Twin studies seminar1 /certified fixed orthodontic courses by Indian dental academy

Twin studies

INDIAN DENTAL ACADEMY
Leader in continuing dental education
www.indiandentalacademy.com


Introduction
The influence of genetic and environmental factors on growth and
development of the dentofacial complex has been the topic of debate and
controversy from ancient times till date. As far as dentofacial deformities
and malocclusion are concerned, there is arguably a significant role for
the case being genetic.
How and why disease show a familial distribution has been the goal of
many genetic epidemiological studies. A better understanding of the
relative effects of genes and environment on dentofacial and occlusal
parameters should improve our knowledge on the etiology of orthodontic
disorders and therefore also on the possibilities and limitations of the
orthodontic treatment and treatment planning
Heredity has been investigated by racial, family-line, and twin method,

the influence of heredity can be assessed by studying the family members,
observing the similarities and differences between mother-child, fatherchild, and sibling pairs

Sir Francis Galton (1875) was the first person who suggested, that studies on
twins would be particularly useful in defining the parts played by hereditary and
environmental influences in determining the form and size of the human body. He
suggested that different rates of growth towards a similar final outcome might be

found and stated that “Twins afford the most potential tools to evaluate the
interaction between “Nature and Nurture”.

The twin method is one of the most effective methods available for
investigating genetically determined variables in orthodontics as well as in other
medical fields, depending on the variance in the shape and the size of skull and
teeth on genetic and environmental influences.


Methods of studying genetic inheritance

1. Family studies, Pedigree analysis
2. Twin studies
3. Contingency method
4. Consanguinity method.
5. Population studies.

6. Racial comparisons.
7. Cytogenetic studies
8. Correlation studies


Family line Pedigree: One of the best methods to identify the characteristics or
diseases that cannot be explained by any other way can be done by their
occurrence between parents and offspring's.
A large number of families are necessary to be included in such studies. but
one should take into consideration the possibility that the trait can be dominant
(1:1) or recessive(3:1) in the population examined. The larger the number of
generations, the better a trait can be traced by repetitive occurrence.
Inbreeding: Some special family line studies lead to a better understanding of
the mechanism of transmission of characteristics. The study of inbreeding is
undertaken among isolated groups because there is a greater chance of
recessive traits to be produced often.
A study of a group where polygamy is practiced helps us in identifying the traits
transmitted by the father through different mothers to the children.
Twin studies: The twin method is one of the most effective methods available
for investigating genetically determined variables in orthodontics as well as in
other medical fields, depending on the variance in the shape and the size of
skull and teeth on genetic and environmental influences

Types of twins: 1. Monozygotic and 2. Dizygotic
Monozygotic twins: They are two individuals developed from a single fertilized
ovum, which divides into two at an early stage of development .Monozygotic
twins thus have a genetic make-up identical to each other.

Dizygotic twins: They are two individuals developed from two separate ova,
ovulated and fertilized at the same time. The two ova are fertilized by two
different sperms. They are not genetically identical as they develop from
different embryos.
They are analogous to siblings except that they have an almost similar
developmental environment including the intrauterine life.
Twin studies are done by analyzing monozygotic and dizygotic twins in a
specific manner. In case of monozygotic twins, they have a similar genetic
makeup ,but postnatally some of them have different environmental conditions.
This helps us to study the expression of the genetic factors and at the same
time, the environmental influences on this genetic expression. similarly in case
of dizygotic twins who have a similar environmental condition, the influence of
genetic as well as the environmental factors in the expression and development
of an individual can be studied.

Although twin studies have several limitations like identification of different
types of twins as well as their developmental environment, work of many
researches have thrown light into the understanding of genetic contribution in
the growth and development of an individual.
Causes of Identical Twinning:

It is not really known how identical twinning occurs, but there are some
theories. One theory is that it may be related to aging of the egg after
ovulation: an “over -ripe”egg. Another theory states that since the rate of
identical twins is higher in mothers who are either very young or very old
,identical twins may be due to the hormonal imbalances seen at these ages.
Supporting this, mothers of identical twins have been shown to have an earlier
menopause, which is also due to hormones.
Having two sets of identical twins would be a rare occurrence. The odds of
having more than one set of identical twins are at least one in 70,000.


