SlideShare ist ein Scribd-Unternehmen logo
1 von 31
Downloaden Sie, um offline zu lesen
miScript miRNA PCR Arrays

Genome-Wide & Pathway-Focused Analysis
With an Advanced qPCR Technology

Samuel J. Rulli, Jr.,Ph.D.
qPCR Applications Scientist
Samuel.Rulli@QIAGEN.com

Sample & Assay Technologies
miScript miRNA PCR Arrays

Genome-Wide & Pathway-Focused Analysis
With an Advanced qPCR Technology

Questions? Comments? or Suggestions?
Ask now or contact Technical Support

.

.

Telephone: 888-503-3187; Email: support@SABiosciences.com

.

Sample & Assay Technologies
Welcome to SABiosciences: Systems Biology
with a Pathway Focused Approach

•

SABiosciences is now a

Company

-3-

Sample & Assay Technologies
Topics to be Covered

Introduction to miRNA
miScript miRNA PCR Array Overview
 How It Works
 Portfolio
 Benefit

miScript miRNA PCR Array Applications
 Cancer
 Development & Differentiation
 Genome-Wide Discovery

-4-

Sample & Assay Technologies
What Is MicroRNA?

.

.

.

Endogenously expressed small functional RNAs (19-25 nt)
Regulate mRNA expression post-transcriptionally
 mRNA degradation, but also translation inhibition
Only partial sequence complementarity required
 One miRNA can potentially regulate hundreds of mRNAs
 One mRNA can be regulated by multiple miRNAs

Another layer of complexity for regulating gene expression

-5-

Sample & Assay Technologies
Canonical pathway of microRNA biogenesis
NUCLEUS

microRNA Gene

DNA

 Transcribed by RNA Polymerase II as
a long primary transcript (pri-miRNAs),
which may contain more than one miRNA.

POL II

Pri-miRNA
Drosha-DGCR8

 In the nucleus, Pri-miRNAs are processed
to hairpin-like pre-miRNAs by RNAse IIIlike enzyme Drosha

Pre-miRNA

CYTOPLASM

Exportin

 Pre-miRNAs are then exported to the
Cytosol by Exportin 5

Exportin

DICER-TRBP

mature miRNA
Ago

RISC Assembly

 These miRNAs are incorporated in RISC

RISC

High homology

mRNA cleavage

 In the cytosol RNAse III-like Dicer
processes these precursors to mature
miRNAs

Partial homology

Translational Repression
mRNA degradation

 miRNAs with high homology to the target
mRNA lead to mRNA cleavage
 miRNAs with imperfect base pairing to the
target mRNA lead to translational
repression and/or mRNA degradation

Krol, J et.al., (2010) Nature Rev Genetics, 11, 597; Winter, J. et.al., (2009) Nature Cell Biology, 11, 228
-6-

Sample & Assay Technologies
miRNA genomic structure

(a) Independent Promoter
MyoD

SRF

miR‐1‐1

miR‐1‐1

miR‐133a‐2
miR‐133a‐2

(b) Intronic
miR‐208
Exon‐27

miR‐208
Exon‐28

(c) Exonic
miR‐198
Exon‐10

miR‐198

Exon‐11

 Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter
 Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can
also be in clusters, transcribed by the host gene promoter
 Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene
 miRNAs can be transcribed from the negative strand within or near a protein coding gene

-7-

Sample & Assay Technologies
Multiple loci can generate the same mature miRNA
But are under different regulatory control
Stem Loop

CHR

Overlapping transcripts

CHR: Coordinates (GRCh37)

1302-1

12

intergenic

12: 113132839-113132981 [-]

1302-3

2

intergenic

2: 114340536-114340673 [-]

1302-7

8

intergenic

8: 142867603-142867674 [-]

1302-10

15

intergenic

15: 102500662-102500799 [-]

1302-11

19

intergenic

19: 71973-72110 [+]

1302-2

1

intronic

Non protein coding

1: 30366-30503 [+] sense

1302-4

2

intronic

Non protein coding

2: 208133999-208134148 [-]

1302-9

9

Non protein coding

9: 30144-30281 [+]; Sense

1302-5

20

intronic

Protein coding/FAM65C; intron4

1302-6

7

intronic

Protein coding/HDAC9; intron 1

1302-8

9

intronic

Protein coding/ch9orf174

20: 49231173-49231322 [-]; Sense
7: 18166843-18166932 [-] ; Antisense
9: 100125836-100125963 [-];
Antisense

Mature-miR-1302: UUGGGACAUACUUAUGCUAAA

www.mirbase.org

-8-

Sample & Assay Technologies
miRNA: Cutting Edge of Science
miRNA database: www.mirbase.org
New miRNAs continually discovered (release
16.0)
 Human: 1066
 Mouse: 940
 Rat: 653
Nomenclature
 Pri-miRNA (>100nt)
 Pre-miRNA (~70nt)
 Mature miRNA (~20nt)
.

.

microRNA/miRNA Research
4000

.

Highwire + Pubmed Hits

3500
3000
2500
2000
1500
1000
500
0
2005

2006

2007

2008

2009

Year

-9-

Sample & Assay Technologies
Why Analyze miRNA Expression Patterns?
Potential for genome-wide coverage, even though >1000 miRNAs
identified
miRNA expression profiles correlate with:
 Protein & Gene Expression Levels, Biological Phenotypes
miRNA regulated genes are involved in a variety of biological
processes and diseases:
 Cancer
 Development
 Immunology
 Aging
 Heart Diseases
 Neurological Diseases
.

.

.

