SlideShare a Scribd company logo
1 of 31
Integrated DNA Technologies
Mark Behlke MD, PhD Chief Scientific Officer
Ootemachi First Square Conference July 30, 2013
MBL/IDT Next Gen Sequencing Symposium
Improved Reagents & Methods for Target
Enrichment in Next Generation Sequencing
General NGS Workflow
2
DNA DNA Shearing
Adaptor and
Barcode [opt]
Attachment
Enrichment [optional]
Template/Library Preparation
Sequencing Analysis
Why enrich?
Detecting rare variants requires enrichment + cost/time savings
3
1. Achieve many times greater coverage than with whole genome sequencing
2. Multiplex many samples on 1 lane
Less cost per sample
Many samples analyzed in a single run
Enrichment Methods
4
 Hybrid Capture  Amplicon
PCR
Micro droplet PCR
Haloplex™
AmpliSeq™ Panels
TruSeq™ Custom Amplicon
Comparing enrichment methods
5
Hybrid Capture Amplicon Enrichment
Workflow
More complex
Slower (1-2 days)
New fast protocol …
Less complex
Fast (< 1 day)
Cost
Higher upfront cost
Lower cost per sample
Lower upfront cost
Higher cost per sample
Problems Sequence / GC content bias
Amplicon failures
SNPs in primer sites
Input DNA needed Med to High Low
Capture size 5 KB to Whole Exome
5 KB to 1 MB
New whole exome
available
Applications
Variant analysis
Gene expression / CNV
Splice variants
Translocations
Variant analysis
Two different approaches to capture probes
6
• Agilent or NimbleGen whole exome kits
• Low quality, low yield oligo probes made on microarray chips
• Advantage = cheap to make a million probes (capture >50 Mb)
• Perfect way to make whole exome sets
• Disadvantage = low quality probes, cannot QC, no idea about individual
probe concentration
• Variable capture efficiency between target loci, big “GC” bias effect
• Difficult, slow and costly to change content
• IDT xGenTM LockdownTM Probes
• High quality, high yield oligos made individually
• Advantage = QC each oligo, measure and normalize yield prior to pooling
• Improved capture efficiency between many loci
• Disadvantage = higher price per probe (but high yield)
• Use for small focused sets or to spike into whole exome sets
• Easy to change content  just make another oligo and add to pool!
• High yield makes it cheaper when running lots of samples
IDT UltramerTM synthesis: the key to xGenTM LockdownTM probes
7
• Ultramers = ultra long oligos made on a specialized synthesis platform with
custom supports and its own synthesis cycle
• Highest possible coupling efficiency = long oligos can be made that
otherwise could not be made. For 120mers, no need to purify!
• 60-200mers sold to customers (size limit is set by our ability to perform ESI
MS QC); within IDT, we use 60-300mers in our gene synthesis group
UltramersTM can be made with high GC content (unlike arrays)
8
Calc. mass 37786.3 Da
Measured 37789.6 Da
BioGCGGCGAGCGGAGATCCGGGGCCTGCGCTGCGCACTCGAGCCTGGCGGGCCGGCACGGTGCGGGCC
ATGAGCGGGGCGGTGCCCCAGGACCTAGCGGTGAGTGGCGGCCGAGTCGGGCAC
ESI-MS trace of an
xGENTM LockdownTM probe
with 78% GC content
Two ways to use xGenTM LockdownTM Probes
9
1. Make your own small focused sets with 5-2000 KB coverage
2. Spike into whole exome array oligo sets to improve performance of
products you may already be using
1. NimbleGen
2. Agilent
Improve Agilent SureSelectTM – example from Foundation Medicine
10
• Custom Agilent SureSelectTM 1.1 Mbp capture array for Foundation Medicine
• Prototype in development for oncology medical re-sequencing panel
• Problems seen with getting complete coverage of desired exons
• Spike in 1100 IDT xGenTM LockdownTM probes (5’-biotin, 120mers)
• 135 Kbp coverage, duplicates what should already be in tiled array
• Sequence on Illumina HiSeq2000 platform
Foundation Medicine
Boston, Massachusetts
Improve performance of whole exome capture kits (spike-in)
11
Foundation Medicine
Boston, Massachusetts
Before supplementation with
xGenTM LockdownTM probes
After supplementation with
xGenTM LockdownTM Probes
Replace SureSelectTM with custom xGenTM LockdownTM Probe Library
12
Foundation Medicine
Boston, Massachusetts
Results from Foundation Medicine comparing results of a large set of
IDT xGenTM LockdownTM probes with a focused Agilent SureSelectTM set.
IDT xGEN: 100% >150x coverage
Agilent: 80.7% >150x coverage
# Reads
IDT
Agilent
xGenTM LockdownTM Probes show less GC bias
13
Foundation Medicine
Boston, Massachusetts
IDT
Agilent
Design of capture probes
14
xGenTM LockdownTM probes are high quality UltramerTM synthesis. Each oligo gets
mass spec QC and is OD260 measured with quantity normalized.
SureSelectTM and other low quality array oligos need large overlaps. You cannot QC
each oligo so you need to have high overlap to help ensure coverage.
Do mutations in target hurt capture efficiency?
15
• Short oligos can distinguish a single SNP site based on hybridization.
Since the goal is to capture variants and detect these by sequencing, do
we risk missing SNPs due to hybridization failure?
• Long 120mers, however, are very tolerant to mismatch
• How tolerant?
• Studied Tm of hybridization of a single 120mer bait oligo to different
