1. Bonus quiz 1. This bonus quiz is based on the material in Chapter 2. Name: Only one strand of a
double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide.
GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAAT
CGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be
transcribed from this DNA. Hint: it is impossible to identify the first base of an mRNA accurately
from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real
start. (10 points) 2. Write the N-terminal portion of polypeptide which is encoded by this DNA.
Used genetic code table from Lecture 2g, slide H68. (10 points).Question 2.55. What are the
properties of the genetic code? (20 points) How many codons are in the genetic code? (5 points)
What are a sense, a start, a stop and a nonsense codons? ( 10 points) Codon bias: GC-rich
microorganisms tend to utilize codons with G or C in the third position, whereas ATrich
microorganisms end to utilize codons with A or T in the hird position. amber, and opal are
termination codons.