- 10 -

Sample & Assay Technologies
How to Monitor miRNA Expression Levels
Northern Blot
 Very low throughput
 Very time consuming and complex
Microarrays
 Profile More Sequences
 Poor Sensitivity & Dynamic Range, Complicated Protocol
Real-Time RT-PCR
 Profiles Fewer Sequences (Up to 384)
 Simpler Protocol
 Better Sensitivity, Specificity & Reproducibility

.

.

.

- 11 -

Sample & Assay Technologies
Topics to be Covered

Introduction to miRNA
miScript miRNA PCR Array Overview
 How It Works
 Portfolio
 Benefit

miScript miRNA PCR Array Applications
 Cancer
 Development & Differentiation
 Genome-Wide Discovery

- 12 -

Sample & Assay Technologies
miScript miRNA PCR Array System
.

.

.

miRNeasy miRNA Isolation Kit
miScript miRNA 1st Strand cDNA Synthesis Kit
 Preferentially reverse transcribe mature miRNA
 Built-in external RNA control
 One-step reaction
miScript miRNA PCR Arrays and qPCR Primers
 Human, mouse, rat: Search miRNA Primers:
http://www.sabiosciences.com/mirna_pcr_assay.php

-or-

.

.

 PCR Arrays: Pathways and Genomes
 Cancer
 Cell Differentiation & Development
 Immunopathology
 Inflammation
 miFinder
 Whole Genome (miRNome) – Sanger miRBase V14.0
 Serum (or plasma)
 Brain Cancer miRNA
 Neurological Development & Disease
Optimized miScript SYBR® Green Master Mix
miScript miRNA Data Analysis Excel Template & Web Portal
- 13 -

Sample & Assay Technologies
miScript miRNA Array format:
Standardized controls (96 well plate)

1
A
B
C
D
E
F
G
H

2

3

4

5

6

7

8

9

10

11

12

84 miRNA Pathway Assays

Controls

1

2

3

4

5

6

7

8

9

10

11

12

H
Cel-miR-39

SNORD61; SNORD68; SNORD72
SNORD95; SNORD96A; RNU6B

miRTC

PPC

Spike in
Control

miScript Controls for
Normalization

RT
Control

PCR
Control

miScript controls: Common for Human, Mouse, Rat and Dog Arrays

- 14 -

Sample & Assay Technologies
miScript miRNA PCR Arrays
cDNA Synthesis (miScript II RT KIT)
 1 hours

.

Load Plates (Preferably with 8-Channel
Pipettors)
 2 minutes
.

Run 40 cycle qPCR Program
 2 hours

.

Upload and Analyze Data
 15 minutes

.

- 15 -

Sample & Assay Technologies
miScript miRNA PCR Arrays
Complete miRNA genome (miRNome)






miRNA Pathway Arrays
 Human, Mouse, Rat:
 Brain Cancers
 Cancer
 Cell Differentiation & Development
 Immunopathology
 Inflammation
 miFinder
 Neurological Development & Disease
 Serum and Plasma (NEW!)
 Breast Cancer
 Ovarian Cancer

Human miScript miRNA PCR Array
Mouse miScript miRNA PCR Array
Rat miScript miRNA PCR Array
Dog miScript miRNA PCR Array

All miRNA designs based on mirBase 16
- 16 -

Sample & Assay Technologies
Compatible Instrumentation: 96- & 384-Well Formats

.

.

.

.

.

96-Well Blocks: 7000, 7300, 7500, 7700, 7900HT, ViiA 7
FAST 96-Well Blocks: 7500, 7900HT, Step One Plus, ViiA 7
FAST 384-Well Block: 7900HT, ViiA 7

.

.

Mastercycler ep realplex 2/2S/4/4S

.

Mx3000p, Mx3005p, Mx4000p

iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384
Opticon, Opticon 2, Chromo 4

LightCycler 480

.

Rotor-Gene Q, Rotor-Gene 6000

miRNA PCR Array Service Core

- 17 -

Sample & Assay Technologies
miRNA RT-PCR Technical Difficulties

Short sequence (21-23nt)

.

Background from contaminating small RNAs (tRNA, rRNA, snRNA)

.

Highly homologous
 Many miRNAs have a single nucleotide difference

.

- 18 -

Sample & Assay Technologies
SABio: Universal miRNA Reverse Transcription
Same cDNA preparation can assay ANY miRNA

miRNA
Poly(A) Polymerase

AAAAAAAA
NNTTTTTTTT
miRNA RT Primer
Reverse Transcriptase

TTTTTTTT
Real-Time PCR

miRNA-Specific Primer

TTTTTTTT
Universal Primer

- 19 -

Sample & Assay Technologies
Performance: Universal RT Advantages
Ease of Universal Reverse Transcription Reaction
 Simpler setup, without primer interaction issues
 Less sample necessary for analyses
 Equal RT reaction for each miRNA, to ensure reproducible
expression analysis
Comprehensive miRNA coverage
 cDNA can be saved for new analyses when additional miRNA
sequences are discovered

.

.

Similar potential specificity, & additional flexibility!

- 20 -

Sample & Assay Technologies
Performance: Reproducibility

The miscript miRNA PCR Assays are highly reproducible,
ensuring run-to-run, plate-to-plate and sample-to-sample
reliability.
- 21 -

Sample & Assay Technologies
Replicates: Technical & Biological
Technical
 Reproducibility of the PCR Arrays is very high
 Results demonstrate that what you are seeing is a result of biology, not
technique.
 RTC & PPC show technical reproducibility on each plate, and comparable
across plates.

