Gerstner et al PLoS One 2008

Brain Fatty Acid Binding Protein (Fabp7) Is Diurnally
Regulated in Astrocytes and Hippocampal Granule Cell
Precursors in Adult Rodent Brain
Jason R. Gerstner1,2,3, Quentin Z. Bremer3, William M. Vander Heyden3, Timothy M. LaVaute3, Jerry C.
Yin2, Charles F. Landry3*
1 Neuroscience Training Program, University of Wisconsin-Madison, Madison, Wisconsin, United States of America, 2 Department of Genetics, University of Wisconsin-
Madison, Madison, Wisconsin, United States of America, 3 Department of Psychiatry, University of Wisconsin-Madison, Madison, Wisconsin, United States of America

Abstract
Brain fatty acid binding protein (Fabp7), which is important in early nervous system development, is expressed in astrocytes
and neuronal cell precursors in mature brain. We report here that levels of Fabp7 mRNA in adult murine brain change over a
24 hour period. Unlike Fabp5, a fatty acid binding protein that is expressed widely in various cell types within brain, RNA
analysis revealed that Fabp7 mRNA levels were elevated during the light period and lower during dark in brain regions
involved in sleep and activity mechanisms. This pattern of Fabp7 mRNA expression was confirmed using in situ hybridization
and found to occur throughout the entire brain. Changes in the intracellular distribution of Fabp7 mRNA were also evident
over a 24 hour period. Diurnal changes in Fabp7, however, were not found in postnatal day 6 brain, when astrocytes are not
yet mature. In contrast, granule cell precursors of the subgranular zone of adult hippocampus did undergo diurnal changes
in Fabp7 expression. These changes paralleled oscillations in Fabp7 mRNA throughout the brain suggesting that cell-
coordinated signals likely control brain-wide Fabp7 mRNA expression. Immunoblots revealed that Fabp7 protein levels also
underwent diurnal changes in abundance, with peak levels occurring in the dark period. Of clock or clock-regulated genes,
the synchronized, global cycling pattern of Fabp7 expression is unique and implicates glial cells in the response or
modulation of activity and/or circadian rhythms.

Citation: Gerstner JR, Bremer QZ, Vander Heyden WM, LaVaute TM, Yin JC, et al (2008) Brain Fatty Acid Binding Protein (Fabp7) Is Diurnally Regulated in
Astrocytes and Hippocampal Granule Cell Precursors in Adult Rodent Brain. PLoS ONE 3(2): e1631. doi:10.1371/journal.pone.0001631
Editor: Rachel Wong, University of Washington, United States of America
Received September 5, 2007; Accepted January 20, 2008; Published February 20, 2008
Copyright: ß 2008 Gerstner et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by National Institutes of Heath grant 5 P50 CA084724-04 (JRG) and DA19153 (CFL).
Competing Interests: The authors have declared that no competing interests exist.
*E-mail: clandry@wisc.edu

Introduction undergo a dramatic reduction during early postnatal development,
but to persist in radial glia-like neuronal progenitors and specific
Brain fatty acid binding protein (also known as brain lipid mature astrocyte populations [13]. Although the role of Fabp7 in
binding protein or Fabp7) is a member of a large family of fatty fatty acid delivery during development is not clear, its involvement
acid binding proteins (Fabps) of relatively small molecular weight in cell growth and differentiation has been implicated based on its
(,15 kD) that are expressed in a diverse set of vertebrate and influence on cell morphology [3]. Further, an induction of Fabp7
invertebrate tissues [1]. Fabps, which facilitate the solubility of increases the motility of glioma cells [18].
hydrophobic long chain fatty acids and function primarily in fatty Recently it has been shown that the targeted deletion of Fabp7
acid uptake and transport [2], have been widely implicated in cell results in an enhancement of fear memory and anxiety in
growth and differentiation [3–7]. In the central nervous system adulthood [9]. Interestingly, the ability of the fatty acid, DHA to
(CNS), three Fabp proteins with different cell-type distributions modulate NMDA receptor activation in hippocampal neurons is
have been identified: Heart-type Fabp (Fabp3), epidermal-type eliminated in these Fabp7-mutant mice. Whether these effects are
Fabp (Fabp5), and brain-type Fabp, Fabp7 [8,9]. Fabps within due to cell-intrinsic changes that occur in the absence of Fabp7
brain are thought to govern the uptake and delivery of fatty acids during neuronal cell precursor maturation or are a result of an
like docosahexanoic acid (DHA) and arachadonic acid and to play absence of Fabp7 in mature astrocytes is not known.
important roles in cell differentiation [3,10,11]. Changes in the expression of molecules involved in the
The initial identification of Fabp7 established its presence regulation of the circadian cycle have been shown to have strong
within radial glia in embryonic brain and in neuronal cell functional and behavioral consequences. For example, mutations
progenitors in mature brain [3,12,13]. In fact, most neuronal cell in various clock genes have been shown to alter feeding behavior
populations are thought to be derived from Fabp7-expressing [19–22], long-term memory formation [23,24] and to exert strong
progenitors [14]. The regulation of Fabp7 mRNA expression has effects on drug conditioning behavior in both flies and mice [25–
been shown to be downstream of Notch signaling [15], and 27]. We have previously shown that Fabp7 also undergoes diurnal
dependent on Pax6 [14,16] and POU/Pbx transcription factors changes in expression in hypothalamus [28]. Given the potential
[17]. Fabp7 mRNA levels were found to peak at birth and to role of Fabp7 in neurogenesis and anxiety mechanisms, and the

PLoS ONE | www.plosone.org 1 February 2008 | Volume 3 | Issue 2 | e1631

Diurnal Regulation of Fabp7

role of circadian genes in complex behavior, we examined the the pons, a brain area that has a broad role in activity states and
expression of Fabp7 throughout the brain and found that it the locus coeruleus (LC), which contains norepinephrine-releasing
underwent global and coordinated diurnal regulation in astrocytes. cells important in regulating sleep and activity [34]. Within these
Further, this synchronized cycling pattern in astrocytes was also three regions, Fabp7 mRNA levels at Zeitgeber time (ZT) 6 (the
observed in granule cell progenitors of the hippocampus. middle of the light period) were three to five-fold higher than
ZT18 (the middle of the dark period; Fig. 1A). Detailed time point
Results analysis of TMN, pons and LC further revealed a gradual decrease
Fabp7 mRNA is diurnally expressed in brain regions in Fabp7 mRNA during the light period followed by an increase in
involved in the regulation of arousal levels at the end of dark (Fig. 1B). The diurnal pattern of Fabp7
Fabp7, a protein present in astrocytes and related cell types mRNA expression was strikingly similar in all three brain regions
[3,12,13], undergoes diurnal changes in mRNA abundance in and was identical to the diurnal change in Fabp7 mRNA levels
regions of murine hypothalamus that are involved in sleep/wake evident in hypothalamus [28].
regulation and circadian rhythmicity [28]. Fabp7 mRNA The diurnal pattern of Fabp7 mRNA expression was compared
expression also cycles over a 48 hour period within the to epidermal-type fatty acid binding protein, Fabp5, which is
suprachiasmatic nucleus, where oscillations persisted in dark expressed in a number of cell types in brain including astrocytes
(free-running) conditions [29,30]. To determine whether Fabp7 [10,11]. Unlike Fabp7, Fabp5 mRNA was not found to cycle in
mRNA is diurnally expressed in other brain regions involved in the TMN, pons or LC (Fig. 1B). Collapsed data from figure 1B is
activity, we examined the cycling of Fabp7 mRNA in the depicted as relative signal intensity in figure 1C to illustrate
tuberomammilary nucleus (TMN), which contains histaminergic differences in diurnal expression between Fabp7 and 5. Significant
neurons thought to play a primary role in brain arousal [31–33], differences were evident in Fabp7, but not Fabp5, mRNA levels