Causes of Fraternal Twinning:
It is felt that fraternal twins are conceived due to higher levels of Follicular
Stimulating Harmone (FSH) in the mother. This Harmone stimulates the growth
and ripening of the eggs. Mother of fraternal twins tend to have increased height,
and weight, earlier start of the menstrual cycle, and shorter menstrual cycles, all
of which are probably hormone-related.
Once you have had fraternal twins, your chance of having another set of twins is
three to four times that of the general population.
Changing trends in Twinning: Acta Genet Med Gemellol 1993; 42 (3-4); 289-94
Biostatistics indicates a fall in the DZ twinning rate and a rise in the MZ
twinning over the decade between 1982-1991.These figures seem to reverse the
trend of the period 1960-1982.One plausible explanation is offered by the age –
data on mothers, which indicate that twins of different sex are more frequently
born to mothers above the age of 35.Since extensive family planning measures
have reduced the upper age limit of mothers, the birth-rate of twins of different
sex has also fallen. Due to the increased proportions of twins of the same sex,
Weinberg’s differential method will therefore report a decline in the DZ twinning
rate, wherever the mean age of mothers has fallen (I.e. most mothers do not
reproduce after the age of 35)

Twinning rates in Tamilnadu:

Rao PS. Inbaraj SG, Muthurathnam S.

Reported twining rates and relates these to maternal age, parity, and
consanguinity. Birth weights and other dimensions at birth and infant mortality are
studied. The overall twinning rate was 1 in 115 births.DZ twinning rates increased
significantly with maternal age and parity. The measurements at birth for likesexed twin pairs were lower than that of unlike-sexed, but the mortalities did not
differ significantly. Twins in general, had a several fold increase in mortality as
compared with singletons.
The twinning rates and epidemiological characteristics of births in southeast Uttar
Pradesh,-India.
Sharma
The data revealed higher incidence of breech twins (11.84% of all cotwins) as
compared to breech single births (2.18%).But the perinatal mortality and
caesarean section rates were similar in both twin and singleton pregnancies. The
twinning rate for mothers over 35yrs of age was about four times higher than that
in mothers younger than 20 yrs. Seasonal variations were observed for both twin
and singleton births. The highest frequency of births was observed from August
through October. But seasonal index for twinning rate showed a clear bimodal
distribution with peaks in April and September.

Mechanism of twinning
Steinman .G
Examined the role of calcium in conjoined twinning.
Conjoined twins are an extreme example of MZ twinning. Women were
subjected to environmental triggers. There is an increase in conjoint twinning
following use of oral contraceptives. It is hypothesized that this resulted from
prolonged ovulatory dysfunction in lightweight women.
The incidence of uniovular twinning is inversely related to women's
prepregnancy weights.
Concluded that factors that induce calcium depression, and delayed
implantation encourage uniovular duplication in general, and CJ twinning in
particular.
Maternal smoking and twinning:. Kallen.K
Smoking women, compared with non-smoking women, were at increased risk of
having DZ twins, but the risk increase was only evident among multiparas.No
association was found between MZ twinning and maternal smoking.
Social class and human twinning:
Bonnelykke.B
A trend was found in DZ –twinning, with significantly fewer DZ-twins born in the
lower social classes, but not in MZ-twinning. All results were controlled for
maternal age and parity.

Delayed ovulation and monozygotic twinning: Bomsel-Helmreich, Papiernik-Berkhauer.E
The relation between MZ twinning, chromosomal anomalies, and embryonic
mortality induced by delayed ovulation, could be connected and related to the
poor perinatal conditions frequently observed in human MZ twins.

The factors that influence twinning rates. -

Nylander P.P

Found that DZ twinning rates varied with maternal age and parity, the MZ
twinning rate remaining fairly constant .Other factors that influence DZ twinning
rates were maternal height, social class, ethnicity, and illegitimacy. No
significant association was found between twining and maternal blood groups
or season of the year.
An important factor that also influences twinning was maternal serum FSH
level.