Biological
Needed to verify the results are a result of biology
 Need multiple samples
 At least 3 replicates per sample for statistical analysis
 p values
95% Confidence Intervals

- 22 -

Sample & Assay Technologies
Topics to be Covered

Introduction to miRNA
miScript miRNA PCR Array Overview
 How It Works
 Portfolio
 Benefit

miScript miRNA PCR Array Applications
 Cancer
 Development & Differentiation
 Genome-Wide Discovery

- 23 -

Sample & Assay Technologies
Application Data: Cancer Biomarkers

Human Cancer miscript miRNA PCR Array:
Many Cancer-Specific miRNA Are Up-regulated in a
Colon Tumor.

- 24 -

Sample & Assay Technologies
Application Data: Cell Differentiation & Development

26 Brain-Specific miRNA

20 Muscle-Specific miRNA

Human Cell Differentiation & Development miscript miRNA PCR
Array: Identifies 26 Brain- and 20 Muscle-Specific miRNA Potentially
Regulating Tissue-Specific Gene Expression.

- 25 -

Sample & Assay Technologies
Application Data: Genome-Wide Screening
40

Ct Adeno-p53

35

30

203
551a
25

34a
940

20

15
15

20

25

30

35

40

Ct Control

miscript Human Genome miRNA PCR Array: Identifies Known
and Novel miRNA Targets of the p53 Signaling Pathway

- 26 -

Sample & Assay Technologies
Application Data: FFPE

Expression rank order of 88
cancer related miRNAs in
RNA extracted from one
20m section of a 2-year
old normal human colon
FFPE block using the
miscript FFPE RNA
Extraction Kit.

- 27 -

Sample & Assay Technologies
SUMMARY
miRNA Function

.

•

Regulates gene expression post-transcriptionally

miRNA Performance

.

•
•
•

RT-PCR vs. Microarrays
Universal vs. Sequence-Specific RT
Specificity, Sensitivity & Reproducibility

miRNA Applications

.

•
•

Screen cancer- or development-focused miRNA panels
Discover novel roles for miRNA sequences

How can YOU analyze miRNA in YOUR research?
… With miscript miRNA PCR Arrays & Assays!

- 28 -

Sample & Assay Technologies
New User Promotion
Experience miRNA PCR Array Performance Try them today!
Promo Code: FDK-MIS1
Starter Pack for miscript miRNA PCR Arrays
• 2 96-well or 1 384-well (4x96) PCR Arrays (Free)
• Any pathway
• With purchase of:
• mIScript SYBR PCR Kit (200 reaction)
• miscript miRNA 1st Strand cDNA Synthesis Kit
Please call to take advantage of this offer.
Valid for US & Canadian customers

Questions?
Contact Technical Support 9 AM – 6 PM Eastern M – F
Many scientists have discovered the
power of miRNA PCR Arrays.
Contact: 1-888-503-3187 OR support@SABiosciences.com
Join them on the road to success!

http://www.sabiosciences.com/promotion/miscriptdemo.php
- 29 -

Sample & Assay Technologies
What’s Next – After PCR Arrays
.

.

.

.

.

.

Validate results with more sample and focused set of genes
 Custom PCR Arrays
Identify Transcription Factors Regulating your Gene
 Biology-on-Array
Assess Biological Impact
 Cignal™ Reporters
Knockdown Analysis
 SureSilencing™ shRNA Plasmids
 Flexitube/Flexiplate siRNAs
Analyze interaction between DNA & nuclear proteins
 ChampionChIP™ Chromatin Immunoprecipitation PCR Arrays
Quantify secreted proteins in blood plasma sera
 ELISArrays

- 30 -

Sample & Assay Technologies
Additional Resources

E-Learning Center:
Recorded Seminars

- 31 -

Sample & Assay Technologies

Weitere ähnliche Inhalte

Was ist angesagt?

Massively parallel sequencing in forensic genetics
Massively parallel sequencing in forensic geneticsMassively parallel sequencing in forensic genetics
Massively parallel sequencing in forensic geneticsThermo Fisher Scientific
 
Planning and Executing siRNA Experiments—Good Practices for Optimal Results
Planning and Executing siRNA Experiments—Good Practices for Optimal ResultsPlanning and Executing siRNA Experiments—Good Practices for Optimal Results
Planning and Executing siRNA Experiments—Good Practices for Optimal ResultsIntegrated DNA Technologies
 
Mi rna series i-dec 2012
Mi rna series i-dec 2012Mi rna series i-dec 2012
Mi rna series i-dec 2012Elsa von Licy
 
Emergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciencesEmergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalscienceskarenbbs
 
Varda Rotter - Weizmann Institute of Science.
Varda Rotter - Weizmann Institute of Science.Varda Rotter - Weizmann Institute of Science.
Varda Rotter - Weizmann Institute of Science.Fundación Ramón Areces
 
RNA-based screening in drug discovery – introducing sgRNA technologies
RNA-based screening in drug discovery – introducing sgRNA technologiesRNA-based screening in drug discovery – introducing sgRNA technologies
RNA-based screening in drug discovery – introducing sgRNA technologiesCandy Smellie
 
Identification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hivIdentification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hivTaahira Goolam Hoosen (Moola)
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Thermo Fisher Scientific
 
Introducing Genomic Testing Cooperative (GTC)
Introducing Genomic Testing Cooperative (GTC)Introducing Genomic Testing Cooperative (GTC)
Introducing Genomic Testing Cooperative (GTC)George Arndt
 
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...Laura Berry
 
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...QIAGEN
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3Michael Powell
 