Figure 1. Fabp7 mRNA is diurnally regulated in brain regions involved in sleep and activity. A) RNA collected from tuberomammillary
nucleus (TMN), pons and locus coeruleus (LC) subjected to Northern blotting revealed elevated levels of Fabp7 mRNA at Zeitgeber time (ZT) 6
compared to ZT18 (bottom panel). Glyeraldehyde-3-phosphate dehydrogenase (Gapdh) was used as a loading control. Graphic representation of
Fabp7 expression normalized against Gapdh indicated 3 to 5 fold changes in mRNA levels (top panel); **p,0.01, *p,0.05, t = 0.06 (t-test). Each time
point represents 12 individual animals pooled. N = 2–3 groups. B) Northern blot analysis of RNA collected every 4 hours showed diurnal changes in
Fabp7 mRNA but not Fabp5. C) Collapsed data from B normalized with Gapdh indicated significant diurnal changes in Fabp7 mRNA across a 24-hour
period but no changes in Fabp5 expression. One-way ANOVA, ***p,0.001, **p,0.01 (post-hoc Bonferroni). Each value represents the regional
average +/2 S.E.M. Each time point represents 3 individual animals pooled.
doi:10.1371/journal.pone.0001631.g001



across the diurnal cycle. The other Fabp expressed in brain, heart- (data not shown). These results suggest that the increase in Fabp7
type fatty acid binding protein (Fabp3), which is exclusive to mRNA that occurs near the end of the dark period is due to
neurons, was also not found to cycle (data not shown). The pattern enhanced transcriptional activity.
of Fabp7 expression in diurnal samples of RNA from pons
subjected to quantitative RT-PCR (qRT-PCR) closely matched Diurnal changes in Fabp7 mRNA occur throughout the
Northern blotting data (Fig. S1). brain
To determine whether pre-processed heteronuclear (hn) Fabp7 In situ hybridization was used to examine the diurnal profile of
RNA underwent similar changes in abundance, we used qRT- Fabp7 mRNA expression in more detail. Highest signal intensities
PCR to examine the relative concentrations of Fabp7 intron 1 in were evident during the light period in agreement with results
TMN, pons and LC across a diurnal profile (Fig. S1). These results using Northern blotting and qRT-PCR RNA analyses (Fig. 2A).
indicated that higher intron 1 hnRNA levels were generally At all time points, signal within coronal sections at the level of
present around the dark-to-light period transition. In situ dorsal hippocampus showed highest intensities in stria medullaris/
hybridization with probe to intron 1 confirmed qRT-PCR results hebenula (Hb), amygdala (A) and hypothalamus (Hy). Sagittal

Figure 2. Fabp7 mRNA changes globally during the diurnal period. A) Coronal (top series) and sagittal (bottom series) sections from four
diurnal time points subjected to in situ hybridization using 35S-labeled Fabp7 antisense riboprobe. Note more intense expression levels during lights-
on. B) Graphic representation of relative Fabp7 mRNA expression at four time points. A statistically significant diurnal variation in expression was
observed; Two-way ANOVA (p,0.001). ***p,0.001, **p,0.01 versus ZT18 (post-hoc Bonferroni). Each value represents the average +/2 S.E.M. N = 2–
5 per time point. A, Amygdala; Cb, cerebellum; CC, cerebral cortex; Hb, medullaris/hebenula; Hy, hypothalamus; OB, olfactory bulb; T, thalamus



sections confirmed the diurnal cycling of Fabp7 mRNA and distinctive pattern of expression was evident in both basolateral
indicated high levels in cerebellum (Cb) and olfactory bulb (OB). (BLA) and medial (MA) nuclei (Fig. 4A) where significant changes
Densitometric measurements from a number of brain regions that in mRNA levels oscillated throughout the diurnal cycle (Fig. 4B).
included thalamus (T), Hb, cerebral cortex (CC) and Cb revealed More detailed analysis using emulsion autoradiography confirmed
the diurnal regulation of Fabp7 expression to include a broader elevated levels of Fabp7 mRNA during lights-on (compare
pattern that extended beyond regions known to specifically Fig. 4C1 and C2). Higher magnification analysis of BLA revealed
influence sleep/wake or circadian rhythmicity. that silver grain distribution corresponding to Fabp7 mRNA was
Given that the recently described Chordc1 mRNA has been more disperse at ZT6 compared to ZT18 (compare 4C3 and C4).
shown to cycle globally in brain during early postnatal development Note the more dense accumulation of silver grains around cell
[35], and that Fabp7 mRNA is abundant in rat [12] and mouse somata at ZT18 (arrow in 4C4) compared to ZT6 (arrow in 4C3).
brain (Fig. S2A), we examined Fabp7 mRNA expression at postnatal A more dispersed distribution of sliver grains was common
day 6, when many astrocytes have completed migration and are throughout the brain toward the end of the light period (data not
beginning to mature [36]. Unlike adult brain, Fabp7 mRNA was not shown) and these observations suggest that the diurnal change in
found to cycle in P6 brain (Fig. S2B). Fabp7 mRNA abundance may coincide with changes in mRNA
targeting. The pattern of expression of Fabp7 mRNA was
Fabp7 protein levels are elevated during the dark period consistent with an astrocytic labeling pattern as has been shown
Immunoblotting was used to determine whether changes in Fabp7 previously [9] and cells that stained with DIG-labeled Fabp7
mRNA levels resulted in changes in Fabp7 protein. Since Northern riboprobe were also found to co-label with radiolabeled probe to
blotting and in situ hybridization indicated that Fabp7 mRNA levels the astrocyte mRNA, Glial fibrillary acidic protein (4C5).
underwent the same pattern of diurnal regulation regardless of brain Immunostained images of Fabp7-expressing astrocytes in BLA
region, we examined Fabp7 protein levels in whole brain extracts are shown for reference (Fig. 4C6).
collected at four diurnal time points. Like Fabp7 mRNA, Fabp7
protein levels were found to differ depending on time of day (Fig. 3). Diurnal changes in Fabp7 mRNA levels in hippocampus
The highest amounts of protein were evident at ZT18 and were are also present in granule cell precursors
statistically different than the lowest amounts found at ZT0 (t-test, Fabp7 mRNA was also diurnally regulated in hippocampus
p,0.05). Higher Fabp7 protein levels during the dark period were in with higher relative levels of expression present in the hippocam-
contrast with mRNA levels, which were highest during the day pal fissure (HF) and dentate gyrus (DG; Fig. 5A). Expression of
suggesting that Fabp7 protein accumulation lagged peak Fabp7 Fabp7 was pronounced in the subgranular zone (SGZ) of DG and
mRNA levels by about 12 hours. was higher during lights-on (arrowheads in Fig. 5A). These
changes were found to be significant in the hippocampus as well as
Fabp7 mRNA is diurnally regulated in amygdala and may within the granule cell precursor layer (Fig. 5B).
undergo changes in intracellular distribution during the Higher resolution autoradiograpy confirmed intense expression
light-dark cycle of Fabp7 mRNA in cells within the SGZ that was absent from the
Fabp7 has recently been implicated in fear memory and anxiety granule cell layer (GCL; Fig. 5C). Silver grain accumulation over
[9] and we therefore examined the region-specific distribution of cells within this region (arrowheads in Fig. 5C3 and C4) indicated
Fabp7 mRNA in amygdala and hippocampus. In amygdala, higher Fabp7 expression at ZT6. Granule cell precursors within
Fabp7 mRNA cycled identically to other brain regions with this layer, which are known to express Fabp7 [37], give rise to
highest mRNA levels present in the light period (Fig. 4). This granule neurons throughout the life of the animal [38]. These cells