targets having 0-7 bases mismatch (either permissive G:T pairing or
more disruptive T:T pairings)
• Also studied targets with 1, 3, or 7 base insertions (indels)
Design of 120mer Tm experiment
16
DTm with 1-7 base mismatches (SNPs)
17
Mismatches
Tm oC
Measured
DTm oC
Mismatch
Tm oC
Predicted
0 85.7 -- 87.6
1 T-T 85.6 - 0.1 87.1
1 T-T 85.0 - 0.7 86.9
3 T-T 84.2 - 1.5 85.7
7 T-T 80.9 - 4.8 82.9
7 T-G 81.6 - 4.1 85.8
DTm with 1, 3, or 7 base insertions (indels)
18
Bulge
Tm oC
Measured
DTm oC
Mismatch
None 85.7 --
1 T 85.3 - 0.4
3 T 84.8 - 0.9
7 T 83.9 - 1.8
7 T + 7 T 82.3 - 3.4
7 C + 7 C 82.4 - 3.3
Conclusions from Tm studies
19
• 1-7 base mismatches had < 5oC DTm
• 1 or 2 1-7 base insertions had < 4oC DTm
• These small changes in Tm should not affect capture
• Thus use of 120mer capture probes is sufficient and should
be effective in capturing targets even when a significant level
of polymorphism is present
Blocking oligos – another critical component of enrichment/capture
20
Two classes of blocking
oligos are needed:
1) Cot1 DNA = Alu, LINE
repeat elements
2) linkers/adaptors
Importance of using Human Cot1 blocking DNA
21
Example: Merkel Cell Polyomavirus study:
Capture hyb with 1 ug Cot1 DNA
Total Reads 7,603,264
Capture specific 520,304
Match to virus 6.8%
Capture hyb without Cot1 DNA
Total Reads 2,313,487
Capture specific 57,967
Match to virus 2.5%
New product: xGen® Blocking Oligos
22
Two classes of blocking
oligos are needed:
1) Cot1 DNA = Alu, Line
repeat elements
2) linkers/adaptors
A new generation of
blockers to improve this
step in the enrichment
process
New xGen® Blocking Oligos
23
In early experiment, simple DNA blockers proved to be effective. By adding excess
blocker, ‘mass action’ drives hybridization in favor of the blocker-adaptor instead
of the undesired blocker-blocker pairing.
However, in most experiments done today, either one or both adaptors contains
an “index” or “bar code” sequence of 6-8 bases. Highly multiplexed experiments
now have mismatched blockers binding to adaptors, and on-target capture rates
dropped.
IDT offers a new solution to this problem: xGen® Blocking Oligos .
The new generation of blockers incorporates Inosine bases to pair with index
domains, so a single blocker can be used with all index variants. Further, the new
blockers have additional improvements which increase effectiveness and give
higher on-target capture rates.
Example of Inosine incorporation in one specific adaptor
24
TruSeq P7 Index 6 x I (also have 8 x I)
CAAGCAGAAGACGGCATACGAGAT(IIIIII)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTx
TruSeq P5
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTx
Note: Inosine is not a universal pairing base, as indicated by the decreasing stability
(I·C > I·A > I·T ≈ I· G > I·I), it is most stable in a G-C base pair.
However it does offer advantages over a N degenerate base, especially with longer indices.
Norman E. Watkins, Jr and John SantaLucia, Jr
Nucleic Acids Res. 2005; 33(19): 6258–6267
In addition to Inosine, the blockers have proprietary changes made which improve performance.
Performance of xGen® Blocking Oligos with an 11,000 probe capture set
25
The IDT xGen LockdownTM Cancer Panel bait set (264 genes, 11,738 probes, 1.2 Mbp
coverage) was used to enrich 4 independent libraries with unique index adaptors. The
libraries were mixed and capture was performed in a multiplex hybridization reaction
with standard 48 hour hybridization.
Improved depth of coverage using xGen® Blocking Oligos
26
The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent
libraries with unique index adaptors. The libraries were mixed and capture was
performed in a multiplex hybridization reaction with standard 48 hour hybridization.
New rapid 4 hour hybridization/capture reaction
27
The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4
independent libraries with unique index adaptors. The libraries were
mixed and capture was performed in a multiplex hybridization reaction
using new buffers and protocols with only a 4 hour hybridization step.
Benefits of the new blockers: Foundation Medicine
28
Standard blockers and new IDT xGen® Blocking Oligos were compared in
an exon capture experiment using a focused set covering ~2Mb
StandardStandard Blockers xGen® Blocking Oligos
Foundation Medicine
Boston, Massachusetts
Benefits of the new blockers: Washington University
29
Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon
capture experiment using a NimbleGen whole exome array (44Mb)
The Genome Institute, Washington University
St. Louis, Missouri, USA
UnMod #1 Mod #2 Mod #3 Mod #4UnmodStandard
Blockers
xGen® Blocking Oligos
Thanks to all the scientists who contributed to these studies!
30
Foundation Medicine
Mirna Jarosz
Zac Zwirko
Michele Nahas
The Genome Institute
Washington University
Elaine Mardis
Bob Fulton
Vince Magrini
Ryan Demeter
Integrated DNA Technologies
Scott Rose
Ashley Dvorak
Katie Popp
Bailey Clark
Stephen Groenewold
Richard Owczarzy
LockdownTM Probe Technology Development Group
31
Ashley DvorakBailey Clark Katie Popp