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030Thermo Fisher Scientific
 
Successful Validation of RNA Targets: Improve your gene expression analysis ...
Successful Validation of RNA Targets:  Improve your gene expression analysis ...Successful Validation of RNA Targets:  Improve your gene expression analysis ...
Successful Validation of RNA Targets: Improve your gene expression analysis ...QIAGEN
 
2012 10-24 - ngs webinar
2012 10-24 - ngs webinar2012 10-24 - ngs webinar
2012 10-24 - ngs webinarElsa von Licy
 
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...Thermo Fisher Scientific
 

Was ist angesagt? (20)

Massively parallel sequencing in forensic genetics
Massively parallel sequencing in forensic geneticsMassively parallel sequencing in forensic genetics
Massively parallel sequencing in forensic genetics
 
Planning and Executing siRNA Experiments—Good Practices for Optimal Results
Planning and Executing siRNA Experiments—Good Practices for Optimal ResultsPlanning and Executing siRNA Experiments—Good Practices for Optimal Results
Planning and Executing siRNA Experiments—Good Practices for Optimal Results
 
Mi rna series i-dec 2012
Mi rna series i-dec 2012Mi rna series i-dec 2012
Mi rna series i-dec 2012
 
Molecular profiling 2013
Molecular profiling 2013Molecular profiling 2013
Molecular profiling 2013
 
Emergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciencesEmergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciences
 
Varda Rotter - Weizmann Institute of Science.
Varda Rotter - Weizmann Institute of Science.Varda Rotter - Weizmann Institute of Science.
Varda Rotter - Weizmann Institute of Science.
 
RNA-based screening in drug discovery – introducing sgRNA technologies
RNA-based screening in drug discovery – introducing sgRNA technologiesRNA-based screening in drug discovery – introducing sgRNA technologies
RNA-based screening in drug discovery – introducing sgRNA technologies
 
Tpa 2013
Tpa 2013Tpa 2013
Tpa 2013
 
Identification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hivIdentification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hiv
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
 
Introducing Genomic Testing Cooperative (GTC)
Introducing Genomic Testing Cooperative (GTC)Introducing Genomic Testing Cooperative (GTC)
Introducing Genomic Testing Cooperative (GTC)
 
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...
 
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
 
Tri-Con_2015
Tri-Con_2015Tri-Con_2015
Tri-Con_2015
 
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
 
Presentacion jbi
Presentacion jbiPresentacion jbi
Presentacion jbi
 
Successful Validation of RNA Targets: Improve your gene expression analysis ...
Successful Validation of RNA Targets:  Improve your gene expression analysis ...Successful Validation of RNA Targets:  Improve your gene expression analysis ...
Successful Validation of RNA Targets: Improve your gene expression analysis ...
 
2012 10-24 - ngs webinar
2012 10-24 - ngs webinar2012 10-24 - ngs webinar
2012 10-24 - ngs webinar
 
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...
 

Andere mochten auch

microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...
microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...
microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...Paul Schoenhagen
 
MicroRNA tiny but efective
MicroRNA tiny but efectiveMicroRNA tiny but efective
MicroRNA tiny but efectivesebastian Rivera
 
Rna And Protein Synthesis Ss
Rna And Protein Synthesis SsRna And Protein Synthesis Ss
Rna And Protein Synthesis SsLeslie Smith
 
Integrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functionsIntegrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functionsMaté Ongenaert
 
Rna and protein synthesis
Rna and protein synthesisRna and protein synthesis
Rna and protein synthesisMuhmmad Asif
 
MiRNA presentation
MiRNA presentationMiRNA presentation
MiRNA presentationjthouse1928
 
microRNA discovery and biomarker development in clinical samples
microRNA discovery and biomarker development in clinical samplesmicroRNA discovery and biomarker development in clinical samples
microRNA discovery and biomarker development in clinical samplesexiqon
 
structure types and function of RNA
structure types and function of RNAstructure types and function of RNA
structure types and function of RNAadnandinmohammed
 
RNAi, miRNA & siRNA
RNAi, miRNA & siRNARNAi, miRNA & siRNA
RNAi, miRNA & siRNAsbryant89
 
Biology - Chp 12 - DNA & RNA - PowerPoint
Biology - Chp 12 - DNA & RNA - PowerPointBiology - Chp 12 - DNA & RNA - PowerPoint
Biology - Chp 12 - DNA & RNA - PowerPointMr. Walajtys
 
DNA Structure PowerPoint
DNA Structure PowerPointDNA Structure PowerPoint
DNA Structure PowerPointBiologyIB
 
RNA- Structure, Types and Functions
RNA- Structure, Types and FunctionsRNA- Structure, Types and Functions
RNA- Structure, Types and FunctionsNamrata Chhabra
 
Call for non-coding mRNA resource
Call for non-coding mRNA resourceCall for non-coding mRNA resource
Call for non-coding mRNA resourceMatthias Harbers
 

Andere mochten auch (20)

microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...
microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...
microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...
 