Figure 3. Fabp7 protein levels are elevated during the dark period. Graphic representation of Western blots from whole brain indicating an
increase in Fabp7 protein levels with increasing Zeitgeber time. There is a significant increase in Fabp7 protein at ZT18 compared to ZT0,*p,0.05 (t-
test). Each value represents the average +/2 S.E.M. N = 3–4 per time point. Values are normalized to an average of Gapdh and b-actin. Inset:
Representative immunoblot of whole brain homogenates from tissue isolated at four diurnal time points. A single, predicted 15 kilodalton band was
evident in blots incubated with anti-Fabp7 antibody. Blots were subsequently incubated with anti-b-actin and anti-glyceraldehyde-3-phosphate
dehydrogenase (Gapdh).



Figure 4. The amount and distribution of Fabp7 mRNA in amygdala changes during the diurnal cycle. A) In situ hybridization of coronal
tissue sections probed for Fabp7 mRNA at four diurnal time points. Top panels, phosphorimages of amygdala, bottom panels, dark field images of a
different set of hybridized sections subjected to emulsion autoradiography. Higher levels of Fabp7 were evident during lights-on. B) Graphic
representation of elevated Fabp7 mRNA levels during lights-on in basolateral and medial amygdala. Two-way ANOVA (p = 0.002). ***p,0.001,
**p,0.01 vs. ZT18 (post-hoc t-test). Each value represents the average +/2 S.E.M. N = 2–4 per time point. C) Sections processed for in situ
hybridization for Fabp7 subjected to emulsion autoradiography. Dark field microscopy revealed a more dispersed labeling pattern at ZT 6 (C1)
compared to ZT18 (C2). Higher magnification micrographs of Nissl counterstained sections indicated labeling over cells whose staining pattern was
consistent with an astrocyte morphology and whose labeling pattern was more disperse at ZT6 (C3) compared to ZT18 (C4). Note that silver grain
accumulation around cell nuclei was similar at the two time points (arrows in C3 and C4). Astrocytes stained with DIG-labeled riboprobe for Fabp7
(unstained astrocytic nuclei (n) are indicated) were also co-labeled for mRNA for the astrocyte protein, GFAP (silver grain accumulations). Unstained
neuronal nuclei (N) are shown for reference. A representative tissue section subjected to immunohistochemistry with anti-Fabp7 antibodies is shown
in C6. Note astrocytic processes emanating from stained cell somata. Bar in A = 400 mm; in C1,C2 = 100 mm; in C3,C4 = 20 mm; in C5 = 10 mm,
C6 = 30 mm BLA, basolateral amygdala; MA, medial amygdala



Figure 5. Fabp7 mRNA expression is diurnally regulated in hippocampus and subgranular zone of dentate gyrus. A) In situ
hybridization of coronal tissue sections probed for Fabp7 mRNA at four diurnal time points. Top panels, phosphorimages of hippocampus, bottom
panels, dark field images of a different set of hybridized sections subjected to emulsion autoradiography. Higher levels of Fabp7 were evident during
lights-on. Arrowheads in bottom panels indicate subgranular zone of dentate gyrus (DG). B) Graphic representation of in situ hybridization data
indicating elevated levels of Fabp7 mRNA during lights-on in hippocampus (top panel) and subgranular zone (bottom panel). One-way ANOVA
(p,0.001). ***p,0.001, **p,0.01 vs. ZT18 (post-hoc Bonferroni). Each value represents the average +/2 S.E.M. N = 2–4 per time point. C) Sections
subjected to in situ hybridization for Fabp7 and emulsion autoradiography. Light- (C1, C2) and dark field (C3, C4) micrographs of sections from ZT6
and ZT18, respectively. Arrowheads indicate Fabp7 positive precursor cells in subgranular zone. Sections co-stained for Fabp7 mRNA (dark stain) and
nestin mRNA (dark silver grains) identified co-labeled precursors in the subgranular zone (C5). Sections subjected to immunohistochemistry for Fabp7
(C6) revealed radial fibers emanating from stained cell bodies (arrows) as previously described. Bar in upper, lightfield micrographs in A = 500 mm; in
lower, darkfield micrographs in A = 200 mm; in C1,C2 = 30 mm; in C3,C4 = 30 mm; in C5 = 5 mm; C6 = 25 mm. DG, dentate gyrus; GCL, granule cell layer;
H, hebenula; HF, hippocampal fissure; T, thalamus

were found to co-express Fabp7 mRNA (note Fabp7-stained mRNA levels oscillate within these cells. Further, we identified
precursor in Fig. 5C5) and mRNA for the intermediate filament lower levels of Fabp7 expression within the granule cell layer or
protein, Nestin as previously described [37]. Precursor cells within directly below the SGZ in agreement with previous observations
the SGZ were also strongly Fabp7 immunoreactive (Fig. 5C6). [37] suggesting that the presence of Fabp7 in astrocytes within the
Since Fabp7 is confined to radial glia-like type-1 and proliferative granule cell region did not contribute significantly to our analysis
type-2 cells within the SGZ [38], our results indicate that Fabp7 of SGZ. Interestingly, we found that cells of the SGZ underwent



