Diese Präsentation wurde erfolgreich gemeldet.
Wir verwenden Ihre LinkedIn Profilangaben und Informationen zu Ihren Aktivitäten, um Anzeigen zu personalisieren und Ihnen relevantere Inhalte anzuzeigen. Sie können Ihre Anzeigeneinstellungen jederzeit ändern.
Clase I Asuntos filosóficos de la psicología fisiológica: una introducción   Elizabeth Torres Millayes, Psy.D.
¿Qué es la Biopsicología? <ul><li>Es el estudio científico de la biología de la conducta. </li></ul><ul><ul><li>Es el enfo...
Relación entre la biopsicologia y otras disciplinas <ul><li>Neuroanatomia: estudio de la estructura del sistema nervioso. ...
Divisiones de la Biopsicología <ul><li>Psicología Fisiológica:  </li></ul><ul><ul><li>Estudia mecanismos neurales de la co...
Divisiones de la Biopsicología (Cont) <ul><li>Psicofisiología: </li></ul><ul><ul><li>Estudio de la relación entre la activ...
¿Y qué tienen en común? <ul><li>Estudian la mente y las conductas desde un punto de vista biológico. </li></ul>
Investigaciones en biopsicologia  <ul><li>Estudian humanos y animales.  </li></ul><ul><ul><li>Ratas, ratones, gatos, perro...
Investigaciones en biopsicologia <ul><li>Se estudian a los animales por la continuidad evolutiva del encéfalo.  </li></ul>...
Investigaciones en biopsicologia <ul><li>Ventajas de los estudios con animales:  </li></ul><ul><ul><li>Los encéfalos y con...
Métodos de investigación en la biopsicología <ul><li>Estudio experimental : examen sistemático y controlado de causa y efe...
Métodos de investigación en la biopsicología <ul><ul><li>Por lo menos se involucran dos tipos de grupos de sujetos:  </li>...
Métodos de investigación en la biopsicología <ul><ul><li>Ventajas: (1) aislar variables mediante grupos de control experim...
Estudios cuasiexperimentales <ul><li>Parecen experimentos pero no son verdaderos experimentos porque las posibles variable...
Métodos de investigación en la psicología <ul><li>Estudio de caso </li></ul><ul><ul><li>Detallada descripción y análisis d...
Investigaciones básicas y aplicadas <ul><li>Investigación básica: esta motivada por la curiosidad del investigador. </li><...
Deducción científica   <ul><li>Método fundamental de la biopsicologia para descubrir algo mediante una observación cuidado...
Juicio critico sobre las tesis biopsicologicas   <ul><li>Evaluar si se ha publicado en una revista científica acreditada. ...
Problema Mente-Cuerpo <ul><li>Antiguo supuesto filosófico. </li></ul><ul><li>Rene Descartes (1596-1650) </li></ul><ul><ul>...
“ El error de Descartes” <ul><li>Antonio Damasio (1994) </li></ul><ul><ul><li>“ La naturaleza aparenta que ha construido e...
Entonces,  ¿quién tiene la razón?
La Conducta <ul><li>Definición:  </li></ul><ul><ul><li>Cualquier actividad humana o animal que pueda observarse y medirse ...
Conductas, ¿Qué sabemos? <ul><li>Todos los seres vivos ejecutan conductas. </li></ul><ul><li>Cada especie posee conductas ...
Bases de la Conducta: Ejemplos <ul><li>Biológica </li></ul><ul><li>Cerebro </li></ul><ul><li>Reflejos </li></ul><ul><li>Me...
¿Cómo se estudian las bases de las conductas humanas?
Sociedad Biología Psique El Modelo Biopsicosocial
<ul><li>Modelo  </li></ul><ul><li>Bio psico social </li></ul><ul><li>Integra los asuntos biológicos, psicológicos y social...
La evolución del hombre
Evolución <ul><li>Carles Darwin:  El Origen de las Especies  (1859) </li></ul><ul><li>Postula la teoría de la Evolución. <...
La evolución del cerebro <ul><li>El tamaño del cerebro no define la inteligencia. </li></ul><ul><ul><li>Elefante </li></ul...
La evolución del cerebro <ul><li>El encéfalo ha aumentado de tamaño. </li></ul><ul><li>El aumento ha sido mas en el cerebr...
El cerebro Triuno <ul><li>Paul McLean (1990) </li></ul><ul><li>Expone que el cerebro ha evolucionado. </li></ul><ul><li>Lo...