MicroRNA tiny but efective
MicroRNA tiny but efectiveMicroRNA tiny but efective
MicroRNA tiny but efective
 
Rna And Protein Synthesis Ss
Rna And Protein Synthesis SsRna And Protein Synthesis Ss
Rna And Protein Synthesis Ss
 
Mirna and its applications
Mirna and its applicationsMirna and its applications
Mirna and its applications
 
Integrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functionsIntegrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functions
 
Rna and protein synthesis
Rna and protein synthesisRna and protein synthesis
Rna and protein synthesis
 
10 tips for working with RNA
10 tips for working with RNA 10 tips for working with RNA
10 tips for working with RNA
 
Micro RNAs
Micro RNAsMicro RNAs
Micro RNAs
 
MiRNA presentation
MiRNA presentationMiRNA presentation
MiRNA presentation
 
RNA presentation (2014)
RNA presentation (2014)RNA presentation (2014)
RNA presentation (2014)
 
miRNA & siRNA
miRNA & siRNAmiRNA & siRNA
miRNA & siRNA
 
microRNA discovery and biomarker development in clinical samples
microRNA discovery and biomarker development in clinical samplesmicroRNA discovery and biomarker development in clinical samples
microRNA discovery and biomarker development in clinical samples
 
miRNA
miRNAmiRNA
miRNA
 
structure types and function of RNA
structure types and function of RNAstructure types and function of RNA
structure types and function of RNA
 
RNAi, miRNA & siRNA
RNAi, miRNA & siRNARNAi, miRNA & siRNA
RNAi, miRNA & siRNA
 
Biology - Chp 12 - DNA & RNA - PowerPoint
Biology - Chp 12 - DNA & RNA - PowerPointBiology - Chp 12 - DNA & RNA - PowerPoint
Biology - Chp 12 - DNA & RNA - PowerPoint
 
DNA Structure PowerPoint
DNA Structure PowerPointDNA Structure PowerPoint
DNA Structure PowerPoint
 
RNA- Structure, Types and Functions
RNA- Structure, Types and FunctionsRNA- Structure, Types and Functions
RNA- Structure, Types and Functions
 
Call for non-coding mRNA resource
Call for non-coding mRNA resourceCall for non-coding mRNA resource
Call for non-coding mRNA resource
 
Micro rna
Micro rnaMicro rna
Micro rna
 

Ähnlich wie miScript miRNA PCR Arrays: Genome-Wide & Pathway-Focused miRNA Profiling

Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...QIAGEN
 
Mi rna functional analysis 2013
Mi rna functional analysis 2013Mi rna functional analysis 2013
Mi rna functional analysis 2013Elsa von Licy
 
Bro gef mi_rna_0212_lr
Bro gef mi_rna_0212_lrBro gef mi_rna_0212_lr
Bro gef mi_rna_0212_lrElsa von Licy
 
Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideQIAGEN
 
Rt2 micrornapcr arrayswhitepaper
Rt2 micrornapcr arrayswhitepaperRt2 micrornapcr arrayswhitepaper
Rt2 micrornapcr arrayswhitepaperElsa von Licy
 
Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...
Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...
Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...QIAGEN
 
miScript Single Cell Poster
miScript Single Cell PostermiScript Single Cell Poster
miScript Single Cell PosterQIAGEN
 
Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013Elsa von Licy
 
Wp mi script_preamp_0613_lr
Wp mi script_preamp_0613_lrWp mi script_preamp_0613_lr
Wp mi script_preamp_0613_lrElsa von Licy
 
Total RNA Discovery for RNA Biomarker Development Webinar
Total RNA Discovery for RNA Biomarker Development WebinarTotal RNA Discovery for RNA Biomarker Development Webinar
Total RNA Discovery for RNA Biomarker Development WebinarQIAGEN
 
Mi rna part iii_2013
Mi rna part iii_2013Mi rna part iii_2013
Mi rna part iii_2013Elsa von Licy
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...QIAGEN
 

Ähnlich wie miScript miRNA PCR Arrays: Genome-Wide & Pathway-Focused miRNA Profiling (20)

Mi rna toss_set
Mi rna toss_setMi rna toss_set
Mi rna toss_set
 
Mi rna brochure_set
Mi rna brochure_setMi rna brochure_set
Mi rna brochure_set
 
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...
 
Sh rna 2013
Sh rna 2013Sh rna 2013
Sh rna 2013
 
Mi rna functional analysis 2013
Mi rna functional analysis 2013Mi rna functional analysis 2013
Mi rna functional analysis 2013
 
Bro gef mi_rna_0212_lr
Bro gef mi_rna_0212_lrBro gef mi_rna_0212_lr
Bro gef mi_rna_0212_lr
 
Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the Guide
 
Rt2 micrornapcr arrayswhitepaper
Rt2 micrornapcr arrayswhitepaperRt2 micrornapcr arrayswhitepaper
Rt2 micrornapcr arrayswhitepaper
 
Si rna 2013
Si rna 2013Si rna 2013
Si rna 2013
 
20140710 5 k_thompson_ercc2.0_workshop
20140710 5 k_thompson_ercc2.0_workshop20140710 5 k_thompson_ercc2.0_workshop
20140710 5 k_thompson_ercc2.0_workshop
 
Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...
Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...
Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...
 
miScript Single Cell Poster
miScript Single Cell PostermiScript Single Cell Poster
miScript Single Cell Poster
 
Epigenetics 2013
Epigenetics 2013Epigenetics 2013
Epigenetics 2013
 
Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013
 
An mi script-serum
An mi script-serumAn mi script-serum
An mi script-serum
 
Wp mi script_preamp_0613_lr
Wp mi script_preamp_0613_lrWp mi script_preamp_0613_lr
Wp mi script_preamp_0613_lr
 
Ffpe pcr array
Ffpe pcr arrayFfpe pcr array
Ffpe pcr array
 
Total RNA Discovery for RNA Biomarker Development Webinar
Total RNA Discovery for RNA Biomarker Development WebinarTotal RNA Discovery for RNA Biomarker Development Webinar
Total RNA Discovery for RNA Biomarker Development Webinar
 