Markers to identify the zygosity in twins
I. Morphologic marker:
1. Somatoscopic –Color and texture of skin ,hair, and eyes.
2. Somatometric : Shape of head, facial features, nose, eye
statuses.
3. Anthropometric – Human body measurements.
II. Traditional markers;
1. Dermatoglyphics : Study of dermal ridges on the palms.
2. Behavioral – Tongue rolling, arm folding, presence or absence of
mid phalangeal hair.
III. Genetic markers;
1. Blood group
2. Proteins and isoenzymes.
3. DNA / Molecular marker ( DNA polymorphism)

Dermatoglyphics
Proposed by Cummins and Midlo (1926) implies the study of
patterned tracies of fine ridges on the digits and palms.
Several studies have shown that most dermatoglyphic traits are
inherited with varying degree of complexity.
MZ twins show high intrapair similarity than DZ twins.
Finger prints are divided into 3 main groups consisting of
Arches – 5%
loops -65%
whorls. – 30%
Studies have shown that there is considerable difference with respect
to heritability, values between palmer and sole patterns, in that they
are the highest for sole loops, and triradii and the lowest for mot
palmar loops.----Finger print facts Dienekes-Anthropology -2003

Spitz, Moutin, Busnel –Used dermatoglyphics to establish zygosity in twins and
Correctly classified 86.75% of pairs.

Plain and rolled impressions
Fingerprints are impressions of the inner surfaces of the fingers from the first
joints to the tips. When a print is made by simple contact between the finger and
a receptive surface it is called as a PLAIN impression.

To record the finger impression in full from the ridged surface, it is necessary to
roll the finger from one nail end to the other end. Because of the method
adopted, the resultant impression is called a ROLLED impression


MONOZYGOTIC TWINS

DIZYGOTIC TWINS


ROLLED PRINT

PLAIN PRINT
TYPES OF FINGERPRINTS

ACCIDENTAL WHORL

LOOP

Core
Delta
WHORL

TENTED ARCH

ARCH
: FINGERPRINT PATTERNS

Cardinal points
With the exception of the arch patterns and accidental patterns, other
patterns viz loops, whorls, twinned loops and lateral pocket loops are either subdivided by “Counting” or “tracing” the ridges between the cardinal points, or fixed
points namely, the CORES and the DELTA’s.
Core : The core means the central point of the pattern. It is near the point where
the innermost ridge re-curves. In loop and whorl patterns there is only one core. In
twinned loops and lateral pocket loops there are two cores.
Delta : The delta, as its triangular structure occurs at the point where the ridges,
flowing across the finger, separate to enclose the basic pattern. One delta is found
in loop patterns and two deltas are found in whorls, twinned loops and lateral
pocket loops. Accidental patterns may have more than two deltas.

Core
Delta
WHORL


Ridge characteristics

Tracing the courses of an individual ridge, some ridges end abruptly, while others
fork and become two. Sometimes, the limbs of such a fork join together
again almost at once and form an “enclosure”.
Occasionally short
independent ridges and “Spur” formations occur. These peculiarities are
called RIDGE CHARACTERISTICS.
The different type of ridge
characteristics are :
•
•
•
•
•

Termination, or ending
Bifurcation, or fork
Enclosure, or lake
Independent ridge or island
Spur


Ridge counts
Since the arch and Tented arch patterns do not have the cardinal points (i.e. core
and delta), no ridge counts are possible for these two patterns.
Ridge counts are given for the loop, whorl and composite patterns. In
loops, the number of ridges intervening between the core and delta are to be

counted. In whorls, which occur in right hand fingers, the ridges intervening
between the core and left side delta are counted and whereas the whorls, which
occur in left hand fingers the ridges intervening between the core and right side
delta are counted
In twinned loops and lateral pocket loops there are two well defined loops called
ascending loop and descending loop. In these two patterns, the number of ridges
intervening between the core and delta of the ascending loop are to be counted.
Since the accidental patterns have more than two deltas, it is not considered for
ridge counts.

Pattern type
.