More Related Content

What's hot

Next generation sequencing
Next  generation  sequencingNext  generation  sequencing
Next generation sequencingNidhi Singh
 
RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities Paolo Dametto
 
Next Generation Sequencing of DNA
Next Generation Sequencing of DNANext Generation Sequencing of DNA
Next Generation Sequencing of DNAmaryamshah13
 
Analysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNAAnalysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNAQIAGEN
 
Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014LutzFr
 
Next Generation Sequencing - the basics
Next Generation Sequencing - the basicsNext Generation Sequencing - the basics
Next Generation Sequencing - the basicsUSD Bioinformatics
 
Rna seq and chip seq
Rna seq and chip seqRna seq and chip seq
Rna seq and chip seqJyoti Singh
 
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...QIAGEN
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewDominic Suciu
 
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGNEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGBilal Nizami
 
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesIntroduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesQIAGEN
 
Microarray technology and applications
Microarray technology and applicationsMicroarray technology and applications
Microarray technology and applicationsPurnima Kartha
 
Illumina infinium sequencing
Illumina infinium sequencingIllumina infinium sequencing
Illumina infinium sequencingAyush Jain
 
Third Generation Sequencing
Third Generation Sequencing Third Generation Sequencing
Third Generation Sequencing priyanka raviraj
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingArindam Ghosh
 
next generation sequencing
next generation sequencingnext generation sequencing
next generation sequencingPeter Egorov
 

What's hot (20)

Next generation sequencing
Next  generation  sequencingNext  generation  sequencing
Next generation sequencing
 
RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities
 
Next Generation Sequencing of DNA
Next Generation Sequencing of DNANext Generation Sequencing of DNA
Next Generation Sequencing of DNA
 
Analysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNAAnalysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNA
 
Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014
 
Next Generation Sequencing - the basics
Next Generation Sequencing - the basicsNext Generation Sequencing - the basics
Next Generation Sequencing - the basics
 
Rna seq and chip seq
Rna seq and chip seqRna seq and chip seq
Rna seq and chip seq
 
Clinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation SequencingClinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation Sequencing
 
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
 
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGNEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology Overview
 
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGNEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING
 
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesIntroduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
 
Microarray technology and applications
Microarray technology and applicationsMicroarray technology and applications
Microarray technology and applications
 
Illumina infinium sequencing
Illumina infinium sequencingIllumina infinium sequencing
Illumina infinium sequencing
 
Third Generation Sequencing
Third Generation Sequencing Third Generation Sequencing
Third Generation Sequencing
 
basic concept of molecular pathology
basic concept of molecular pathologybasic concept of molecular pathology
basic concept of molecular pathology
 
Ion torrent
Ion torrentIon torrent
Ion torrent
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
next generation sequencing
next generation sequencingnext generation sequencing
next generation sequencing
 

Viewers also liked

Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...Integrated DNA Technologies
 
Expanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGSExpanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGSIntegrated DNA Technologies
 
DIYgenomics: an open platform for citizen science
DIYgenomics: an open platform for citizen scienceDIYgenomics: an open platform for citizen science
DIYgenomics: an open platform for citizen scienceMelanie Swan
 
Getting into genes slideshare copy
Getting into genes slideshare copyGetting into genes slideshare copy
Getting into genes slideshare copyTanya Wood
 
Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...
Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...
Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...Thermo Fisher Scientific
 
Development and verification of an Ion AmpliSeq TP53 Panel
Development and verification of an Ion AmpliSeq TP53 PanelDevelopment and verification of an Ion AmpliSeq TP53 Panel
Development and verification of an Ion AmpliSeq TP53 PanelThermo Fisher Scientific
 
Fully automated Ion AmpliSeq™ library preparation using the Ion Chef System
Fully automated Ion AmpliSeq™ library preparation using the Ion Chef SystemFully automated Ion AmpliSeq™ library preparation using the Ion Chef System
Fully automated Ion AmpliSeq™ library preparation using the Ion Chef SystemThermo Fisher Scientific
 
Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...
Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...
Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...Integrated DNA Technologies
 
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...QIAGEN
 
Advances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyAdvances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyQIAGEN
 
Custom Enrichment Panels for Targeted Next Generation Sequencing
Custom Enrichment Panels for Targeted Next Generation SequencingCustom Enrichment Panels for Targeted Next Generation Sequencing
Custom Enrichment Panels for Targeted Next Generation SequencingIntegrated DNA Technologies
 
Custom, Affordable Gene Panels with Superior Coverage and Uniformity
Custom, Affordable Gene Panels with Superior Coverage and UniformityCustom, Affordable Gene Panels with Superior Coverage and Uniformity
Custom, Affordable Gene Panels with Superior Coverage and UniformityIntegrated DNA Technologies
 
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10Thermo Fisher Scientific
 
Accurate detection of low frequency genetic variants using novel, molecular t...
Accurate detection of low frequency genetic variants using novel, molecular t...Accurate detection of low frequency genetic variants using novel, molecular t...
Accurate detection of low frequency genetic variants using novel, molecular t...Integrated DNA Technologies
 
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...Integrated DNA Technologies
 
Cpf1-based genome editing using ribonucleoprotein complexes
Cpf1-based genome editing using ribonucleoprotein complexesCpf1-based genome editing using ribonucleoprotein complexes
Cpf1-based genome editing using ribonucleoprotein complexesIntegrated DNA Technologies
 
DNA Sequencing : Maxam Gilbert and Sanger Sequencing
DNA Sequencing : Maxam Gilbert and Sanger SequencingDNA Sequencing : Maxam Gilbert and Sanger Sequencing
DNA Sequencing : Maxam Gilbert and Sanger SequencingVeerendra Nagoria
 
Dna sequencing powerpoint
Dna sequencing powerpointDna sequencing powerpoint
Dna sequencing powerpoint14cummke
 

Viewers also liked (20)

xGen® Lockdown® Probes
xGen® Lockdown® ProbesxGen® Lockdown® Probes
xGen® Lockdown® Probes
 
Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...
 
Expanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGSExpanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGS
 
DIYgenomics: an open platform for citizen science
DIYgenomics: an open platform for citizen scienceDIYgenomics: an open platform for citizen science
DIYgenomics: an open platform for citizen science
 
Getting into genes slideshare copy
Getting into genes slideshare copyGetting into genes slideshare copy
Getting into genes slideshare copy
 
Biotech autumn2012-02-ngs2
Biotech autumn2012-02-ngs2Biotech autumn2012-02-ngs2
Biotech autumn2012-02-ngs2
 
Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...
Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...
Assessment of TP53 Mutation Status in Breast Tumor Tissue using the "Ion Ampl...
 
Development and verification of an Ion AmpliSeq TP53 Panel
Development and verification of an Ion AmpliSeq TP53 PanelDevelopment and verification of an Ion AmpliSeq TP53 Panel
Development and verification of an Ion AmpliSeq TP53 Panel
 
Fully automated Ion AmpliSeq™ library preparation using the Ion Chef System
Fully automated Ion AmpliSeq™ library preparation using the Ion Chef SystemFully automated Ion AmpliSeq™ library preparation using the Ion Chef System
Fully automated Ion AmpliSeq™ library preparation using the Ion Chef System
 
Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...
Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...
Oligonucleotides for Next Generation Sequencing Research and Clinical Diagnos...
 
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
 
Advances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyAdvances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell Technology
 
Custom Enrichment Panels for Targeted Next Generation Sequencing
Custom Enrichment Panels for Targeted Next Generation SequencingCustom Enrichment Panels for Targeted Next Generation Sequencing
Custom Enrichment Panels for Targeted Next Generation Sequencing
 
Custom, Affordable Gene Panels with Superior Coverage and Uniformity
Custom, Affordable Gene Panels with Superior Coverage and UniformityCustom, Affordable Gene Panels with Superior Coverage and Uniformity
Custom, Affordable Gene Panels with Superior Coverage and Uniformity
 
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10
 
Accurate detection of low frequency genetic variants using novel, molecular t...
Accurate detection of low frequency genetic variants using novel, molecular t...Accurate detection of low frequency genetic variants using novel, molecular t...
Accurate detection of low frequency genetic variants using novel, molecular t...
 
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
 
Cpf1-based genome editing using ribonucleoprotein complexes
Cpf1-based genome editing using ribonucleoprotein complexesCpf1-based genome editing using ribonucleoprotein complexes
Cpf1-based genome editing using ribonucleoprotein complexes
 
DNA Sequencing : Maxam Gilbert and Sanger Sequencing
DNA Sequencing : Maxam Gilbert and Sanger SequencingDNA Sequencing : Maxam Gilbert and Sanger Sequencing
DNA Sequencing : Maxam Gilbert and Sanger Sequencing
 
Dna sequencing powerpoint
Dna sequencing powerpointDna sequencing powerpoint
Dna sequencing powerpoint
 

Similar to Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing

Improving exome sequencing, targeted sequencing, and low frequency variant de...
Improving exome sequencing, targeted sequencing, and low frequency variant de...Improving exome sequencing, targeted sequencing, and low frequency variant de...
Improving exome sequencing, targeted sequencing, and low frequency variant de...Laura Berry
 
Barcode Data Standards
Barcode Data Standards Barcode Data Standards
Barcode Data Standards Leigh Peele
 
Gene disc® rapid microbiology system
Gene disc® rapid microbiology systemGene disc® rapid microbiology system
Gene disc® rapid microbiology systemdanisandominguez
 
Fruitbreedomics workshop wp6 dna extraction methods
Fruitbreedomics workshop wp6 dna extraction methodsFruitbreedomics workshop wp6 dna extraction methods
Fruitbreedomics workshop wp6 dna extraction methodsfruitbreedomics
 
Innovative NGS Library Construction Technology
Innovative NGS Library Construction TechnologyInnovative NGS Library Construction Technology
Innovative NGS Library Construction TechnologyQIAGEN
 
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...QIAGEN
 
I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...
I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...
I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...JDIngram
 
Apac distributor training series 3 swift product for cancer study
Apac distributor training series 3  swift product for cancer studyApac distributor training series 3  swift product for cancer study
Apac distributor training series 3 swift product for cancer studySwift Biosciences
 
Whole Genome Amplification from Single Cell
Whole Genome Amplification from Single CellWhole Genome Amplification from Single Cell
Whole Genome Amplification from Single CellQIAGEN
 
Bobs Aptamer Assay Slide Presentation_R
Bobs Aptamer Assay Slide Presentation_RBobs Aptamer Assay Slide Presentation_R
Bobs Aptamer Assay Slide Presentation_RRobert Bruce
 
DNASeq and basis structure of Dna and its function
DNASeq and basis structure of Dna and its functionDNASeq and basis structure of Dna and its function
DNASeq and basis structure of Dna and its functionSubhadipGhosh96
 
Types of PCR ((APEH Daniel O.))
Types of  PCR ((APEH Daniel O.))Types of  PCR ((APEH Daniel O.))
Types of PCR ((APEH Daniel O.))Daniel Apeh
 

Similar to Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing (20)

Improving exome sequencing, targeted sequencing, and low frequency variant de...
Improving exome sequencing, targeted sequencing, and low frequency variant de...Improving exome sequencing, targeted sequencing, and low frequency variant de...
Improving exome sequencing, targeted sequencing, and low frequency variant de...
 
