25. 25. •‫الخطر‬ ‫عوامل‬ ‫اكثر‬ ‫وهذا‬ :‫العظمية‬ ‫للكتلة‬ ‫الناقص‬ ‫التشكيل‬ .‫اهمية‬ •‫تأثيرات‬ ‫فإن‬ ‫كافية‬ ‫عظمية‬ ‫كتلة‬ ‫ال‬ً ‫ااص‬ ‫هناك‬ ‫تكن‬ ‫لم‬ ‫فاذا‬ ‫العظام‬ ‫هشاشة‬‫وفي‬ ‫بسرعة‬ ‫تظهر‬‫مبكرة‬ ‫مرحلة‬.
  26. 26. ............‫المأثور‬ ‫القول‬ ‫ماأجمل‬‫أغناك‬ ‫فقد‬ ‫عافاك‬ ‫إذا‬ ‫و‬ ‫الدين‬ ‫في‬ ‫الدائمة‬ ‫المعافاة‬ ‫و‬ ‫والعافية‬ ‫العفو‬ ‫أتسألك‬ ‫إني‬ ‫اللهم‬ .......‫النار‬ ‫من‬ ‫النجاة‬ ‫و‬ ‫بالجنة‬ ‫الفوز‬ ‫و‬ ‫والخرة‬ ‫الدنيا‬ ‫يتسم‬ ‫مثالي‬ ‫حياة‬ ‫بنمط‬ ‫العافية‬ ‫و‬ ‫الصحة‬ ‫نعمة‬ ‫على‬ ‫فلنحافظ‬ ‫متوازن‬ ‫اصحي‬ ‫بغذاء‬ ‫بدني‬ ‫بنشاط‬ ‫مثالي‬ ‫بوزن‬ ‫عطاء‬ ‫و‬ ‫رضى‬ ‫و‬ ‫وقناعة‬ ‫داخلية‬ ‫بسعادة‬ ‫نعمة‬ ‫على‬ ‫المحافظة‬ ‫لنا‬ ‫يمكن‬ ‫المعطيات‬ ‫هذه‬ ‫بكل‬‫العافية‬ ‫و‬ ‫الصحة‬‫حتى‬ .‫بالمرض‬ ‫الاصابة‬ ‫إلى‬ ‫تؤدي‬ ‫قد‬ ‫جينية‬ ‫لتغيرات‬ ‫حاملين‬ ‫كنا‬ ‫لو‬
  27. 27. ‫داغستاني‬ ‫عبدالعزيز‬ ‫حسن‬ ‫مها‬ ‫د‬ ‫الفائدة‬ ‫تعم‬ ‫أن‬ ‫أرجو‬ ‫المركزي‬ ‫المختبر‬ ‫منسوبات‬ ‫تحيات‬ ‫مع‬ ‫الطبية‬ ‫والدراسات‬ ‫العلوم‬ ‫/أقسام‬ ‫سعود‬ ‫الملك‬ ‫جامعة‬ ‫الفائدة‬ ‫تعم‬ ‫أن‬ ‫أرجو‬ ‫المركزي‬ ‫المختبر‬ ‫منسوبات‬ ‫تحيات‬ ‫مع‬ ‫الطبية‬ ‫والدراسات‬ ‫العلوم‬ ‫/أقسام‬ ‫سعود‬ ‫الملك‬ ‫جامعة‬ clab@ksu.edu.sa

الاسباب الهرمونية والجينية للهشاشة

Aufrufe

Aufrufe insgesamt

1.033

Auf Slideshare

0

Aus Einbettungen

0

Anzahl der Einbettungen

24

Befehle

Downloads

9

Geteilt

0

Kommentare

0

Likes

0

×