Los seres humanos son la única especie que tiene consciencia sobre sus conductas.
La Consciencia <ul><li>Percatarse de lo que pasa a través de los sentidos, las emociones, pensamientos y de nuestra propia...
Niveles de Consciencia <ul><li>Alerta </li></ul><ul><ul><li>Pendiente a estímulos internos y externos </li></ul></ul><ul><...
¿Cómo funciona la consciencia? <ul><li>Se relaciona con los niveles de atención. </li></ul><ul><li>Requiere de la regulaci...
La conducta, ¿es genética o aprendida? El dilema vs. Nurture Nature
Herencia vs ambiente <ul><li>Dicotomias tradicionales </li></ul><ul><ul><li>John B. Watson : conductismo </li></ul></ul><u...
Un modelo de la biología de la conducta  Evolución Genes Experiencia Organismo  en el momento Situación Actual Conducta  A...
Psicología evolucionista <ul><li>Entender la conducta humana considerando las presiones que llevaron a su evolución </li><...
Psicología evolucionista <ul><li>El vinculo de apareamiento se desarrolla por que las hembras mamíferas paren una cantidad...
Psicología evolucionista <ul><li>Poligamia </li></ul><ul><ul><li>Las hembras hacen una mayor aportación en la crianza de l...
Psicología evolucionista <ul><li>Monogamia:  </li></ul><ul><ul><li>Un macho y una hembra. </li></ul></ul><ul><li>Teoría de...
Psicología evolucionista <ul><li>Cont. Teoría de la evolución de elección de pareja: (Buss, 1992) </li></ul><ul><ul><li>El...
Clase II: Genética  y  Genética Conductual
Genética <ul><li>El origen de todo ser vivo. </li></ul><ul><li>Estudia las variaciones biológicas (herencia). </li></ul><u...
Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Genotipo:  </li></ul></ul><ul><ul><ul><li>material gen...
Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Estudios con guisantes:  </li></ul></ul><ul><ul><ul><l...
Genética <ul><li>Mendel propuso que existen dos tipos de factores hereditarios para cada rasgo dicotómico.  </li></ul><ul>...
Características heredadas <ul><li>Homocigoto  </li></ul><ul><ul><li>Dos genes idénticos para un rasgo </li></ul></ul><ul><...
ADN La información genética se encuentra en una secuencia de aminoácidos, en el núcleo de las células, llamado Ácido Deoxi...
Genes <ul><li>Son la unidad de herencia definidos por la secuencia de bases nitrogenadas y aminoácidos. </li></ul><ul><li>...
<ul><li>Deficiencias en Genes </li></ul><ul><li>Se pueden dar mutaciones en el orden de la secuencia de bases pares, ya se...
Cromosoma <ul><li>Estructuras filiformes en el núcleo de la célula. </li></ul><ul><li>Conjunto de la hélice de ADN. </li><...
Estructura del cromosoma
Algunas Anomalías Cromosómicas
Genoma <ul><li>Todo el material genético contenido en los cromosomas de un organismo. </li></ul><ul><li>El ser humano tien...
En resumen…
División Celular <ul><li>Mitosis </li></ul><ul><ul><li>División en células somáticas. </li></ul></ul><ul><ul><li>Producto:...
<ul><li>Mitosis </li></ul><ul><li>Profase </li></ul><ul><li>Metafase </li></ul><ul><li>Anafase </li></ul><ul><li>Telofase ...
Pasos división celular:  Mitosis vs. Meiosis
Genética Conductual <ul><li>Intenta buscar qué diferencias genéticas son responsables (en conjunto con la ambiental) de ra...
EU GENICS ( del griego )   EU  = bueno GENICS =generación
Francis Galton: Eugenics <ul><li>Notó que los hijos de las personas inteligentes de su época, también eran inteligentes. <...
Métodos de investigación en la Genética y Genética Conductual <ul><li>Estudios estadísticos   </li></ul><ul><li>Concordanc...
<ul><li>Estudios Moleculares:   </li></ul><ul><li>Polymerase Chain Reaction (PCR) </li></ul><ul><ul><li>Método para amplif...
Condiciones estudiadas <ul><li>Alcoholismo </li></ul><ul><li>Autismo </li></ul><ul><li>ADHD </li></ul><ul><li>Depresión </...
