Diese Präsentation wurde erfolgreich gemeldet.
Wir verwenden Ihre LinkedIn Profilangaben und Informationen zu Ihren Aktivitäten, um Anzeigen zu personalisieren und Ihnen relevantere Inhalte anzuzeigen. Sie können Ihre Anzeigeneinstellungen jederzeit ändern.

Paremvasi perioristikes endonoukleases

258 Aufrufe

Veröffentlicht am

  • Als Erste(r) kommentieren

  • Gehören Sie zu den Ersten, denen das gefällt!

Paremvasi perioristikes endonoukleases

  1. 1. Κεφ 4ο•Περιοριστικές ενδονουκλεάσες
  2. 2. Μόριο rRNA βατράχου αποτελείται από την ακολουθία βάσεων:3’ AUUAAGAUGACGCGAAGGCCACCAUUAUAGGCCAC 5’Η απομόνωση του γονιδίου, που κωδικοποιεί το εν λόγω μόριο, επιτεύχθηκε με τηνπεριοριστική ενδονουκλεάση Notl, η οποία αναγνωρίζει την ακόλουθη αλληλουχία καικόβει στις θέσεις που υποδεικνύουν τα βέλη:5’ GC↓GGCC GC 3’3’ CG CCGG↑CG 5’Η συγκεκριμένη αλληλουχία στο γονιδίωμα του βατράχου βρίσκεται αμέσως πριν και μετάτο εν λόγω γονίδιο.i. Να γράψετε την αλληλουχία βάσεων στο τμήμα DNA που προέκυψε μετά την επίδρασητης Notl στο γονιδίωμα του βατράχου. ii. Πόσοι δεσμοί υδρογόνου έσπασαν κατά την επίδραση της περιοριστικήςενδονουκλεάσης; Πόσοι δεσμοί υδρογόνου έσπασαν κατά τη μεταγραφή του γονιδίου; iii. Να υπολογίσετε το μήκος του ανασυνδιασμένου (σε ζεύγη βάσεων) που προέκυψεκατά τη σύνδεση του γονιδίου με κατάλληλο φορέα κλωνοποίησης μήκους 1500 ζευγώνβάσεων.
  3. 3. i. Να γράψετε την αλληλουχία βάσεων στο τμήμα DNA που προέκυψε μετά την επίδραση της Notl στο γονιδίωμα του βατράχου. 1. Αφού το μόριο που μας δίνεται είναι το rRNA (και εμείς ξέρουμε ότι αυτό είναι το ίδιο με την κωδική αλυσίδα του DNA από το οποίο προήλθε πλην της βάσης ουρακίλης-θυμίνης) μπορούμε να βρούμε το αρχικό τμήμα DNA πριν τη δράση της περιοριστικής ενδονουκλεάσης. rRNA 3’ AUU AAG AUG ACG CGA AGG CCA CCA UUA UAG GCC AC 5’DNA κωδική 3’ ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC 5’DNA μη κωδική 5’ TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG 3’
  4. 4. i. Να γράψετε την αλληλουχία βάσεων στο τμήμα DNA που προέκυψε μετά την επίδραση της Notl στο γονιδίωμα του βατράχου. 2. Αφού βρήκαμε το αρχικό τμήμα DNA πριν τη δράση της περιοριστικής ενδονουκλεάσης μπορούμε να δούμε τι είδους άκρα θα έχει αυτό αφού θα το έχει κόψει αμέσως πριν και μετά αυτή η ενδονουκλεάση. 5’ GC↓GGCC GC 3’ 3’ CG CCGG↑CG 5’ ή 3’ CG CCGG↓GC 5’ 5’ GC↑GGCC CG 3’DNA κωδική 3’ CG CCGG↓GC ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC CG CCGG↓GC 5’DNA μηκωδική 5’ GC↑GGCC CG TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG GC↑GGCC CG 3’
  5. 5. i. Να γράψετε την αλληλουχία βάσεων στο τμήμα DNA που προέκυψε μετά την επίδραση της Notl στο γονιδίωμα του βατράχου. 3. Άρα το τμήμα που θα μείνει μετά τη δράση της περιοριστικής ενδονουκλεάσης θα είναι το παρακάτω.DNA κωδική 3’ GC ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC CG CCGG 5’DNA μηκωδική 5’ GGCC CG TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG GC 3’