diurnal changes in Fabp7 mRNA abundance that paralleled the directly influence PPAR-mediated transcription [45–47], and we
regulation of Fabp7 expression in the hippocampus proper as well observe peak Fabp7 protein levels that proceed Fabp7 transcript
as throughout the brain (lower panel in 5B). These results suggest levels, it is intriguing to speculate that Fabp7 protein influences its
that Fabp7 mRNA undergoes synchronized diurnal changes in own transcription via PPAR. The importance of E-box elements in
expression in multiple cell-types in the brain. the diurnal regulation of Fabp7, however, is uncertain since per2,
but not Fabp7, has been found to cycle in astrocyte culture [48];
Discussion Gerstner and Landry, unpublished observations). Further, unlike
Fabp7, circadian genes like CLOCK, per1, per2 and d-albumin
This report describes the diurnal regulation of brain fatty acid binding protein cycle in different temporal phases in different brain
binding protein (Fabp7) within astrocytes and subgranular zone regions [49,50]. It is likely that the regulation of Fabp7 expression
precursors of the adult murine brain. Synchronized cycling of results from a combination of PPAR and E-box elements as well as
Fabp7 mRNA occurred throughout the brain with peak levels other transcriptional mechanisms. Further study will be required to
present at the beginning of the light period and lowest levels near determine the elements that influence Fabp7 expression in mature
lights-off. Fabp7 protein was also found to change over a 24 hour brain.
period such that an accumulation in protein occurred towards the Peak Fabp7 mRNA levels preceded peak protein levels by about
middle of the dark period when Fabp7 mRNA levels were 12 hours and a gradual decline in mRNA occurred as protein
declining. Interestingly, we observed no changes in Fabp7 mRNA levels increased. These changes are similar to known circadian and
in young postnatal brain but found Fabp7 to cycle in precursor diurnally regulated genes, although the delay that we see here is
cells of the adult hippocampus. These data suggest that Fabp7 is a somewhat longer [51–53]. It may be that mechanisms that
novel cycling gene and that its regulation is driven by mechanisms influence Fabp7 mRNA levels during lights-on are in place to
that confer brain-wide, coordinated oscillations in expression. increase the amount of Fabp7 protein during the active (dark)
Given that Fabp7 expression is downstream of Notch signaling period, perhaps in response to enhanced fatty acid demand at this
[15], Notch-mediated regulation of Fabp7 is a putative mechanism time. Since high levels in Fabp7 protein in brain during the dark
for the oscillation in Fabp7 mRNA that we observe. In fact, a parallel diurnal changes in fatty acid binding proteins in liver and
binding site for the Notch effector CBF1 is essential for the heart, which are also elevated during the active period [54], a
transcriptional regulation of Fabp7 in radial glial cells and CBF1 mechanism for modulating the delivery or utilization of fatty acids
elements within 400 base pairs of the Fabp7 transcription start site during activity may be a common theme in a number of organ
are necessary and sufficient for transgene activity in embryonic systems. Further, the diurnal rhythmicity of fatty acid binding
and postnatal day (P) 6 brain [15]. Further, Notch signaling is protein expression in heart and liver are influenced by levels of
thought to synchronize the segmentation clock for somitogenesis serum cholesterol [54] implicating fatty acid utilization as a
where it operates in somite precursor cells of the mesoderm that modulating factor in fatty acid binding protein expression.
oscillate through phases of the cell cycle [39]. It is not known Diurnal cycling in processes that use fatty acids as functional
whether Notch signaling has a similar role later in development. components may be a common feature of homeostatic mechanisms.
Also, we did not observe changes in Fabp7 mRNA expression For example, fatty acid amide hydrolase (FAAH) activity has been
across the light-dark cycle in early postnatal brain (P6) when Notch shown to cycle throughout the day [55], and to modulate sleep
signaling is known to influence Fabp7 expression [15]. Since [56,57]. Similarly, the fatty-acid metabolites anandamide and 2-
astrocyte migration and maturation is not complete at this time in arachidonylgycerol have been shown to vary globally across the
development [36] and because Fabp7 levels are greatly elevated at light-dark cycle [55] and endocannabinoids such as these have been
this age compared to adult [12], it may be that an inability to found to participate in the regulation of complex behaviors such as
observe time-of-day changes in Fabp7 mRNA levels is a result of a feeding, sleep/wake cycles, and response to stress [58–60]. How fatty
ceiling affect. Conversely, it may be that the diurnal cycling of acids required for these processes are delivered and distributed
Fabp7 mRNA is restricted to mature brain. In addition, other within cells of the nervous system is not well understood [61] and the
transcriptional regulators, such as Pax6 and POU/Pbx have also cycling of Fabp7 is the first report of an oscillating protein involved in
been found to influence the developmental profile of Fabp7 the movement of fatty acids. Diurnal changes in the transport and
expression [16,17], suggesting alternative regulatory mechanisms delivery of fatty acids may therefore be a critical component of lipid-
for Fabp7 transcription. dependant, homeostatic mechanisms.
Whether Fapb7 expression is tied to known clock mechanisms or The brain-wide diurnal regulation of Fabp7 mRNA suggests
is a component of a novel clock pathway is not known. that either a cell-autonomous mechanism governs its regulation, or
Bioinformatic analyses of the Fabp7 gene suggest an influence of that diurnal levels are controlled by a global coordinated signaling
known clock mechanisms given the presence within the proximal system. The diurnal regulation of Fabp7 within granule cell
Fabp7 promoter of cis-elements such as peroxisome proliferater precursors of the hippocampus suggests cell-autonomous mecha-
activated receptor (PPRE) and E-box elements. These cis-elements nisms since these cells are not astrocytes and are only transiently
play important roles in known clock-related transcriptional Fabp7 positive [37]. However, since granule-cell precursors are
regulation [40]. Functional PPREs are present in circadian genes continually born within the subgranular zone [38] where we
such as BMAL and Rev-erb-alpha [41,42] and the PPRE- observed synchronized diurnal expression of Fabp7, we would
transactivator, peroxisome proliferater activated receptor-alpha predict that Fabp7 cycles similarly in precursor cells of different
(PPARa), is itself regulated by the circadian modulator, CLOCK birth dates, indicating a coordinated (non-cell autonomous) system
[43]. In addition, it has been shown that CLOCK:BMAL1 of regulation. Since astrocytes are known to contact subgranular
transactivates PPAR target genes via the PPRE [44]. Since progenitors [62], it is likely that radial glial-like precursor cells are
CLOCK is known to control the transcription of PPARs, and capable of receiving signals from astrocytes. Further, populations
PPREs are present within the Fabp7 promoter, it may be that the of astrocytes have been shown to undergo coordinated activity.
diurnal oscillation in Fabp7 observed in this study is driven by a For example, astrocytic purinergic signaling has been shown to
CLOCK, PPAR-mediated pathway. Further, since other fatty acid synchronize pulses of calcium [63,64] and to modulate hetero-
binding proteins have been shown to translocate to the nucleus and synaptic depression through inhibition of presynaptic terminals