Barcode Data Standards
Barcode Data Standards Barcode Data Standards
Barcode Data Standards
 
Gene disc® rapid microbiology system
Gene disc® rapid microbiology systemGene disc® rapid microbiology system
Gene disc® rapid microbiology system
 
SmartPanels
SmartPanelsSmartPanels
SmartPanels
 
Fruitbreedomics workshop wp6 dna extraction methods
Fruitbreedomics workshop wp6 dna extraction methodsFruitbreedomics workshop wp6 dna extraction methods
Fruitbreedomics workshop wp6 dna extraction methods
 
Innovative NGS Library Construction Technology
Innovative NGS Library Construction TechnologyInnovative NGS Library Construction Technology
Innovative NGS Library Construction Technology
 
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...
 
I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...
I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...
I. Henderson, J. Ingram, D. Poulcharidis - Advanced Topics in Chemical Biolog...
 
DNA Cloning
DNA CloningDNA Cloning
DNA Cloning
 
Apac distributor training series 3 swift product for cancer study
Apac distributor training series 3  swift product for cancer studyApac distributor training series 3  swift product for cancer study
Apac distributor training series 3 swift product for cancer study
 
Dna microarrays
Dna microarraysDna microarrays
Dna microarrays
 
Whole Genome Amplification from Single Cell
Whole Genome Amplification from Single CellWhole Genome Amplification from Single Cell
Whole Genome Amplification from Single Cell
 
Gene Xpert
Gene XpertGene Xpert
Gene Xpert
 
Highlight catalogue
Highlight catalogueHighlight catalogue
Highlight catalogue
 
Bobs Aptamer Assay Slide Presentation_R
Bobs Aptamer Assay Slide Presentation_RBobs Aptamer Assay Slide Presentation_R
Bobs Aptamer Assay Slide Presentation_R
 
DNASeq and basis structure of Dna and its function
DNASeq and basis structure of Dna and its functionDNASeq and basis structure of Dna and its function
DNASeq and basis structure of Dna and its function
 
PrimeTime® qPCR products for gene expression
PrimeTime® qPCR products for gene expressionPrimeTime® qPCR products for gene expression
PrimeTime® qPCR products for gene expression
 
Types of PCR ((APEH Daniel O.))
Types of  PCR ((APEH Daniel O.))Types of  PCR ((APEH Daniel O.))
Types of PCR ((APEH Daniel O.))
 
iMate Protocol Guide version 1.2
iMate Protocol Guide version 1.2iMate Protocol Guide version 1.2
iMate Protocol Guide version 1.2
 
iMate Protocol Guide version 3.0
iMate Protocol Guide version 3.0 iMate Protocol Guide version 3.0
iMate Protocol Guide version 3.0
 

More from Integrated DNA Technologies

Overcoming the challenges of designing efficient and specific CRISPR gRNAs
Overcoming the challenges of designing efficient and specific CRISPR gRNAsOvercoming the challenges of designing efficient and specific CRISPR gRNAs
Overcoming the challenges of designing efficient and specific CRISPR gRNAsIntegrated DNA Technologies
 
Best practices for data analysis when using UMI adapters to improve variant d...
Best practices for data analysis when using UMI adapters to improve variant d...Best practices for data analysis when using UMI adapters to improve variant d...
Best practices for data analysis when using UMI adapters to improve variant d...Integrated DNA Technologies
 
Increasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymesIncreasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymesIntegrated DNA Technologies
 
The quest for high confidence mutations in plasma: searching for a needle in ...
The quest for high confidence mutations in plasma: searching for a needle in ...The quest for high confidence mutations in plasma: searching for a needle in ...
The quest for high confidence mutations in plasma: searching for a needle in ...Integrated DNA Technologies
 
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...Integrated DNA Technologies
 
Optimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editingOptimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editingIntegrated DNA Technologies
 
Dual index adapters with UMIs resolve index hopping and increase sensitivity ...
Dual index adapters with UMIs resolve index hopping and increase sensitivity ...Dual index adapters with UMIs resolve index hopping and increase sensitivity ...
Dual index adapters with UMIs resolve index hopping and increase sensitivity ...Integrated DNA Technologies
 
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...Integrated DNA Technologies
 
Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...Integrated DNA Technologies
 
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotypingrhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotypingIntegrated DNA Technologies
 
Unique, dual-matched adapters mitigate index hopping between NGS samples
Unique, dual-matched adapters mitigate index hopping between NGS samplesUnique, dual-matched adapters mitigate index hopping between NGS samples
Unique, dual-matched adapters mitigate index hopping between NGS samplesIntegrated DNA Technologies
 
Analyzing the exome—focusing your NGS analysis with high performance target c...
Analyzing the exome—focusing your NGS analysis with high performance target c...Analyzing the exome—focusing your NGS analysis with high performance target c...
Analyzing the exome—focusing your NGS analysis with high performance target c...Integrated DNA Technologies
 