Human Genome Project <ul><li>Human Genome Project </li></ul><ul><ul><li>Esfuerzo internacional que busca identificar todos...
¿Qué se hereda? (cont) <ul><li>Se hereda la mitad de la información genética de padre y de madre. </li></ul><ul><li>Los ge...
Nächste SlideShare
Wird geladen in …5

Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las

  • Als Erste(r) kommentieren

  • Gehören Sie zu den Ersten, denen das gefällt!

Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las

  1. 1. Clase I Asuntos filosóficos de la psicología fisiológica: una introducción Elizabeth Torres Millayes, Psy.D.
  2. 2. ¿Qué es la Biopsicología? <ul><li>Es el estudio científico de la biología de la conducta. </li></ul><ul><ul><li>Es el enfoque biológico del estudio de la psicología. </li></ul></ul><ul><ul><li>“ La organizacion de la conducta” por D.O. Hebb : Nacimiento de la ciencia. </li></ul></ul><ul><ul><ul><li>Como la actividad cerebral produce fenómenos psicológicos. </li></ul></ul></ul>
  3. 3. Relación entre la biopsicologia y otras disciplinas <ul><li>Neuroanatomia: estudio de la estructura del sistema nervioso. </li></ul><ul><li>Neuroquimica: estudio de las bases químicas de la actividad neural. </li></ul><ul><li>Neuroendocrinologia: estudio de las interacciones entre el sistema nervioso y el sistema endocrino. </li></ul><ul><li>Neuropatologia: estudio de los trastornos del sistema nervioso. </li></ul><ul><li>Neurofarmacologia: estudio de los efectos de los farmacos sobre la actividad neural. </li></ul><ul><li>Neurofisiologia: estudio de las funciones y la actividad del sistema nervioso. </li></ul>
  4. 4. Divisiones de la Biopsicología <ul><li>Psicología Fisiológica: </li></ul><ul><ul><li>Estudia mecanismos neurales de la conducta a través de la manipulación directa del cerebro. </li></ul></ul><ul><li>Psicofarmacología: </li></ul><ul><ul><li>Enfatiza la manipulación de la actividad neural y conducta con drogas. </li></ul></ul><ul><li>Neuropsicología: </li></ul><ul><ul><li>Estudio de los efectos psicológicos de daño cerebral en humanos. </li></ul></ul>
  5. 5. Divisiones de la Biopsicología (Cont) <ul><li>Psicofisiología: </li></ul><ul><ul><li>Estudio de la relación entre la actividad fisiológica y los procesos psicológicos en humanos. </li></ul></ul><ul><li>Neurociencia Cognoscitiva: </li></ul><ul><ul><li>Estudia los mecanismos neurales de la cognición humana. </li></ul></ul><ul><li>Psicología Comparativa: </li></ul><ul><ul><li>Estudia la evolución, genética y capacidad adaptativa de la conducta a través de las diversas especies. </li></ul></ul>
  6. 6. ¿Y qué tienen en común? <ul><li>Estudian la mente y las conductas desde un punto de vista biológico. </li></ul>
  7. 7. Investigaciones en biopsicologia <ul><li>Estudian humanos y animales. </li></ul><ul><ul><li>Ratas, ratones, gatos, perros y primates. </li></ul></ul><ul><li>Con los humanos hay varias ventajas de investigación: </li></ul><ul><ul><li>Siguen instrucciones </li></ul></ul><ul><ul><li>Pueden comunicar sus experiencias </li></ul></ul><ul><ul><li>Pueden ser mas económicos </li></ul></ul><ul><ul><li>Cerebros humanos </li></ul></ul>
  8. 8. Investigaciones en biopsicologia <ul><li>Se estudian a los animales por la continuidad evolutiva del encéfalo. </li></ul><ul><ul><li>Se diferencian en su tamaño global y en el grado de desarrollo cortical. </li></ul></ul><ul><ul><li>Son diferencias cuantitativas y no cualitativas. </li></ul></ul>
  9. 9. Investigaciones en biopsicologia <ul><li>Ventajas de los estudios con animales: </li></ul><ul><ul><li>Los encéfalos y conductas son mas sencillas. </li></ul></ul><ul><ul><li>El enfoque comparativo </li></ul></ul><ul><ul><li>Se pueden hacer investigaciones que no se permiten en humanos. </li></ul></ul>