[65]. Indeed, purinergic signaling by adenosine, as well as lipid- the Megaprime DNA labeling system (Amersham Biosciences,
derived prostaglandins, is known to modulate behavioral state, England). Fabp7 forward primer, AGACCCGAGTTCCTCCA-
long-term potentiation and long-term depression [66–68]. Astro- GTT, reverse primer, CCTCCACACCGAAGACAAAC. Fabp5
cyte derived calcium signals have also been shown to correlate forward primer, CAATTCAGTGAGCGGTCAAA, reverse prim-
with neuronal activity [69], and to couple this activity to cerebral er, TAAGCTTGGATCTCCCTTTATTCTATAAAA. Probe was
microcirculation [70]. That populations of astrocytes are capable mixed with hybrisol, and incubated overnight at 42uC. Blots were
of coordinated activity, therefore, further supports the notion that washed three times in 26 SSC (16SSC = 150 mM NaCl, 15 mM
a broad astrocyte-mediated signaling system occurs in brain. Na citrate, pH, 7.0), 1% SDS at room temperature, then two times
Although, the modulation of the cycling of Fabp7 that we observe for 30 min in 26SSC, 1% SDS at 50uC, and finally one time for
maybe extrinsic to the brain, i.e., driven by fluctuating serum lipid 30 min in 0.56SSC, 1% SDS at 60uC. Following washes, blots were
concentrations that influence astrocyte metabolism, it seems more exposed to a phosphoscreen for 3 days and image analysis was
likely that Fabp7 expression is driven by a yet undefined intrinsic performed using the Storm 860 and ImageQuant 5.2 software
brain signaling system that involves astrocyte communication. (Molecular Dynamics, Sunnyvale, CA). A 983-bp PCR product for
This is the first report to describe a diurnally regulated gene, glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was generated
Fabp7 that cycles globally in astrocytes and related cell-types in the as described previously [28].
mammalian central nervous system. The global cycling pattern of
Fabp7 implicates a coordinated mechanism of regulation that Quantitative Reverse Transcriptase PCR
extends to radial glial-like cells of the hippocampal subgranular zone All quantitative reverse transcriptase PCR (qRT-PCR) was
and is consistent with growing evidence that astrocytes coordinate performed at the University of Wisconsin-Madison Genome
homeostatic mechanisms in brain. Although the mechanism for this Center. Complementary DNA was generated using Superscript
regulation is uncertain, other globally regulated genes, including II Reverse Transcriptase (SSRII; Invitrogen, Carlsbad, California)
circadian and clock-controlled transcripts, cycle in different phases in as follows: Five mg of total RNA was added to 100 pmole of T7
brain regions outside of the suprachiasmatic circadian pacemaker oligo(dT) primer (GGCCAGTGAATTGTAATACGACTCAC-
making the cycling of Fabp7 unique. Given the influence that known TATAGGGAGGCGG-d(T)24) and the reaction volume was
circadian genes and lipid metabolites exert on complex behavior, brought to 12 ml total volume with PCR grade water. The
and the role that astrocytes play in homeostasis and plasticity, the reaction was incubated at 70uC for 10 minutes in a Mastercycler
global cycling of Fabp7 may be intimately related to the ep thermocycler (Eppendorf, Hamburg-Eppendorf, Germany) and
maintenance of these processes. placed on ice for 2 minutes. Four ml of 56 SSRII buffer, 2 ml of
0.1 M DTT, and 1 ml of 10 mM dNTPs were added and the
Materials and Methods reaction was incubated in a thermocycler for 2 minutes at 42uC.
Subjects and Handling After incubation, 1 ml of SSRII reverse transcriptase was added
Mice (C57BL/6) were either purchased directly from Harlan and the reaction was incubated at 42uC for 1 hour. cDNA was
Sprague-Dawley (adult) or taken at specific ages from a breeding then quantified using an ND-1000 Spectrophotometer (NanoDrop
colony. A total number of 111 animals were used in this study. Technologies, Wilmington, Delaware) and normalized to 20 ng/
Animals were entrained to a 12 hour light, 12 hour dark schedule ml with PCR grade water.
for at least 5 weeks. For tissue collection, animals were sacrificed PCR Methods: Individual reactions contained 16 Probes
by decapitation, their brains dissected, flash frozen at 230uC in 2- MasterMix (F. Hoffmann-La Roche Ltd, Basel, Switzerland),
methylbutane, and stored at 280uC. For tissue punches of specific 0.05 U Uracil-N-Glycosylase, 16 LCGreen Plus (Idaho Technolo-
regions, brains were embedded in OCT media and sectioned on a gy, Salt Lake City, Utah), 200 nM of each primer and 20 ng of
Leica (CM3050) cryostat at 225uC as follows (according to cDNA. Fabp7 mRNA forward primer, CTCTGGGCGTGGGC-
Paxinos & Franklin Mouse Brain Atlas, 2nd ed.): 1) TMN: Two sets TTT, reverse primer, TTCCTGACTGATAATCACAGTTG-
of two 400 mm bilateral 1 mm diameter punches from Interaural GTT, Fabp7 intron 1 forward primer, CGTACTGTTTTCTTCT-
1.56 to 0.76; 2) LC: Two sets of two 300 mm bilateral 1 mm TAACTCTGTATTTTG, reverse primer, GATTTCTGAAC-
diameter punches from Interaural 21.40 to 22.00; 3) Pons: Two TATTTTGGAAGTTGCTG. The total reaction volume of 5 ml
sets of one 300 mm 2 mm diameter punch from Interaural 21.40 was overlaid with 10 m of Chillout Wax (Bio-Rad Laboratories,
to 22.00. Punches from the same brain region were pooled from Hercules, California). All reactions were run on a LightCycler 480
each of the animals within the same group, and stored at 280uC Real-Time PCR System (F. Hoffmann-La Roche Ltd). The cycling
until RNA isolation. All animal care and use procedures were in parameters were; 50uC for 5 minutes, 95uC for 10 minutes and then
strict accordance with University of Wisconsin IACUC and 50 cycles of 95uC for 15 seconds and 60uC for 30 seconds.
National Institute of Health guidelines for the humane treatment Fluorescence data was collected at a wavelength setting of 450–
of laboratory animals. 500 nm. Analysis was performed using both the LightCycler 480’s
proprietary software and qBASE v1.3.5 (Jan Hellemans, Center for
Northern Blot Analysis Medical Genetics, Ghent University, Belgium).
Northern blotting was performed essentially as described
previously [28]. Briefly, brains were dissected and total RNA was In Situ Hybridization
isolated using TRIZOL (Invitrogen, Carlsbad, CA), according to the In situ hybridization was performed as previously described [71].
manufacturer’s specifications, and stored at 280uC. Prior to loading, Briefly, post-fixed, cryostat sections (20 mm) were pretreated with
each sample was incubated with sample buffer (7.5%Formaldehyde, Proteinase K (0.2 mg/ml; Promega, Madison, WI) and hybridized
43%Formamide, 12% 10XMOPS, 0.12%Ethidium Bromide) for overnight at 55uC in 150 ml of 35S-labeled antisense riboprobe
5 min at 56uC, and then cooled on ice for 5 min. Northern Blots (10,000 cpms/ml). Following posthybridzation washes, sections
consisted of 1 mg of total RNA per lane and were electrophoresed on were exposed to a phosphoscreen for 6 days. Image analysis was
a 1.2% agarose gel. RNA was transferred overnight onto a sheet of performed using the Storm 860 and ImageQuant 5.2 software
GeneScreen Plus nitrocellulose (NEN Life Science Products, Boston, (Molecular Dynamics Sunnyvale, CA). For densitometric analysis
MA). DNA templates generated by PCR were labeled with 32P using of in situ hybridization data, specific regions from a minimum of