S.N
o

Pattern type

Subdivision

Symbo
l

1.

Arches

Plain Arches
Tented Arches

A
T

2.

Loops

Radical Loops
Ulnar Loops

R
U

3.

Whorls

4.

Composite

Numerical value

Pattern type

-

W

Twinned Loops
Lateral pocket loops
Accidentals

Numerical value

Arch

1

Tented Arch

2

Radial Loop

3

Ulnar Loop

4

Whorl

5

Twinned Loop

6

Lateral Pocket loop
Accidental

7
8

TL
LP
AC

Different types of genetic markers
• SCAR Sequence Characterized Amplified Region
• RFLPs Restriction Fragment Length Polymorphism
• AFLP Amplified Fragment length Polymorhisms

• RAPD-PCR Randomly amplified polymorphic PCR
• Direct In-situ Single Copy PCR (DISC-PCR)

• Microsatellite analysis

What are microsatellites ?
These are short sequence of nucleotides (such as GATA)
which are repeated over and over again a number of times
in tandem.
Also called as
1. SSR (Simple sequence repeat )
2. STR (Short tandem repeat)
3. VNTR (Variable number tandem repeat)


DNA: key
points
Double stranded

alphabet of DNA
Nucleotides;
2 nucleotides
= 1 base pair

Attraction between
base pairs: bonds
G with C; A with T.


Where are microsatellites found?

Microsatellites


Majority are in non-coding region

Homozygous
Homozygous twins
, CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG…
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG…
5’ flanking region

3’ flanking region

Dizygous twins

Heterozygous
CGTAGCCTTGCATCCTTCTCTCTCTCTCTCT
ATCGGTACTACGTGG…
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG

Excellent marker for DNA fingerprinting because:


Polymorphic (fast-evolving)



Single locus



Neutral (non-coding)



Relative ease of use



High levels of accuracy



Repeatable


DNA Fingerprinting (DNA typing/profiling)

•

•

No two individuals produced by sexually
reproducing organisms (except identical twins)
have exactly the same genotype.
Why?

– Crossing-over of chromosomes in
meiosis prophase I.
– Random alignment of maternal/paternal
chromosomes in meiosis metaphase I.

– Mutation
– DNA replication errors (same effect as
mutation)

Micro satellite analysis include the following steps,


DNA isolation from twin samples



Quantification of DNA. (Spectrophotometer)



Gel electrophoresis



Polymerized chain reaction (PCR) using 9 STR loci
PCR machine –Gene Amp 9700
PCR kit –AmpF/STR Profilier Plus kit



Gene scan analysis of PCR amplicons using automated
DNA sequencer ( ABI Prism 3700 )



Genotyping.


DNA Isolation

Vacuette –Disposable Syringe.