  10. 10. Métodos de investigación en la biopsicología <ul><li>Estudio experimental : examen sistemático y controlado de causa y efecto. </li></ul><ul><ul><li>El propósito es probar relaciones de causa y efecto. </li></ul></ul><ul><ul><li>Variable independiente: tratamiento que los investigadores controlan o manipulan. </li></ul></ul><ul><ul><li>Variable dependiente: el fenómeno que es tratado como un efecto o resultado. </li></ul></ul>
  11. 11. Métodos de investigación en la biopsicología <ul><ul><li>Por lo menos se involucran dos tipos de grupos de sujetos: </li></ul></ul><ul><ul><ul><li>Grupo experimental: expuesto al tratamiento experimental </li></ul></ul></ul><ul><ul><ul><li>Grupo control: expuesto a todas las condiciones experimentales, excepto al tratamiento experimental. </li></ul></ul></ul><ul><ul><li>Asignación aleatoria </li></ul></ul>
  12. 12. Métodos de investigación en la biopsicología <ul><ul><li>Ventajas: (1) aislar variables mediante grupos de control experimental. (2) Otros investigadores pueden repetir el experimento para verificar los resultados. </li></ul></ul><ul><ul><li>Desventajas: (1) un investigador puede manipular sólo un pequeño número de variable. (2) Las situaciones que un investigador crea en un laboratorio quizás no refleje el “mundo real”. </li></ul></ul>
  13. 13. Estudios cuasiexperimentales <ul><li>Parecen experimentos pero no son verdaderos experimentos porque las posibles variables extrañas no se han controlado. </li></ul>
  14. 14. Métodos de investigación en la psicología <ul><li>Estudio de caso </li></ul><ul><ul><li>Detallada descripción y análisis de una o pocas personas </li></ul></ul><ul><ul><li>Lo más usado en psicología </li></ul></ul><ul><ul><li>El sesgo del investigador puede ser problema </li></ul></ul><ul><ul><li>No se pueden hacer generalizaciones </li></ul></ul>
  15. 15. Investigaciones básicas y aplicadas <ul><li>Investigación básica: esta motivada por la curiosidad del investigador. </li></ul><ul><ul><li>Adquirir conocimiento </li></ul></ul><ul><li>Investigación aplicada: investigación encaminada a lograr algún beneficio directo para la humanidad. </li></ul>
  16. 16. Deducción científica <ul><li>Método fundamental de la biopsicologia para descubrir algo mediante una observación cuidadosa. </li></ul><ul><ul><li>Método científico </li></ul></ul><ul><ul><li>Deducción científica: deducir lógicamente lo que no pueden observar. </li></ul></ul>
  17. 17. Juicio critico sobre las tesis biopsicologicas <ul><li>Evaluar si se ha publicado en una revista científica acreditada. </li></ul><ul><li>Esto garantiza la evaluación y aprobación de los especialistas del tema. </li></ul>
  18. 18. Problema Mente-Cuerpo <ul><li>Antiguo supuesto filosófico. </li></ul><ul><li>Rene Descartes (1596-1650) </li></ul><ul><ul><li>Teoría del Dualismo </li></ul></ul><ul><ul><li>Cogito Ergo Sum (“Pienso, luego existo”) </li></ul></ul><ul><ul><ul><li>Mente y Cuerpo son dos sustancias diferentes, pero interaccionan: </li></ul></ul></ul><ul><ul><ul><ul><li>El cuerpo afecta a la mente en la percepción. </li></ul></ul></ul></ul><ul><ul><ul><ul><li>La mente afecta al cuerpo en la acción deliberada. </li></ul></ul></ul></ul><ul><li>¿Pensamos así? </li></ul>
  19. 19. “ El error de Descartes” <ul><li>Antonio Damasio (1994) </li></ul><ul><ul><li>“ La naturaleza aparenta que ha construido el aparato de la racionalidad no solo para estar al frente de la regulación biológica, sino también para venir de ella y estar con ella”. </li></ul></ul><ul><li>La mente (el cerebro) es parte del cuerpo, y éstos se influencian bilateralmente laborando de forma integrada, produciendo las conductas. </li></ul>
  20. 20. Entonces, ¿quién tiene la razón?