four sections were averaged per animal per time point, and Immunohistochemistry
normalized to background as described previously [72]. Sections were cut at 50 mm on a vibrotome and stored in 0.01 M
Antisense (35S- or digoxigenin (DIG) -labeled) riboprobe was phosphate-buffered saline (PBS; pH 7.4) and 0.01% azide solutions
made from Fabp7, Nestin or Glial fibrillary acidic protein (GFAP) until processing. Sections were thoroughly washed in PBS, and
PCR templates derived from T7-tagged reverse or forward endogenase peroxidase activity was quenched by incubation for
primers, respectively. Fabp7 forward primer: AGACCCGAGTT- 10 minutes in PBS containing 10% methanol, 2.5% hydrogen
CCTCCAGTT, reverse primer, CCTCCACACCGAAGA- peroxide. Sections were again rinsed, then placed in blocking solution
CAAAC; Nestin forward primer, GGTCAAGACGCTGGAG- containing 10% normal goat serum (NGS) and 0.2% Triton X-100
GAG, reverse primer, GGAGACCTGGCTCACTTTTTC; for 30 min. Sections were rinsed four times in PBS and then
GFAP forward primer: AATGCTGGCTTCAAGGAGAC, re- incubated with the primary Fabp7 antibody (1:2000 dilusion) at 4uC
verse primer, AGGACAACTGAGCGGACACT. Templates used for 72–96 h. After three rinses in PBS, sections were incubated in
for in vitro transcription were generated using standard PCR Alexa Flour goat anti-rabbit 2u antibody (1:400; Invitrogen, Carlsbad,
conditions. T7 sequence tag extending the reverse primer was CA) for 2 h. Following rinsing and coverslipping, photographic
GGCCAGTGAATTGTAATACGACTCACTATAGGGAGG- images were taken on a Leica DMI 6000 B inverted microscope.
CGG. In vitro transcription reactions were carried out as described
by Promega Biotech (Madison, WI) for 35S-labeled riboprobe and Supporting Information
by Hoffman-La Roche (Nutley, NJ) for DIG-labeled riboprobe.
For emulsion autoradiography, sections processed for in situ Figure S1 Fabp7 messenger (m-) and heteronuclear (hn-) RNA
hybridization were dipped in NTB3 liquid emulsion (Eastman underwent changes in abundance over a 24 hour period. RNA
Kodak, Rochester, New York) under safelight conditions and from pons subjected to quantitative RT PCR (qPCR) revealed
stored at 4uC for 6 weeks. Processing was as described by the diurnal changes in Fabp7 mRNA expression that mirrored results
manufacturer. Following development, sections were lightly from Northern blotting. qPCR for Fabp7 intron 1 (average of
stained in cresyl violet (0.1%), dehydrated in an ethanol series TMN, pons, and LC) used as a measure of heteronuclear RNA
and mounted. For double in situ hybridization analysis, sections and therefore transcriptional activity, identified elevated levels of
were hybridized to both riboprobes, washed as described above intron 1 near the end of the dark period and after lights-on. Note
and then processed for alkaline phosphatase as described by the that increases in Fapb7 hnRNA immediately preceded the apex of
manufacturer (Hoffman-La Roche, Nutley, NJ). Sections were Fabp7 mRNA. RNA levels are normalized against Gapdh.
then processed with autoradiographic emulsion for 6 weeks. Found at: doi:10.1371/journal.pone.0001631.s001 (0.21 MB TIF)
For analysis of diurnal time points using emulsion autoradiog- Figure S2 Fabp7 mRNA did not cycle in early postnatal brain. A)
raphy, all sections within a series were processed under identical RNA collected from postnatal day (P) 6 whole brain analyzed with
conditions in the same run (N = 2–5 animals per group). The qPCR identified significantly higher levels of Fabp7 compared with
subgranular zone (SGZ) of hippocampus was analyzed using adult whole brain (relative to Gapdh); ***p,0.001 (t-test) B) Analysis
Image J software (NIH; http://rsb.info.nih.gov). Briefly, the by qPCR of Fabp7 mRNA levels across the day revealed statistically
ventral SGZ in dorsal hippocampal sections extending from significant diurnal changes in adult whole brain that mirrored
Interaural 1.62 to 2.22 mm were boxed (minimum of four sections previous results, while there were no diurnal changes in P6 whole
per time point per animal), counts tabulated and background brain (relative to Gapdh, normalized to mean levels within age
subtracted, and averaged. Final values were calculated by group); Two-way ANOVA, (p = 0.004); A significant difference in
averaging across animals (N = 2–5 per group). Prior to emulsion diurnal levels were observed between adult and P6: ZT2.5,
autoradiography, changes in hippocampus were cross-validated **p,0.01; ZT14.5, *p,0.05 (post-hoc Bonferroni). Each value
using phosphorimaging. represents the average +/2 S.E.M. N = 2–3 per timepoint. Animals
were maintained on a 10:14 hour light-dark schedule.
Western blotting Found at: doi:10.1371/journal.pone.0001631.s002 (0.24 MB TIF)
Samples prepared from whole brain were subjected to SDS-
polyacrylamide gel electrophoresis by separating 10 mg protein per Acknowledgments
lane on a 10–20% gradient pre-cast gel (Biorad, Hercules, CA).
We would like to thank Catherine Smith for excellent technical assistance
Protein was transferred to 0.2 mm Protran nitrocellulose mem-
with immunocytochemistry and Josh Smith and the University of
branes (PerkinElmer, Boston, MA), blocked in 5% dried milk Wisconsin-Madison Genome Center for expert qRT-PCR services. We
powder in 50 mM Tris-HCl, pH 7.5, 15 mM NaCl, 0.5% Tween- would also like to thank Jules ‘‘10:14’’ Panksepp, and Dr. Garet Lahvis, for
20 (TBST), washed briefly in TBST and incubated in primary providing mouse facilities for some of the studies.
antibody in TBST overnight at 4uC. Fabp7 antibody (Chemicon,
Temecula, CA) was used at 1:1000 dilution in TBST, antibody to Author Contributions
b-actin (Imgenex, San Diego, CA) was used at 1:10,000 dilution
Conceived and designed the experiments: JY CL JG TL. Performed the
and anti-glyceraldehyde-3-phosphate dehydrogenase (Gapdh;
experiments: JG QB WV TL. Analyzed the data: CL JG QB. Wrote the
Imgenex, San Diego, CA), at 1:5,000 dilution. Blots were then paper: JY CL JG. Other: Jason Gerstner’s primary supervisor: JV. Aided
washed 3 times in TBST, incubated for 1 hour in anti-rabbit horse greatly in the progression of the work, the organization of critical
radish peroxidase-conjugated secondary antibody (1:7500 in experiments and the writing of the article: JV. Aided in the initial
TBST; KPL, Gaithersburg, MD), washed 3 times in TBST and interpretation and analysis of results pertaining to the identification of the
incubated in ECL plus Western blotting detection reagent for diurnal regulation of Fabp7 in mature brain: TL. Ran the Northern blots
5 minutes based on the manufacturers instructions (GE Health- that lead to the initial observations and provided critical input on the
progression of the work: TL JG. Isolated RNA used in many of the
care, Buckinghamshire, UK). Visualization was performed by
experiments outlined in the first part of the Results: WV. Aided in
chemoluminescence scanning (medium sensitivity, photomultiplier Northern blotting and data analysis: WV. Isolated all protein samples for
voltage, 600 volts) on a Typhoon 9410 phosphorimager (GE immunoblotting and performed all immunoblot experiments: QB.
Healthcare, Buckinghamshire, UK). Densitometric analysis was Subjected the immunodata to statistical analysis, wrote the methods
performed using ImageQuant version 5.2. section pertaining to immunoblotting and aided in the writing of the



Results section: QB. Aided in the in situ hybridization technique: QB. experiments outlined in the article: JG. Performed much of the in situ
Performed the initial analysis that lead to the identification of the cycling of analysis and aided Mr. Gerstner in the generation of the figures: CL.
the gene in adult brain: JG. Performed many of the analyses including Supervised, with Dr. Yin, the progression of the work: CL. Co-wrote the
those listed in figure 1, 2, 4 and 5: JG. Contributed to many of the article: CL.