Mi rna part iii_2013
Mi rna part iii_2013Mi rna part iii_2013
Mi rna part iii_2013
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
 

Mehr von Elsa von Licy

Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Elsa von Licy
 
Strategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfiStrategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfiElsa von Licy
 
Neuropsychophysiologie
NeuropsychophysiologieNeuropsychophysiologie
NeuropsychophysiologieElsa von Licy
 
L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages   184 ko)L agressivite en psychanalyse (21 pages   184 ko)
L agressivite en psychanalyse (21 pages 184 ko)Elsa von Licy
 
C1 clef pour_la_neuro
C1 clef pour_la_neuroC1 clef pour_la_neuro
C1 clef pour_la_neuroElsa von Licy
 
Vuillez jean philippe_p01
Vuillez jean philippe_p01Vuillez jean philippe_p01
Vuillez jean philippe_p01Elsa von Licy
 
Spr ue3.1 poly cours et exercices
Spr ue3.1   poly cours et exercicesSpr ue3.1   poly cours et exercices
Spr ue3.1 poly cours et exercicesElsa von Licy
 
Plan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pPlan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pElsa von Licy
 
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsBioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsElsa von Licy
 
Poly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesPoly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesElsa von Licy
 
Methodes travail etudiants
Methodes travail etudiantsMethodes travail etudiants
Methodes travail etudiantsElsa von Licy
 
Atelier.etude.efficace
Atelier.etude.efficaceAtelier.etude.efficace
Atelier.etude.efficaceElsa von Licy
 
There is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introThere is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introElsa von Licy
 

Mehr von Elsa von Licy (20)

Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
 
Strategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfiStrategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfi
 
Rainville pierre
Rainville pierreRainville pierre
Rainville pierre
 
Neuropsychophysiologie
NeuropsychophysiologieNeuropsychophysiologie
Neuropsychophysiologie
 
L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages   184 ko)L agressivite en psychanalyse (21 pages   184 ko)
L agressivite en psychanalyse (21 pages 184 ko)
 
C1 clef pour_la_neuro
C1 clef pour_la_neuroC1 clef pour_la_neuro
C1 clef pour_la_neuro
 
Hemostase polycop
Hemostase polycopHemostase polycop
Hemostase polycop
 
Antiphilos
AntiphilosAntiphilos
Antiphilos
 
Vuillez jean philippe_p01
Vuillez jean philippe_p01Vuillez jean philippe_p01
Vuillez jean philippe_p01
 
Spr ue3.1 poly cours et exercices
Spr ue3.1   poly cours et exercicesSpr ue3.1   poly cours et exercices
Spr ue3.1 poly cours et exercices
 
Plan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pPlan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 p
 
M2 bmc2007 cours01
M2 bmc2007 cours01M2 bmc2007 cours01
M2 bmc2007 cours01
 
Feuilletage
FeuilletageFeuilletage
Feuilletage
 
Chapitre 1
Chapitre 1Chapitre 1
Chapitre 1
 
Biophy
BiophyBiophy
Biophy
 
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsBioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
 
Poly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesPoly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicales
 
Methodes travail etudiants
Methodes travail etudiantsMethodes travail etudiants
Methodes travail etudiants
 
Atelier.etude.efficace
Atelier.etude.efficaceAtelier.etude.efficace
Atelier.etude.efficace
 
There is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introThere is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_intro
 