Thermopak box

Cold room
www.indiandentalacademy.com Autoclaving units

DNA isolation

Falcon tubes

After centrifuge-Pellet

Centrifuge

Reagent B

Centrifuge

Phenol and chloroform


Centrifuge

Aqueous , protein and solvent layers

Centrifuge

Eppendroff tubes

Isolated DNA

Spin


Drying

Optical density( O.D)
Optical density

Spectrophotometer


Gel electrophoresis

Gel tray

Elec weighing machine

Autoclave

DNA diluent with loading dye


Electrophoresis app

Before electrophoresis After electrophoresis

Transilluminating Equipment


Gel picture under UV light of transilluminator

Locus, repeat motif,size range and dye label of AmpFlSTR Profiler Plus kit

PCR kit used – AmpFlSTR Profilier Plus kit

Locus

Region

D3S1358

3p

vWA

Common Sequence motif

Size
range(bp)a

Dyelabel

TCTA(TCTG)1-3(TCTA)n

114-142

5-FAM

12p

TCTA(TCTG)3-4 (TCTA)n

157-197

5-FAM

FGA

4q28

(TTTC)3TTTT TTCT

219-267

5-FAM

D8S1179b

8

(TCTA)n C

128-168

JOE

D21S11

21

189-243

JOE

D18S51

18q21

(AGAA)n

273-341

JOE

D5S818

5q21-31

(AGAT)n

135-171

NED

D13S317

13q22-31

(GATA)n

206-234

NED

D7S820

7q

(GATA)n

258-294

NED

(TCTA)n(TCTG)n(TCTA)3
A(TCTA)3TCA(TCTA)2TCCA TA
T(TCTA)n


Polymerized Chain Reaction ( PCR)
Steps

Conditions

Initial denaturation

95°c

28 cycles at

94°C

11 min
1 min

59°C

1 min

72°C

1 min

Final Extension

60°C

45 min

Hold at

25°C

Forever

Gene AMP 9700

PCR: Polymerase Chain Reaction

A 3 stage process that
is temperature dependent:

Step 1: with heat, the two
DNA stands separate

Step 2: with cooling,
primers bind to the DNA in
the desired location

Step 3: with more heat,
new nucleotides are added
at the ends of the primers
making 2 new DNA strands

PCR amplification:

Wow ! That’s a lot of copies


Taq Polymerase

Hot water bacteria:
Thermus aquaticus
Taq DNA polymerase

Gene Scan Analysis

Automated DNA Sequencer- ABI Prism 3700


Genotyping

ZYGOSITY DETERMINATION – GENE SCAN ANALYSIS REPORT FOR
MONOZYGOTIC TWIN PAIR

ZYGOSITY DETERMINATION – GENE SCAN ANALYSIS REPORT FOR
DIZYGOTIC TWIN PAIR

Arya et, al
26 pairs of monozygotic and 16 pairs of dizygotic like sexed twins cephalograms
were analyzed to find out the genetic variability of 6 mandibular dimensions and 3
craniofacial dimensions. The sample was tested as to whether an individual bone

showed any larger component of genetic variability than that shown by the
craniofacial complex. The genetic component was predominant in the variability of
all the dimensions measured except the dimensions left gonion-right gonion in
which the environmental component of the variability was predominant. Mandibular

dimensions showed a greater component of genetic variability than that showed
by the craniofacial dimensions. The length and width of the mandible appeared
to have a greater component of genetic variability than did the height dimensions
indicating that the height dimensions are more susceptible to environmental
influences


Robert S. Corruccini, Rosario Potter
conducted a study on the occlusal characteristics in 32 pairs of monozygotic

twins and 28 pairs of dizygotic twins using dental stone casts. Zygosity was
determined using serologic and dermatoglyphics criteria.
They studied arch shape, size, and symmetry, overjet. Overbite, posterior cross

bite, buccal segment relation, rotations and displacements.

They concluded that arch size variation, tooth displacement and cross bite
showed significant genetic variance. They also concluded an increased
environmental component of variance in occlusion.


Susanne C, Defrise – Gussenhoven E, Van Wanseele, Tassin A

Analyzed 17 head and face measurements of 205 twin pairs, aged 18 to 25
years.
They found significant genetic variance for both sexes in face length, head
breadth, and frontal breath, for several breadth measurements of the face for
physio – face height, and nose height.

A significant genetic variance component is found for Nasion – Gnathion,
Nasion – stomion, and lip height in males, and for the two ear measurements in
females.
They suggested that the sex differences for heritability may be due to random
factors and to continued growth from 18 – 25 years in males


Sharma K. Corruccini RS, Henderson AM (1985)
studied 58 pairs of twins (23 MZ and 35DZ) from Chandigarh INDIA .
, Indian MZ twins had higher variance than did DZ in most instances.
There was also evidence of strong environmental covariance for MZ and DZ
twins.
The study revealed substantial, complex environmental determination for some
dental dimensions especially for incisors and second molars.


Lundstrom and McWilliams (1987)
conducted a study to compare horizontal and vertical cephalometric distances
with regard to heritability.

The material used consisted of 56 pairs of twins of the same sex ranging from
13-20 years of age.
Heritability (h2) and cultural inheritance (c2) were determined according to the
path analysis method and quotients between genetic and environmental
standard deviations were compared.
No systemic difference could be found between horizontal and vertical
measurements, but the highest heritability values were obtained among four
vertical variables.