References
1. Bernlohr DA, Simpson MA, Hertzel AV, Banaszak LJ (1997) Intracellular lipid- 28. Gerstner JR, Vander Heyden WM, Lavaute TM, Landry CF (2006) Profiles of
binding proteins and their genes. Annu Rev Nutr 17: 277–303. novel diurnally regulated genes in mouse hypothalamus: Expression analysis of
2. Chmurzynska A (2006) The multigene family of fatty acid-binding proteins the cysteine and histidine-rich domain-containing, zinc-binding protein 1, the
(FABPs): function, structure and polymorphism. J Appl Genet 47: 39–48. fatty acid-binding protein 7 and the GTPase, ras-like family member 11b.
3. Feng L, Hatten ME, Heintz N (1994) Brain lipid-binding protein (BLBP): a novel Neuroscience 139: 1435–1448.
signaling system in the developing mammalian CNS. Neuron 12: 895–908. 29. Panda S, Antoch MP, Miller BH, Su AI, Schook AB, et al. (2002) Coordinated
4. Khan SH, Sorof S (1994) Liver fatty acid-binding protein: specific mediator of transcription of key pathways in the mouse by the circadian clock. Cell 109:
the mitogenesis induced by two classes of carcinogenic peroxisome proliferators. 307–320.
Proc Natl Acad Sci U S A 91: 848–852. 30. Ueda HR, Chen W, Adachi A, Wakamatsu H, Hayashi S, et al. (2002) A
5. Huynh HT, Larsson C, Narod S, Pollak M (1995) Tumor suppressor activity of transcription factor response element for gene expression during circadian night.
the gene encoding mammary-derived growth inhibitor. Cancer Res 55: Nature 418: 534–539.
2225–2231. 31. Panula P, Yang HY, Costa E (1984) Histamine-containing neurons in the rat
6. Prinsen CF, Veerkamp JH (1998) Transfection of L6 myoblasts with adipocyte hypothalamus. Proc Natl Acad Sci U S A 81: 2572–2576.
fatty acid-binding protein cDNA does not affect fatty acid uptake but disturbs 32. Lin JS, Sakai K, Jouvet M (1988) Evidence for histaminergic arousal
lipid metabolism and fusion. Biochem J 329 ( Pt 2): 265–273. mechanisms in the hypothalamus of cat. Neuropharmacology 27: 111–122.
7. Tang MK, Kindler PM, Cai DQ, Chow PH, Li M, et al. (2004) Heart-type fatty 33. Brown RE, Stevens DR, Haas HL (2001) The physiology of brain histamine.
acid binding proteins are upregulated during terminal differentiation of mouse Prog Neurobiol 63: 637–672.
cardiomyocytes, as revealed by proteomic analysis. Cell Tissue Res 316: 34. Aston-Jones G, Bloom FE (1981) Activity of norepinephrine-containing locus
339–347. coeruleus neurons in behaving rats anticipates fluctuations in the sleep-waking
8. Veerkamp JH, Zimmerman AW (2001) Fatty acid-binding proteins of nervous cycle. J Neurosci 1: 876–886.
tissue. J Mol Neurosci 16: 133–142; discussion 151–137. 35. Gerstner JR, Landry CF (2007) The zinc-binding protein chordc1 undergoes
9. Owada Y, Abdelwahab SA, Kitanaka N, Sakagami H, Takano H, et al. (2006) complex diurnal changes in mRNA expression during mouse brain develop-
Altered emotional behavioral responses in mice lacking brain-type fatty acid- ment. Neurochem Res 32: 241–250.
binding protein gene. Eur J Neurosci 24: 175–187. 36. Marshall CA, Suzuki SO, Goldman JE (2003) Gliogenic and neurogenic
10. Liu Y, Molina CA, Welcher AA, Longo LD, De Leon M (1997) Expression of progenitors of the subventricular zone: who are they, where did they come from,
DA11, a neuronal-injury-induced fatty acid binding protein, coincides with axon and where are they going? Glia 43: 52–61.
growth and neuronal differentiation during central nervous system development. 37. Steiner B, Klempin F, Wang L, Kott M, Kettenmann H, et al. (2006) Type-2
J Neurosci Res 48: 551–562. cells as link between glial and neuronal lineage in adult hippocampal
11. Liu Y, Longo LD, De Leon M (2000) In situ and immunocytochemical neurogenesis. Glia 54: 805–814.
localization of E-FABP mRNA and protein during neuronal migration and 38. Kempermann G, Jessberger S, Steiner B, Kronenberg G (2004) Milestones of
differentiation in the rat brain. Brain Res 852: 16–27. neuronal development in the adult hippocampus. Trends Neurosci 27: 447–452.
12. Bennett E, Stenvers KL, Lund PK, Popko B (1994) Cloning and characteriza- 39. Giudicelli F, Lewis J (2004) The vertebrate segmentation clock. Curr Opin
tion of a cDNA encoding a novel fatty acid binding protein from rat brain. Genet Dev 14: 407–414.
Journal of neurochemistry 63: 1616–1624. 40. Kohsaka A, Bass J (2007) A sense of time: how molecular clocks organize
13. Kurtz A, Zimmer A, Schnutgen F, Bruning G, Spener F, et al. (1994) The metabolism. Trends Endocrinol Metab 18: 4–11.
expression pattern of a novel gene encoding brain-fatty acid binding protein 41. Fontaine C, Dubois G, Duguay Y, Helledie T, Vu-Dac N, et al. (2003) The
correlates with neuronal and glial cell development. Development 120: orphan nuclear receptor Rev-Erbalpha is a peroxisome proliferator-activated
2637–2649. receptor (PPAR) gamma target gene and promotes PPARgamma-induced
14. Anthony TE, Klein C, Fishell G, Heintz N (2004) Radial glia serve as neuronal adipocyte differentiation. J Biol Chem 278: 37672–37680.
progenitors in all regions of the central nervous system. Neuron 41: 881–890. 42. Canaple L, Rambaud J, Dkhissi-Benyahya O, Rayet B, Tan NS, et al. (2006)
15. Anthony TE, Mason HA, Gridley T, Fishell G, Heintz N (2005) Brain lipid- Reciprocal regulation of brain and muscle Arnt-like protein 1 and peroxisome
binding protein is a direct target of Notch signaling in radial glial cells. Genes proliferator-activated receptor alpha defines a novel positive feedback loop in the
Dev 19: 1028–1033. rodent liver circadian clock. Mol Endocrinol 20: 1715–1727.
16. Arai Y, Funatsu N, Numayama-Tsuruta K, Nomura T, Nakamura S, et al. 43. Oishi K, Shirai H, Ishida N (2005) CLOCK is involved in the circadian
(2005) Role of Fabp7, a downstream gene of Pax6, in the maintenance of transactivation of peroxisome-proliferator-activated receptor alpha (PPARalpha)
neuroepithelial cells during early embryonic development of the rat cortex. in mice. Biochem J 386: 575–581.
J Neurosci 25: 9752–9761. 44. Inoue I, Shinoda Y, Ikeda M, Hayashi K, Kanazawa K, et al. (2005) CLOCK/
17. Josephson R, Muller T, Pickel J, Okabe S, Reynolds K, et al. (1998) POU BMAL1 is involved in lipid metabolism via transactivation of the peroxisome
transcription factors control expression of CNS stem cell-specific genes. proliferator-activated receptor (PPAR) response element. J Atheroscler Thromb
Development 125: 3087–3100. 12: 169–174.
18. Liang Y, Diehn M, Watson N, Bollen AW, Aldape KD, et al. (2005) Gene 45. Wolfrum C, Borrmann CM, Borchers T, Spener F (2001) Fatty acids and
expression profiling reveals molecularly and clinically distinct subtypes of hypolipidemic drugs regulate peroxisome proliferator-activated receptors alpha -
glioblastoma multiforme. Proc Natl Acad Sci U S A 102: 5814–5819. and gamma-mediated gene expression via liver fatty acid binding protein: a
19. Sarov-Blat L, So WV, Liu L, Rosbash M (2000) The Drosophila takeout gene is signaling path to the nucleus. Proc Natl Acad Sci U S A 98: 2323–2328.
a novel molecular link between circadian rhythms and feeding behavior. Cell 46. Tan NS, Shaw NS, Vinckenbosch N, Liu P, Yasmin R, et al. (2002) Selective
101: 647–656. cooperation between fatty acid binding proteins and peroxisome proliferator-
20. Dudley CA, Erbel-Sieler C, Estill SJ, Reick M, Franken P, et al. (2003) Altered activated receptors in regulating transcription. Mol Cell Biol 22: 5114–5127.
patterns of sleep and behavioral adaptability in NPAS2-deficient mice. Science 47. Adida A, Spener F (2006) Adipocyte-type fatty acid-binding protein as inter-
301: 379–383. compartmental shuttle for peroxisome proliferator activated receptor gamma
21. Turek FW, Joshu C, Kohsaka A, Lin E, Ivanova G, et al. (2005) Obesity and agonists in cultured cell. Biochim Biophys Acta 1761: 172–181.
metabolic syndrome in circadian Clock mutant mice. Science 308: 1043–1045. 48. Prolo LM, Takahashi JS, Herzog ED (2005) Circadian rhythm generation and
22. Feillet CA, Ripperger JA, Magnone MC, Dulloo A, Albrecht U, et al. (2006) entrainment in astrocytes. J Neurosci 25: 404–408.
Lack of food anticipation in Per2 mutant mice. Curr Biol 16: 2016–2022. 49. Yan L, Miyake S, Okamura H (2000) Distribution and circadian expression of
23. Garcia JA, Zhang D, Estill SJ, Michnoff C, Rutter J, et al. (2000) Impaired cued dbp in SCN and extra-SCN areas in the mouse brain. J Neurosci Res 59:
and contextual memory in NPAS2-deficient mice. Science 288: 2226–2230. 291–295.
24. Sakai T, Tamura T, Kitamoto T, Kidokoro Y (2004) A clock gene, period, plays 50. Shieh KR, Yang SC, Lu XY, Akil H, Watson SJ (2005) Diurnal rhythmic
a key role in long-term memory formation in Drosophila. Proc Natl Acad expression of the rhythm-related genes, rPeriod1, rPeriod2, and rClock, in the
Sci U S A 101: 16058–16063. rat brain. J Biomed Sci 12: 209–217.
25. Andretic R, Chaney S, Hirsh J (1999) Requirement of circadian genes for 51. So WV, Rosbash M (1997) Post-transcriptional regulation contributes to
cocaine sensitization in Drosophila. Science 285: 1066–1068. Drosophila clock gene mRNA cycling. Embo J 16: 7146–7155.
26. Abarca C, Albrecht U, Spanagel R (2002) Cocaine sensitization and reward are 52. Field MD, Maywood ES, O’Brien JA, Weaver DR, Reppert SM, et al. (2000)
under the influence of circadian genes and rhythm. Proc Natl Acad Sci U S A Analysis of clock proteins in mouse SCN demonstrates phylogenetic divergence
99: 9026–9030. of the circadian clockwork and resetting mechanisms. Neuron 25: 437–447.
27. McClung CA, Sidiropoulou K, Vitaterna M, Takahashi JS, White FJ, et al. 53. Suri V, Hall JC, Rosbash M (2000) Two novel doubletime mutants alter
(2005) Regulation of dopaminergic transmission and cocaine reward by the circadian properties and eliminate the delay between RNA and protein in
Clock gene. Proc Natl Acad Sci U S A 102: 9377–9381. Drosophila. J Neurosci 20: 7547–7555.



