Epidemiology of Pierce’s Disease in Texas Vineyards

1. Epidemiology of Pierce’s Disease in Texas Vineyards 2008 Pierce’s Disease Research Symposium Session 5: Crop Biology and Disease Epidemiology Dr. David N. Appel, Professor Dept. of Plant Pathology and Microbiology Texas A&M University College Station, TX December 17, 2008

4. “ Gulf Coast” Vineyard “ Hill Country” Vineyard

5. Disease Progress in Gulf Coast Vineyard Chambourcin, n = 1071 Survey maps Rating scale: 1 = healthy , 2 = incipient symptoms , 3 = advanced symptoms , 4 = advanced symptoms/deiback , 5 = dead . Logistic rate of disease increase ( r ) = 2.02 2001 2005 2006 2007

6. Gulf Coast Vineyard 12,342 vines 8 vine varieties Variety No. of Vines Year Planted Rootstock Chambourcin 1071 2001 own Shiraz (4) 1270 2001 101-14 Primitivo (4) 1270 2001 SO4 Primitivo (3) 1280 2000 101-14 Shiraz (3) 1280 2000 101-14 Ruby Cab 1152 2000 101-14 Blanc du Bois 1071 2001 own

7. Disease Progress – Gulf Coast Vineyard 2005 2007 P P S S M M Mb C Bdb Rc

8. Disease Progress in the Gulf Coast Vineyard

9. Disease Progress in Hill Country Vineyard Cabernet sauvignon Pinot grigio Cabernet sauvignon Charadonnay Merlot Cab franc Melbec

10. Disease Progress in the Hill Country Vineyard Year

11. Spatial Perspectives Ordinary Runs Analysis Variety Year Prop. Within Prop. Across Cab Sauv. 1 TXH 03 .105 .101 05 .210 .16 06 .316 .16 Merlot PAL 05 .40 0.0 06 .70 .023 Merlot TXH 05 .44 .127 06 .61 .222

12. HILL Country Vineyard Varietal responses Variety n r m r d Edge Effect? Rows With clusters Cab sauv 2 1627 0.79 0.56 Yes n/a Pinot grigio 3477 0.59 0.46 No n/a Merlot 1419 0.56 0.50 No Yes Chardonnay 3267 0.27 0.22 Yes n/a Cab franc 557 0.18 0.13 Yes n/a Cab sauv 1 1111 0.06 0.05 Yes Yes

13. Fates/Recovery Rates of Diseased Vines Majority of Chambourcin, even healthy, were dead after 2 years Small number vines with incipient symptoms rated healthy after 3 years No Chambourcin with advanced symptoms recovered after 2 years

14. Fates/Recovery Rates of Diseased Vines Majority of Shiraz healthy, After 2 years Large number vines with incipient symptoms rated healthy after 2 years One Shiraz vine with advanced symptoms recovered after 2 years

16. Health Ratings of Vines Sampled for Isolation Gulf Coast Vineyard (Six Blocks) Culture attempts = 101 Positive isolations = 66 (6 blocks only) Numbers of Positive Vines Numbers of Negative Vines Year Rating = 1 Rating = 2 Rating = 3 Rating = 4-6 Rating = 1 Rating = 2 Rating = 3 Rating = 4-6 2005 30 33 2 1 24 10 0 1 2006 13 24 21 8 26 5 3 1 2007 12 6 20 28 19 7 3 6

17. Strain Analysis at Gulf Coast Vineyard *C.P. TORRES, D.N. Appel, and L. Morano. 2008. Phytopathology (Abstr.). Multiplex PCR Assay used to differentiation subspecies of Almond strain I, Almond strain II, Pierce’s Disease strain, and Oleandar* Step 1. Step 2. Differentiation of Xylella fastidiosa subspecies piercei isolates into strain groups utilizing simple sequence repeat markers OSSR# 9 OSSR# 4 OSSR# 14 OSSR# 19 OSSR# 7 Multiplex PCR Assay Primers Primer Sequence (5'-3') XF1968-L GGAGGTTTACCGAAGACAGAT XF1968-R ATCCACAGTAAAACCACATGC XF 2542-L TTGATCGAGCTGATGATCG XF 2542-R CAGTACAGCCTGCTGGAGTTA ALM-1 CTGCAGAAATTGGAAACTTCAG ALM-2 GCCACACGTGATCTATGAA Hernandez-Martinez et al. 2006. Plant Dis. 90: 1382-1388 Simple Sequence Repeat Markers Primer Forward Sequence Reverse Sequence Type of repeat motif OSSR-9 TAGGAATCGTCTTCAAACTG TTACTATCGGCAGCAGAC (TTTCCGT)13 GSSR-4 GCGTTACTGGCGACAAAC GCTCGTTCCTGACCTGTG (ATCC)7 GSSR-7 ATCATGTCGTGTCGTTTC CAATAAAGCACCGAATTAGC (GGCAAC)24 GSSR-14 TTGATGTGCTTTTGCGGTAAG GACAGGTCCTCTCATTGCG (TCCCGTA)24 GSSR-19 GCCGATGCAGAACAAGAAC TCAACTTCGCCACACCTG (GAAAAACAAG)19 Lin et al. 2005. Applied and Environmental Microbiology 71(8): 4888-4892

20. Questions? Thanks to: Cruz Torres Tom Kurdyla Kelly Bryan TX PD Research Group