  6. 6. ii. Πόσοι δεσμοί υδρογόνου έσπασαν κατά την επίδραση της περιοριστικής ενδονουκλεάσης; 1. Ας δούμε πάλι το αρχικό μόριο DNA πριν τη δράση της περιοριστικής ενδονουκλεάσης :DNA κωδική 3’ CG CCGG↓GC ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC CG CCGG↓GC 5’DNA μηκωδική 5’ GC↑GGCC CG TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG GC↑GGCC CG 3’ Αυτά είναι τα σημεία στα οποία σπάζουν δεσμοί υδρογόνου ανάμεσα στα συμπληρωματικά ζεύγη βάσεων (4 από τη μία πλευρά και 4 από την άλλη). Ξέρουμε πως ανάμεσα σε ζεύγος T-A έχουμε δύο δεσμούς υδρογόνου και ανάμεσα σε ζεύγος G-C έχουμε τρις δεσμούς υδρογόνου. Άρα εδώ επειδή έχουμε συνολικά 8 ζεύγη G-C που σπάζουν οι δεσμοί υδρογόνου τους θα είναι σύνολο 8χ3=24 δεσμοί υδρογόνου που σπάζουν.
  7. 7. ii. Πόσοι δεσμοί υδρογόνου έσπασαν κατά τη μεταγραφή του γονιδίου; 1. Ας δούμε πάλι το αρχικό μόριο DNA από το οποίο προήλθε το rRNA : rRNA 3’ AUU AAG AUG ACG CGA AGG CCA CCA UUA UAG GCC AC 5’DNA κωδική 3’ ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC 5’DNA μη κωδική 5’ TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG 3’ Ξέρουμε πως ανάμεσα σε ζεύγος T-A έχουμε δύο δεσμούς υδρογόνου και ανάμεσα σε ζεύγος G-C έχουμε 3 δεσμούς υδρογόνου. Άρα εδώ επειδή έχουμε συνολικά 17 ζεύγη G-C και 18 ζεύγη T-A που σπάζουν οι δεσμοί υδρογόνου τους θα είναι σύνολο 17χ3+18χ2=51+36=87 δεσμοί υδρογόνου που σπάζουν.
  8. 8. iii. Να υπολογίσετε το μήκος του ανασυνδιασμένου (σε ζεύγη βάσεων) που προέκυψε κατά τη σύνδεση του γονιδίου με κατάλληλο φορέα κλωνοποίησης μήκους 1500 ζευγών βάσεων. 1. Ας δούμε πάλι το μόριο DNA μετά τη δράση της περιοριστικής ενδονουκλεάσης :DNA κωδική 3’ GC ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC CG CCGG 5’DNA μηκωδική 5’ GGCC CG TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG GC 3’ Και ο φορέας θα έχει συμπληρωματικά άκρα τα ίδια αφού θα έχει κοπεί με την ίδια ενδονουκλεάση 3’ CG CCGG 5’ 3’ GC 5’ φορέαςφορέας 5’ GC 3’ 5’ GGCC CG 3’
  9. 9. iii. Να υπολογίσετε το μήκος του ανασυνδιασμένου (σε ζεύγη βάσεων) που προέκυψε κατά τη σύνδεση του γονιδίου με κατάλληλο φορέα κλωνοποίησης μήκους 1500 ζευγών βάσεων. 2. Οπότε με τη συνένωση των δύο μορίων DNA προκύπτει το εξής ανασυνδιασμένο DNA : CG CCGG GC ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC CG CCGGφορέας GC φορέας GC GGCC CG TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG GC GGCC CG
  10. 10. iii. Να υπολογίσετε το μήκος του ανασυνδιασμένου (σε ζεύγη βάσεων) που προέκυψε κατά τη σύνδεση του γονιδίου με κατάλληλο φορέα κλωνοποίησης μήκους 1500 ζευγών βάσεων. 3. Μετρώντας τώρα τα συνολικά ζεύγη έχουμε: CG CCGG GC ATT AAG ATG ACG CGA AGG CCA CCA TTA TAG GCC AC CG CCGGφορέας GC φορέας GC GGCC CG TAA TTC TAC TGC GCT TCC GGT GGT AAT ATC CGG TG GC GGCC CG Α) τα ζεύγη του φορέα δίνονται 1500 (μαζί με τα μπλε): Β) τα ζεύγη του γονιδίου 35 (μαύρο-μαύρο) και 4 (κόκκινο-κόκκινο): Γ) τα ζεύγη του γονιδίου (που ενώνεται με τα συμπληρωματικά του φορέα) 4 (τέσσερις βάσεις από τη μία και τέσσερις από την άλλη πλευρά): Σύνολο έχουμε 1500+35+4+4=1543

×