miScript miRNA PCR Arrays: Genome-Wide & Pathway-Focused miRNA Profiling

  • 1. miScript miRNA PCR Arrays Genome-Wide & Pathway-Focused Analysis With an Advanced qPCR Technology Samuel J. Rulli, Jr.,Ph.D. qPCR Applications Scientist Samuel.Rulli@QIAGEN.com Sample & Assay Technologies
  • 2. miScript miRNA PCR Arrays Genome-Wide & Pathway-Focused Analysis With an Advanced qPCR Technology Questions? Comments? or Suggestions? Ask now or contact Technical Support . . Telephone: 888-503-3187; Email: support@SABiosciences.com . Sample & Assay Technologies
  • 3. Welcome to SABiosciences: Systems Biology with a Pathway Focused Approach • SABiosciences is now a Company -3- Sample & Assay Technologies
  • 4. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview  How It Works  Portfolio  Benefit miScript miRNA PCR Array Applications  Cancer  Development & Differentiation  Genome-Wide Discovery -4- Sample & Assay Technologies
  • 5. What Is MicroRNA? . . . Endogenously expressed small functional RNAs (19-25 nt) Regulate mRNA expression post-transcriptionally  mRNA degradation, but also translation inhibition Only partial sequence complementarity required  One miRNA can potentially regulate hundreds of mRNAs  One mRNA can be regulated by multiple miRNAs Another layer of complexity for regulating gene expression -5- Sample & Assay Technologies
  • 6. Canonical pathway of microRNA biogenesis NUCLEUS microRNA Gene DNA  Transcribed by RNA Polymerase II as a long primary transcript (pri-miRNAs), which may contain more than one miRNA. POL II Pri-miRNA Drosha-DGCR8  In the nucleus, Pri-miRNAs are processed to hairpin-like pre-miRNAs by RNAse IIIlike enzyme Drosha Pre-miRNA CYTOPLASM Exportin  Pre-miRNAs are then exported to the Cytosol by Exportin 5 Exportin DICER-TRBP mature miRNA Ago RISC Assembly  These miRNAs are incorporated in RISC RISC High homology mRNA cleavage  In the cytosol RNAse III-like Dicer processes these precursors to mature miRNAs Partial homology Translational Repression mRNA degradation  miRNAs with high homology to the target mRNA lead to mRNA cleavage  miRNAs with imperfect base pairing to the target mRNA lead to translational repression and/or mRNA degradation Krol, J et.al., (2010) Nature Rev Genetics, 11, 597; Winter, J. et.al., (2009) Nature Cell Biology, 11, 228 -6- Sample & Assay Technologies
  • 7. miRNA genomic structure (a) Independent Promoter MyoD SRF miR‐1‐1 miR‐1‐1 miR‐133a‐2 miR‐133a‐2 (b) Intronic miR‐208 Exon‐27 miR‐208 Exon‐28 (c) Exonic miR‐198 Exon‐10 miR‐198 Exon‐11  Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter  Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can also be in clusters, transcribed by the host gene promoter  Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene  miRNAs can be transcribed from the negative strand within or near a protein coding gene -7- Sample & Assay Technologies
  • 8. Multiple loci can generate the same mature miRNA But are under different regulatory control Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron4 1302-6 7 intronic Protein coding/HDAC9; intron 1 1302-8 9 intronic Protein coding/ch9orf174 20: 49231173-49231322 [-]; Sense 7: 18166843-18166932 [-] ; Antisense 9: 100125836-100125963 [-]; Antisense Mature-miR-1302: UUGGGACAUACUUAUGCUAAA www.mirbase.org -8- Sample & Assay Technologies
  • 9. miRNA: Cutting Edge of Science miRNA database: www.mirbase.org New miRNAs continually discovered (release 16.0)  Human: 1066  Mouse: 940  Rat: 653 Nomenclature  Pri-miRNA (>100nt)  Pre-miRNA (~70nt)  Mature miRNA (~20nt) . . microRNA/miRNA Research 4000 . Highwire + Pubmed Hits 3500 3000 2500 2000 1500 1000 500 0 2005 2006 2007 2008 2009 Year -9- Sample & Assay Technologies
  • 10. Why Analyze miRNA Expression Patterns? Potential for genome-wide coverage, even though >1000 miRNAs identified miRNA expression profiles correlate with:  Protein & Gene Expression Levels, Biological Phenotypes miRNA regulated genes are involved in a variety of biological processes and diseases:  Cancer  Development  Immunology  Aging  Heart Diseases  Neurological Diseases . . . - 10 - Sample & Assay Technologies
  • 11. How to Monitor miRNA Expression Levels Northern Blot  Very low throughput  Very time consuming and complex Microarrays  Profile More Sequences  Poor Sensitivity & Dynamic Range, Complicated Protocol Real-Time RT-PCR  Profiles Fewer Sequences (Up to 384)  Simpler Protocol  Better Sensitivity, Specificity & Reproducibility . . . - 11 - Sample & Assay Technologies
  • 12. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview  How It Works  Portfolio  Benefit miScript miRNA PCR Array Applications  Cancer  Development & Differentiation  Genome-Wide Discovery - 12 - Sample & Assay Technologies
  • 13. miScript miRNA PCR Array System . . . miRNeasy miRNA Isolation Kit miScript miRNA 1st Strand cDNA Synthesis Kit  Preferentially reverse transcribe mature miRNA  Built-in external RNA control  One-step reaction miScript miRNA PCR Arrays and qPCR Primers  Human, mouse, rat: Search miRNA Primers: http://www.sabiosciences.com/mirna_pcr_assay.php -or- . .  PCR Arrays: Pathways and Genomes  Cancer  Cell Differentiation & Development  Immunopathology  Inflammation  miFinder  Whole Genome (miRNome) – Sanger miRBase V14.0  Serum (or plasma)  Brain Cancer miRNA  Neurological Development & Disease Optimized miScript SYBR® Green Master Mix miScript miRNA Data Analysis Excel Template & Web Portal - 13 - Sample & Assay Technologies
  • 14. miScript miRNA Array format: Standardized controls (96 well plate) 1 A B C D E F G H 2 3 4 5 6 7 8 9 10 11 12 84 miRNA Pathway Assays Controls 1 2 3 4 5 6 7 8 9 10 11 12 H Cel-miR-39 SNORD61; SNORD68; SNORD72 SNORD95; SNORD96A; RNU6B miRTC PPC Spike in Control miScript Controls for Normalization RT Control PCR Control miScript controls: Common for Human, Mouse, Rat and Dog Arrays - 14 - Sample & Assay Technologies