Getting started with CRISPR: a review of gene knockout and homology-directed ...
Getting started with CRISPR: a review of gene knockout and homology-directed ...Getting started with CRISPR: a review of gene knockout and homology-directed ...
Getting started with CRISPR: a review of gene knockout and homology-directed ...Integrated DNA Technologies
 
High efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDT
High efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDTHigh efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDT
High efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDTIntegrated DNA Technologies
 
Tips for effective use of BLAST and other NCBI tools
Tips for effective use of BLAST and other NCBI toolsTips for effective use of BLAST and other NCBI tools
Tips for effective use of BLAST and other NCBI toolsIntegrated DNA Technologies
 
Gene synthesis technology and applications update—unleash your lab’s potentia...
Gene synthesis technology and applications update—unleash your lab’s potentia...Gene synthesis technology and applications update—unleash your lab’s potentia...
Gene synthesis technology and applications update—unleash your lab’s potentia...Integrated DNA Technologies
 
Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...
Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...
Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...Integrated DNA Technologies
 
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...Integrated DNA Technologies
 
xGen® Lockdown® products for next generation sequencing
xGen® Lockdown® products for next generation sequencingxGen® Lockdown® products for next generation sequencing
xGen® Lockdown® products for next generation sequencingIntegrated DNA Technologies
 
New RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editingNew RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editingIntegrated DNA Technologies
 

More from Integrated DNA Technologies (20)

Overcoming the challenges of designing efficient and specific CRISPR gRNAs
Overcoming the challenges of designing efficient and specific CRISPR gRNAsOvercoming the challenges of designing efficient and specific CRISPR gRNAs
Overcoming the challenges of designing efficient and specific CRISPR gRNAs
 
Best practices for data analysis when using UMI adapters to improve variant d...
Best practices for data analysis when using UMI adapters to improve variant d...Best practices for data analysis when using UMI adapters to improve variant d...
Best practices for data analysis when using UMI adapters to improve variant d...
 
Increasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymesIncreasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymes
 
The quest for high confidence mutations in plasma: searching for a needle in ...
The quest for high confidence mutations in plasma: searching for a needle in ...The quest for high confidence mutations in plasma: searching for a needle in ...
The quest for high confidence mutations in plasma: searching for a needle in ...
 
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
 
Optimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editingOptimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editing
 
Dual index adapters with UMIs resolve index hopping and increase sensitivity ...
Dual index adapters with UMIs resolve index hopping and increase sensitivity ...Dual index adapters with UMIs resolve index hopping and increase sensitivity ...
Dual index adapters with UMIs resolve index hopping and increase sensitivity ...
 
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
 
Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...
 
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotypingrhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
 
Unique, dual-matched adapters mitigate index hopping between NGS samples
Unique, dual-matched adapters mitigate index hopping between NGS samplesUnique, dual-matched adapters mitigate index hopping between NGS samples
Unique, dual-matched adapters mitigate index hopping between NGS samples
 
Analyzing the exome—focusing your NGS analysis with high performance target c...
Analyzing the exome—focusing your NGS analysis with high performance target c...Analyzing the exome—focusing your NGS analysis with high performance target c...
Analyzing the exome—focusing your NGS analysis with high performance target c...
 
Getting started with CRISPR: a review of gene knockout and homology-directed ...
Getting started with CRISPR: a review of gene knockout and homology-directed ...Getting started with CRISPR: a review of gene knockout and homology-directed ...
Getting started with CRISPR: a review of gene knockout and homology-directed ...
 
High efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDT
High efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDTHigh efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDT
High efficiency qPCR with PrimeTime® Gene Expression Master Mix from IDT
 
Tips for effective use of BLAST and other NCBI tools
Tips for effective use of BLAST and other NCBI toolsTips for effective use of BLAST and other NCBI tools
Tips for effective use of BLAST and other NCBI tools
 
Gene synthesis technology and applications update—unleash your lab’s potentia...
Gene synthesis technology and applications update—unleash your lab’s potentia...Gene synthesis technology and applications update—unleash your lab’s potentia...
Gene synthesis technology and applications update—unleash your lab’s potentia...
 
Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...
Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...
Alt-R™ CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improv...
 
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
 
xGen® Lockdown® products for next generation sequencing
xGen® Lockdown® products for next generation sequencingxGen® Lockdown® products for next generation sequencing
xGen® Lockdown® products for next generation sequencing
 
New RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editingNew RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editing
 

Recently uploaded

Shazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdfShazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdfTrustlife
 
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...gragneelam30
 
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Angel
 
Intramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptxIntramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptxsaranpratha12
 
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...Sheetaleventcompany
 
Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...
Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...
Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...Sheetaleventcompany
 
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...Sheetaleventcompany
 
VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋mahima pandey
 
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan CytotecJual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotecjualobat34
 
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...Sheetaleventcompany
 
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service DehradunDehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service DehradunSheetaleventcompany
 
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...Oleg Kshivets
 
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...Sheetaleventcompany
 
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Sheetaleventcompany
 
Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service Available
Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service AvailableCall Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service Available
Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service AvailableJanvi Singh
 
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...
Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...Namrata Singh
 
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryJyoti singh
 
Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...
Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...
Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...Sheetaleventcompany
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...Sheetaleventcompany
 
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...Sheetaleventcompany
 

Recently uploaded (20)

Shazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdfShazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdf
 
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
 
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
 
Intramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptxIntramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptx
 
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
 
Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...
Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...
Gorgeous Call Girls Dehradun {8854095900} ❤️VVIP ROCKY Call Girls in Dehradun...
 