Brown et al

studied the dentofacial characteristics of South Australian twins with an objective
to develop methods for the quantification and analysis or morphological
asymmetry in the facial structures using dental casts and stereo photographs of
the face.
They observed some interesting features of facial morphology, particularly
asymmetry in a pair of monozygotic twin pair.
There was close match between the face of a twin and the mirror image of his
brother than there was between the original faces.

Evidence of mirror imaging was also present in the maxillary dentition, for
example in the position of the central incisors and eruption sequence of the third
molars


Lundstrom and Mc William

Compared some vertical and horizontal cephalometric size variables as regard to
heritability in twins, the sample consisted of 28 pairs of monozygotic and 27 pairs
of dizygotic twins.

The highest heritability coefficients were found for facial height to facial depth
and for upper to lower sella-apical base distances, while the lowest was for
upper to lower sella incisal edge distances


Burke studied facial morphology in twins.
Facial morphology has been important in twin studies and two dimensional
photography was generally used to record the face.
A technique of three dimensional photogrametry was described, which has
been used to examine intrapair differences in facial parameters in 18 pairs of
twins.
Zygosity was first determined by using serological tests, standing height,
finger, print ridge count, tooth size, hair and eye color.
Stereoscopy was then used to measure 13 facial parameters and compare
intrapair differences in facial parameters size in monozygotic and dizygotic
twins.
The results when compared with other tests showed that stereoscopic vision
recorded similar faces in monozygotic and dissimilar faces in dizygotic twins
and had a real basis which could be measured dimensionally

Sorin M.S, Ramsey TC, Hart TC, and Farrington FH

Digitized lateral cephalograms of 33 families of monozygotic twins and their
siblings.
Eight skeletal parameters were measured: FA to SN, SNA, SNB, ANB, angle of
convexity, mandibular plane to SN angle, Y- axis and pogonion to NB distance.
MZ twin pairs and their siblings showed a normal distribution pattern for all the
skeletal parameters, except the pogonion to NB distance measurement.
There was found to be statistically significant correlation between age and facial
angle and ANB.A familial aggregation effect was found for SNA, ANB, and angle
of convexity.
Some genetic influence was found for FA, mandibular plane angle and Y- axis,
while the Pg to NB distance showed neither genetic influence, nor a familial
aggregation.


Vanco C. Sergi.R, KasaiK, Richards L.C, Townsend G.C: et al
selected lateral photographs of 23 male and 19 female monozygous (MZ), and 15
male and 22 female dizygous (DZ) twin pairs from the records of the South
Australian Twin study to investigate the role of genetic influence on variation in
facial profile.
Soft tissue landmarks and facial profiles were identified traced and digitized.
Linear and angular measures defined by the landmarks were calculated and a
series of Fourier functions derived to describe the facial profiles..
Correlations within monozygotic pairs were consistently higher than within
dizygotic pairs for both the facial dimensions and the Fourier amplitudes, providing
evidence of significant genetic contribution to facial convexity, facial height and
facial depth.
Variability in nose and lip morphology appeared to be under stronger
environmental influence.


Claudio.M, Martina.R, G.B.Grossi
heritability of 39 lateral cephalometric variables were estimated by statistical
method of path analysis and Dahlberg quotient in 10 pairs of monozygotic twins,
10pairs of dizygotic same sex twins and 10 pairs of same sex singletons.
They found that many of the 39 cephalometric variables evaluated were under
strong genetic control, especially the vertical ones, among which, heritability
seems to be expressed more anteriorly than posteriorly.
Mandibular shape seemed to be more genetically determined than mandibular
size.
All five cephalometric typological Ricketts parameters as well as the linear
horizontal McNamara’s measurement and lower incisor to A-Pg line confirm a
very high heritability.
A peculiar triangular area on the lateral view of the face and delimited by Na,
geometric Go, and geometric Gn points (the so called triangle of face similarity)
showed high heritability coefficients.