  • 15. miScript miRNA PCR Arrays cDNA Synthesis (miScript II RT KIT)  1 hours . Load Plates (Preferably with 8-Channel Pipettors)  2 minutes . Run 40 cycle qPCR Program  2 hours . Upload and Analyze Data  15 minutes . - 15 - Sample & Assay Technologies
  • 16. miScript miRNA PCR Arrays Complete miRNA genome (miRNome)     miRNA Pathway Arrays  Human, Mouse, Rat:  Brain Cancers  Cancer  Cell Differentiation & Development  Immunopathology  Inflammation  miFinder  Neurological Development & Disease  Serum and Plasma (NEW!)  Breast Cancer  Ovarian Cancer Human miScript miRNA PCR Array Mouse miScript miRNA PCR Array Rat miScript miRNA PCR Array Dog miScript miRNA PCR Array All miRNA designs based on mirBase 16 - 16 - Sample & Assay Technologies
  • 17. Compatible Instrumentation: 96- & 384-Well Formats . . . . . 96-Well Blocks: 7000, 7300, 7500, 7700, 7900HT, ViiA 7 FAST 96-Well Blocks: 7500, 7900HT, Step One Plus, ViiA 7 FAST 384-Well Block: 7900HT, ViiA 7 . . Mastercycler ep realplex 2/2S/4/4S . Mx3000p, Mx3005p, Mx4000p iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384 Opticon, Opticon 2, Chromo 4 LightCycler 480 . Rotor-Gene Q, Rotor-Gene 6000 miRNA PCR Array Service Core - 17 - Sample & Assay Technologies
  • 18. miRNA RT-PCR Technical Difficulties Short sequence (21-23nt) . Background from contaminating small RNAs (tRNA, rRNA, snRNA) . Highly homologous  Many miRNAs have a single nucleotide difference . - 18 - Sample & Assay Technologies
  • 19. SABio: Universal miRNA Reverse Transcription Same cDNA preparation can assay ANY miRNA miRNA Poly(A) Polymerase AAAAAAAA NNTTTTTTTT miRNA RT Primer Reverse Transcriptase TTTTTTTT Real-Time PCR miRNA-Specific Primer TTTTTTTT Universal Primer - 19 - Sample & Assay Technologies
  • 20. Performance: Universal RT Advantages Ease of Universal Reverse Transcription Reaction  Simpler setup, without primer interaction issues  Less sample necessary for analyses  Equal RT reaction for each miRNA, to ensure reproducible expression analysis Comprehensive miRNA coverage  cDNA can be saved for new analyses when additional miRNA sequences are discovered . . Similar potential specificity, & additional flexibility! - 20 - Sample & Assay Technologies
  • 21. Performance: Reproducibility The miscript miRNA PCR Assays are highly reproducible, ensuring run-to-run, plate-to-plate and sample-to-sample reliability. - 21 - Sample & Assay Technologies
  • 22. Replicates: Technical & Biological Technical  Reproducibility of the PCR Arrays is very high  Results demonstrate that what you are seeing is a result of biology, not technique.  RTC & PPC show technical reproducibility on each plate, and comparable across plates. Biological Needed to verify the results are a result of biology  Need multiple samples  At least 3 replicates per sample for statistical analysis  p values 95% Confidence Intervals - 22 - Sample & Assay Technologies
  • 23. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview  How It Works  Portfolio  Benefit miScript miRNA PCR Array Applications  Cancer  Development & Differentiation  Genome-Wide Discovery - 23 - Sample & Assay Technologies
  • 24. Application Data: Cancer Biomarkers Human Cancer miscript miRNA PCR Array: Many Cancer-Specific miRNA Are Up-regulated in a Colon Tumor. - 24 - Sample & Assay Technologies
  • 25. Application Data: Cell Differentiation & Development 26 Brain-Specific miRNA 20 Muscle-Specific miRNA Human Cell Differentiation & Development miscript miRNA PCR Array: Identifies 26 Brain- and 20 Muscle-Specific miRNA Potentially Regulating Tissue-Specific Gene Expression. - 25 - Sample & Assay Technologies
  • 26. Application Data: Genome-Wide Screening 40 Ct Adeno-p53 35 30 203 551a 25 34a 940 20 15 15 20 25 30 35 40 Ct Control miscript Human Genome miRNA PCR Array: Identifies Known and Novel miRNA Targets of the p53 Signaling Pathway - 26 - Sample & Assay Technologies
  • 27. Application Data: FFPE Expression rank order of 88 cancer related miRNAs in RNA extracted from one 20m section of a 2-year old normal human colon FFPE block using the miscript FFPE RNA Extraction Kit. - 27 - Sample & Assay Technologies
  • 28. SUMMARY miRNA Function . • Regulates gene expression post-transcriptionally miRNA Performance . • • • RT-PCR vs. Microarrays Universal vs. Sequence-Specific RT Specificity, Sensitivity & Reproducibility miRNA Applications . • • Screen cancer- or development-focused miRNA panels Discover novel roles for miRNA sequences How can YOU analyze miRNA in YOUR research? … With miscript miRNA PCR Arrays & Assays! - 28 - Sample & Assay Technologies
  • 29. New User Promotion Experience miRNA PCR Array Performance Try them today! Promo Code: FDK-MIS1 Starter Pack for miscript miRNA PCR Arrays • 2 96-well or 1 384-well (4x96) PCR Arrays (Free) • Any pathway • With purchase of: • mIScript SYBR PCR Kit (200 reaction) • miscript miRNA 1st Strand cDNA Synthesis Kit Please call to take advantage of this offer. Valid for US & Canadian customers Questions? Contact Technical Support 9 AM – 6 PM Eastern M – F Many scientists have discovered the power of miRNA PCR Arrays. Contact: 1-888-503-3187 OR support@SABiosciences.com Join them on the road to success! http://www.sabiosciences.com/promotion/miscriptdemo.php - 29 - Sample & Assay Technologies
  • 30. What’s Next – After PCR Arrays . . . . . . Validate results with more sample and focused set of genes  Custom PCR Arrays Identify Transcription Factors Regulating your Gene  Biology-on-Array Assess Biological Impact  Cignal™ Reporters Knockdown Analysis  SureSilencing™ shRNA Plasmids  Flexitube/Flexiplate siRNAs Analyze interaction between DNA & nuclear proteins  ChampionChIP™ Chromatin Immunoprecipitation PCR Arrays Quantify secreted proteins in blood plasma sera  ELISArrays - 30 - Sample & Assay Technologies
  • 31. Additional Resources E-Learning Center: Recorded Seminars - 31 - Sample & Assay Technologies