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
 
VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋
 
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan CytotecJual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
 
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
 
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service DehradunDehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
 
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
 
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
 
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
 
Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service Available
Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service AvailableCall Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service Available
Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service Available
 
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...
Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...
 
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
 
Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...
Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...
Premium Call Girls Dehradun {8854095900} ❤️VVIP ANJU Call Girls in Dehradun U...
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
 
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
 

Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing

  • 1. Integrated DNA Technologies Mark Behlke MD, PhD Chief Scientific Officer Ootemachi First Square Conference July 30, 2013 MBL/IDT Next Gen Sequencing Symposium Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing
  • 2. General NGS Workflow 2 DNA DNA Shearing Adaptor and Barcode [opt] Attachment Enrichment [optional] Template/Library Preparation Sequencing Analysis Why enrich?
  • 3. Detecting rare variants requires enrichment + cost/time savings 3 1. Achieve many times greater coverage than with whole genome sequencing 2. Multiplex many samples on 1 lane Less cost per sample Many samples analyzed in a single run
  • 4. Enrichment Methods 4  Hybrid Capture  Amplicon PCR Micro droplet PCR Haloplex™ AmpliSeq™ Panels TruSeq™ Custom Amplicon
  • 5. Comparing enrichment methods 5 Hybrid Capture Amplicon Enrichment Workflow More complex Slower (1-2 days) New fast protocol … Less complex Fast (< 1 day) Cost Higher upfront cost Lower cost per sample Lower upfront cost Higher cost per sample Problems Sequence / GC content bias Amplicon failures SNPs in primer sites Input DNA needed Med to High Low Capture size 5 KB to Whole Exome 5 KB to 1 MB New whole exome available Applications Variant analysis Gene expression / CNV Splice variants Translocations Variant analysis
  • 6. Two different approaches to capture probes 6 • Agilent or NimbleGen whole exome kits • Low quality, low yield oligo probes made on microarray chips • Advantage = cheap to make a million probes (capture >50 Mb) • Perfect way to make whole exome sets • Disadvantage = low quality probes, cannot QC, no idea about individual probe concentration • Variable capture efficiency between target loci, big “GC” bias effect • Difficult, slow and costly to change content • IDT xGenTM LockdownTM Probes • High quality, high yield oligos made individually • Advantage = QC each oligo, measure and normalize yield prior to pooling • Improved capture efficiency between many loci • Disadvantage = higher price per probe (but high yield) • Use for small focused sets or to spike into whole exome sets • Easy to change content  just make another oligo and add to pool! • High yield makes it cheaper when running lots of samples
  • 7. IDT UltramerTM synthesis: the key to xGenTM LockdownTM probes 7 • Ultramers = ultra long oligos made on a specialized synthesis platform with custom supports and its own synthesis cycle • Highest possible coupling efficiency = long oligos can be made that otherwise could not be made. For 120mers, no need to purify! • 60-200mers sold to customers (size limit is set by our ability to perform ESI MS QC); within IDT, we use 60-300mers in our gene synthesis group
  • 8. UltramersTM can be made with high GC content (unlike arrays) 8 Calc. mass 37786.3 Da Measured 37789.6 Da BioGCGGCGAGCGGAGATCCGGGGCCTGCGCTGCGCACTCGAGCCTGGCGGGCCGGCACGGTGCGGGCC ATGAGCGGGGCGGTGCCCCAGGACCTAGCGGTGAGTGGCGGCCGAGTCGGGCAC ESI-MS trace of an xGENTM LockdownTM probe with 78% GC content
  • 9. Two ways to use xGenTM LockdownTM Probes 9 1. Make your own small focused sets with 5-2000 KB coverage 2. Spike into whole exome array oligo sets to improve performance of products you may already be using 1. NimbleGen 2. Agilent
  • 10. Improve Agilent SureSelectTM – example from Foundation Medicine 10 • Custom Agilent SureSelectTM 1.1 Mbp capture array for Foundation Medicine • Prototype in development for oncology medical re-sequencing panel • Problems seen with getting complete coverage of desired exons • Spike in 1100 IDT xGenTM LockdownTM probes (5’-biotin, 120mers) • 135 Kbp coverage, duplicates what should already be in tiled array • Sequence on Illumina HiSeq2000 platform Foundation Medicine Boston, Massachusetts
  • 11. Improve performance of whole exome capture kits (spike-in) 11 Foundation Medicine Boston, Massachusetts Before supplementation with xGenTM LockdownTM probes After supplementation with xGenTM LockdownTM Probes
  • 12. Replace SureSelectTM with custom xGenTM LockdownTM Probe Library 12 Foundation Medicine Boston, Massachusetts Results from Foundation Medicine comparing results of a large set of IDT xGenTM LockdownTM probes with a focused Agilent SureSelectTM set. IDT xGEN: 100% >150x coverage Agilent: 80.7% >150x coverage # Reads IDT Agilent