54. Glatz JF, Baerwaldt CC, Veerkamp JH, Kempen HJ (1984) Diurnal variation of 63. Guthrie PB, Knappenberger J, Segal M, Bennett MV, Charles AC, et al. (1999)
cytosolic fatty acid-binding protein content and of palmitate oxidation in rat liver ATP released from astrocytes mediates glial calcium waves. J Neurosci 19:
and heart. J Biol Chem 259: 4295–4300. 520–528.
55. Valenti M, Vigano D, Casico MG, Rubino T, Steardo L, et al. (2004) 64. Bowser DN, Khakh BS (2007) Vesicular ATP is the predominant cause of
Differential diurnal variations of anandamide and 2-arachidonoyl-glycerol levels intercellular calcium waves in astrocytes. J Gen Physiol 129: 485–491.
in rat brain. Cell Mol Life Sci 61: 945–950. 65. Pascual O, Casper KB, Kubera C, Zhang J, Revilla-Sanchez R, et al. (2005)
56. Huitron-Resendiz S, Sanchez-Alavez M, Wills DN, Cravatt BF, Henriksen SJ Astrocytic purinergic signaling coordinates synaptic networks. Science 310:
(2004) Characterization of the sleep-wake patterns in mice lacking fatty acid 113–116.
amide hydrolase. Sleep 27: 857–865. 66. Chen C, Magee JC, Bazan NG (2002) Cyclooxygenase-2 regulates prostaglandin
57. Murillo-Rodriguez E, Vazquez E, Millan-Aldaco D, Palomero-Rivero M, E2 signaling in hippocampal long-term synaptic plasticity. J Neurophysiol 87:
Drucker-Colin R (2007) Effects of the fatty acid amide hydrolase inhibitor 2851–2857.
URB597 on the sleep-wake cycle, c-Fos expression and dopamine levels of the 67. de Mendonca A, Costenla AR, Ribeiro JA (2002) Persistence of the
rat. Eur J Pharmacol 562: 82–91. neuromodulatory effects of adenosine on synaptic transmission after long-term
58. Bisogno T, De Petrocellis L, Di Marzo V (2002) Fatty acid amide hydrolase, an potentiation and long-term depression. Brain Res 932: 56–60.
enzyme with many bioactive substrates. Possible therapeutic implications. Curr 68. Huang ZL, Urade Y, Hayaishi O (2007) Prostaglandins and adenosine in the
Pharm Des 8: 533–547. regulation of sleep and wakefulness. Curr Opin Pharmacol 7: 33–38.
59. Wenger T, Moldrich G (2002) The role of endocannabinoids in the 69. Winship IR, Plaa N, Murphy TH (2007) Rapid astrocyte calcium signals
hypothalamic regulation of visceral function. Prostaglandins Leukot Essent correlate with neuronal activity and onset of the hemodynamic response in vivo.
Fatty Acids 66: 301–307. J Neurosci 27: 6268–6272.
60. Chen C, Bazan NG (2005) Lipid signaling: sleep, synaptic plasticity, and 70. Straub SV, Nelson MT (2007) Astrocytic calcium signaling: the information
neuroprotection. Prostaglandins Other Lipid Mediat 77: 65–76. currency coupling neuronal activity to the cerebral microcirculation. Trends
61. Qi K, Hall M, Deckelbaum RJ (2002) Long-chain polyunsaturated fatty acid Cardiovasc Med 17: 183–190.
accretion in brain. Curr Opin Clin Nutr Metab Care 5: 133–138. 71. Gerstner JR, Landry CF (2007) Expression of the transcriptional coactivator
62. Plumpe T, Ehninger D, Steiner B, Klempin F, Jessberger S, et al. (2006) CITED1 in the adult and developing murine brain. Dev Neurosci 29: 203–212.
Variability of doublecortin-associated dendrite maturation in adult hippocampal 72. Schiltz CA, Bremer QZ, Landry CF, Kelley AE (2007) Food-associated cues
neurogenesis is independent of the regulation of precursor cell proliferation. alter forebrain functional connectivity as assessed with immediate early gene and
BMC Neurosci 7: 77. proenkephalin expression. BMC Biol 5: 16.


Gerstner et al PLoS One 2008

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Viewers also liked

Viewers also liked (9)

Similar to Gerstner et al PLoS One 2008

Similar to Gerstner et al PLoS One 2008 (20)

Gerstner et al PLoS One 2008