The lower third of the face showed a strong genetic control

Savoye, Loose, Carels Deron

evaluated the genetic and environmental contribution to facial proportions and
compared them with earlier genetics analysis of the different facial
components using model fitting and path analysis.
They found high genetic influence for vertical proportions. The lowest
heritability values were found for Sella – Upper incisal edge to Sella – lower
incisal edge.
The lower genetic determination of the facial proportions compared with their
components indicated that the indices are subjected to more complex
interactions between gene and environment


Liu H, Deng H, Cao CF, Ono H.
Studied systematically the heritability of dental traits in 82 pairs of female –
female twins from 6 – 12 years.
Zygosity diagnosis was made by DNA fingerprinting.

The study was composed of questionnaires, oral examination, model
measurements, and panoramic radiographs.
The same analytic method was used for each of the dental traits and
comparison of their heritability was made.

The levels of heritability of the dental traits were divided into 4 types; strong,
median, weak, and weaker heritability.
The number of third molars present, tooth size, arch size, and upper lateral
incisor malformation were under strong genetic influence; hypodontia indicated a
median heritability ; a weak heritability was seen in tooth eruption and caries
,and a weaker heritability was found in occlusal traits.

Mossey. P.A. (1999)
reviewed various studies regarding heritability of malocclusion and concluded
that there is considerable evidence suggesting a significant role of genes in the
etiology of many dental anomalies.
Furthermore, a frequency of association of one or more of these dental
anomalies coincidentally in the same pedigree suggests some kind of genetically
controlled inter relationship.
The clinical significance of the inheritance of certain dental anomalies is that the
clinicians should be vigilant in the expectation that the clinical or radiographic
detection of one anomaly should alert them to the possibility of other defects in
the same individual or other family members.
Early diagnosis would enable interceptive pediatric and orthodontic opportunities
in relation to ectopic, missing, or malformed teeth.


Conclusion
• A full knowledge of interplay between
environmental and genetic patterns
involved in the development of craniofacial
features will enable the future practitioners
to effectively guide growth with orthodontic
therapy.


T
h
a
n
k
U


Singh GD, Kutcipal E, Mc Namara JA.
Investigated the craniofacial morphology in twins with cleft lip and/or palate
.and localize differences, compared with noncleft (NC) twins.
They studied poster anterior cephalographs of 32 pairs of DZ, concordant, like
–sexed twins.
The NC group consisted of 20 pairs on noncleft twins. The cleft twin (CT)
group consisted of 12 pairs of concordant twins. Main outcome measures
included changes in linear distances, differences in form difference matrices,
and visualization of deformations of thin-plate spline (TPS) transformation
grids.
They concluded that twins with orofacial clefts differed from their unaffected
counterparts by a midfacial skeletal morphology characterized by decrease in
interorbital and intranasal widths and relatively shorter maxillary base heights
and widths.


Identical Twins:
When one egg is fertilized by one sperm cell, and then divides and separates,
two identical cells will result. These cells will then develop into identical twins.
The DNA profiles for identical twins will be identical. Additionally, the physical
attributes of identical twins will seem similar for traits such as hair color, hair
texture, eye color, height, and weight.
They must also be of the same sex.
Fraternal Twins (Non identical twins):

When two eggs are independently fertilized by two different sperm cells,
fraternal twins result. The DNA profiles for fraternal twins will not be identical,
and they are just like full-siblings that are born at different times. Further more, if
the two sperm cells originated from 2 different men then the twins or would be
like 2 half-siblings. Additionally, the physical attributes of fraternal twins may not
seem similar for traits such as hair color, hair texture, eye color, height, and
weight. They also may not be of
the same sex

Twin studies seminar1 /certified fixed orthodontic courses by Indian dental academy

Empfohlen

Empfohlen

Weitere ähnliche Inhalte

Was ist angesagt?

Was ist angesagt? (20)

Ähnlich wie Twin studies seminar1 /certified fixed orthodontic courses by Indian dental academy

Ähnlich wie Twin studies seminar1 /certified fixed orthodontic courses by Indian dental academy (19)

Mehr von Indian dental academy

Mehr von Indian dental academy (20)

Twin studies seminar1 /certified fixed orthodontic courses by Indian dental academy