  • 13. xGenTM LockdownTM Probes show less GC bias 13 Foundation Medicine Boston, Massachusetts IDT Agilent
  • 14. Design of capture probes 14 xGenTM LockdownTM probes are high quality UltramerTM synthesis. Each oligo gets mass spec QC and is OD260 measured with quantity normalized. SureSelectTM and other low quality array oligos need large overlaps. You cannot QC each oligo so you need to have high overlap to help ensure coverage.
  • 15. Do mutations in target hurt capture efficiency? 15 • Short oligos can distinguish a single SNP site based on hybridization. Since the goal is to capture variants and detect these by sequencing, do we risk missing SNPs due to hybridization failure? • Long 120mers, however, are very tolerant to mismatch • How tolerant? • Studied Tm of hybridization of a single 120mer bait oligo to different targets having 0-7 bases mismatch (either permissive G:T pairing or more disruptive T:T pairings) • Also studied targets with 1, 3, or 7 base insertions (indels)
  • 16. Design of 120mer Tm experiment 16
  • 17. DTm with 1-7 base mismatches (SNPs) 17 Mismatches Tm oC Measured DTm oC Mismatch Tm oC Predicted 0 85.7 -- 87.6 1 T-T 85.6 - 0.1 87.1 1 T-T 85.0 - 0.7 86.9 3 T-T 84.2 - 1.5 85.7 7 T-T 80.9 - 4.8 82.9 7 T-G 81.6 - 4.1 85.8
  • 18. DTm with 1, 3, or 7 base insertions (indels) 18 Bulge Tm oC Measured DTm oC Mismatch None 85.7 -- 1 T 85.3 - 0.4 3 T 84.8 - 0.9 7 T 83.9 - 1.8 7 T + 7 T 82.3 - 3.4 7 C + 7 C 82.4 - 3.3
  • 19. Conclusions from Tm studies 19 • 1-7 base mismatches had < 5oC DTm • 1 or 2 1-7 base insertions had < 4oC DTm • These small changes in Tm should not affect capture • Thus use of 120mer capture probes is sufficient and should be effective in capturing targets even when a significant level of polymorphism is present
  • 20. Blocking oligos – another critical component of enrichment/capture 20 Two classes of blocking oligos are needed: 1) Cot1 DNA = Alu, LINE repeat elements 2) linkers/adaptors
  • 21. Importance of using Human Cot1 blocking DNA 21 Example: Merkel Cell Polyomavirus study: Capture hyb with 1 ug Cot1 DNA Total Reads 7,603,264 Capture specific 520,304 Match to virus 6.8% Capture hyb without Cot1 DNA Total Reads 2,313,487 Capture specific 57,967 Match to virus 2.5%
  • 22. New product: xGen® Blocking Oligos 22 Two classes of blocking oligos are needed: 1) Cot1 DNA = Alu, Line repeat elements 2) linkers/adaptors A new generation of blockers to improve this step in the enrichment process
  • 23. New xGen® Blocking Oligos 23 In early experiment, simple DNA blockers proved to be effective. By adding excess blocker, ‘mass action’ drives hybridization in favor of the blocker-adaptor instead of the undesired blocker-blocker pairing. However, in most experiments done today, either one or both adaptors contains an “index” or “bar code” sequence of 6-8 bases. Highly multiplexed experiments now have mismatched blockers binding to adaptors, and on-target capture rates dropped. IDT offers a new solution to this problem: xGen® Blocking Oligos . The new generation of blockers incorporates Inosine bases to pair with index domains, so a single blocker can be used with all index variants. Further, the new blockers have additional improvements which increase effectiveness and give higher on-target capture rates.
  • 24. Example of Inosine incorporation in one specific adaptor 24 TruSeq P7 Index 6 x I (also have 8 x I) CAAGCAGAAGACGGCATACGAGAT(IIIIII)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTx TruSeq P5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTx Note: Inosine is not a universal pairing base, as indicated by the decreasing stability (I·C > I·A > I·T ≈ I· G > I·I), it is most stable in a G-C base pair. However it does offer advantages over a N degenerate base, especially with longer indices. Norman E. Watkins, Jr and John SantaLucia, Jr Nucleic Acids Res. 2005; 33(19): 6258–6267 In addition to Inosine, the blockers have proprietary changes made which improve performance.
  • 25. Performance of xGen® Blocking Oligos with an 11,000 probe capture set 25 The IDT xGen LockdownTM Cancer Panel bait set (264 genes, 11,738 probes, 1.2 Mbp coverage) was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was performed in a multiplex hybridization reaction with standard 48 hour hybridization.
  • 26. Improved depth of coverage using xGen® Blocking Oligos 26 The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was performed in a multiplex hybridization reaction with standard 48 hour hybridization.
  • 27. New rapid 4 hour hybridization/capture reaction 27 The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was performed in a multiplex hybridization reaction using new buffers and protocols with only a 4 hour hybridization step.
  • 28. Benefits of the new blockers: Foundation Medicine 28 Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon capture experiment using a focused set covering ~2Mb StandardStandard Blockers xGen® Blocking Oligos Foundation Medicine Boston, Massachusetts
  • 29. Benefits of the new blockers: Washington University 29 Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon capture experiment using a NimbleGen whole exome array (44Mb) The Genome Institute, Washington University St. Louis, Missouri, USA UnMod #1 Mod #2 Mod #3 Mod #4UnmodStandard Blockers xGen® Blocking Oligos
  • 30. Thanks to all the scientists who contributed to these studies! 30 Foundation Medicine Mirna Jarosz Zac Zwirko Michele Nahas The Genome Institute Washington University Elaine Mardis Bob Fulton Vince Magrini Ryan Demeter Integrated DNA Technologies Scott Rose Ashley Dvorak Katie Popp Bailey Clark Stephen Groenewold Richard Owczarzy
  • 31. LockdownTM Probe Technology Development Group 31 Ashley DvorakBailey Clark Katie Popp