  21. 21. La Conducta <ul><li>Definición: </li></ul><ul><ul><li>Cualquier actividad humana o animal que pueda observarse y medirse objetivamente. </li></ul></ul>
  22. 22. Conductas, ¿Qué sabemos? <ul><li>Todos los seres vivos ejecutan conductas. </li></ul><ul><li>Cada especie posee conductas propias. </li></ul><ul><ul><li>Se repiten a través de las generaciones. </li></ul></ul><ul><li>Todas tienen un objetivo. </li></ul><ul><li>Tienen bases biológicas, psicológicas y sociales. </li></ul>
  23. 23. Bases de la Conducta: Ejemplos <ul><li>Biológica </li></ul><ul><li>Cerebro </li></ul><ul><li>Reflejos </li></ul><ul><li>Metabolismo </li></ul><ul><li>Genética </li></ul><ul><li>Psicológica </li></ul><ul><li>Emoción </li></ul><ul><li>Motivación </li></ul><ul><li>Introspección </li></ul><ul><li>Funciones Ejecutivas </li></ul><ul><li>Social </li></ul><ul><li>Aprendizaje </li></ul><ul><li>Validación </li></ul><ul><li>Liderazgo </li></ul><ul><li>Conversación </li></ul>
  24. 24. ¿Cómo se estudian las bases de las conductas humanas?
  25. 25. Sociedad Biología Psique El Modelo Biopsicosocial
  26. 26. <ul><li>Modelo </li></ul><ul><li>Bio psico social </li></ul><ul><li>Integra los asuntos biológicos, psicológicos y sociales como sistemas del cuerpo. </li></ul><ul><li>Surge en 1977 (George Engel) como un movimiento para estudiar más efectivamente al ser humano en un contexto médico. </li></ul><ul><li>Explica de forma integrada cómo influyen los sistemas en el ser humano. </li></ul>
  27. 27. La evolución del hombre
  28. 29. Evolución <ul><li>Carles Darwin: El Origen de las Especies (1859) </li></ul><ul><li>Postula la teoría de la Evolución. </li></ul><ul><ul><li>Las evidencias para esta teoría fueron: </li></ul></ul><ul><ul><ul><li>Evolución de fósiles. </li></ul></ul></ul><ul><ul><ul><li>Similaridades de extremidades </li></ul></ul></ul><ul><ul><ul><li>Cambios en las plantas y animales en crianza selectiva. </li></ul></ul></ul><ul><ul><ul><li>Cambios en el pico de aves. </li></ul></ul></ul><ul><li>Establece el concepto de selección natural. </li></ul><ul><ul><li>Adaptación. </li></ul></ul><ul><ul><li>Variación. </li></ul></ul><ul><ul><li>Sobrereproducción. </li></ul></ul><ul><ul><li>El mas fuerte sobrevive. </li></ul></ul>
  29. 30. La evolución del cerebro <ul><li>El tamaño del cerebro no define la inteligencia. </li></ul><ul><ul><li>Elefante </li></ul></ul><ul><ul><li>Einstein </li></ul></ul><ul><li>Tronco del encéfalo: supervivencia </li></ul><ul><li>Cerebro: procesos adaptativos complejos. </li></ul>
  30. 31. La evolución del cerebro <ul><li>El encéfalo ha aumentado de tamaño. </li></ul><ul><li>El aumento ha sido mas en el cerebro. </li></ul><ul><li>Hay un incremento en la cantidad de circunvoluciones cerebrales. </li></ul>
  31. 32. El cerebro Triuno <ul><li>Paul McLean (1990) </li></ul><ul><li>Expone que el cerebro ha evolucionado. </li></ul><ul><li>Los humanos tenemos tres cerebros en uno. </li></ul><ul><ul><li>Primitivo o Reptiliano (reptiles y aves) </li></ul></ul><ul><ul><ul><li>Tallo Cerebral y Cerebelo. </li></ul></ul></ul><ul><ul><ul><ul><li>Sobrevivencia. </li></ul></ul></ul></ul><ul><ul><li>Intermedio o Sistema Límbico (mamíferos) </li></ul></ul><ul><ul><ul><li>Primitivo + Sistema Límbico. </li></ul></ul></ul><ul><ul><ul><ul><li>Emociones-Paranoia, miedos. </li></ul></ul></ul></ul><ul><ul><li>Neocorteza (primates y humanos) </li></ul></ul><ul><ul><ul><li>Racionalidad. </li></ul></ul></ul>
  32. 33. Los seres humanos son la única especie que tiene consciencia sobre sus conductas.
  33. 34. La Consciencia <ul><li>Percatarse de lo que pasa a través de los sentidos, las emociones, pensamientos y de nuestra propia consciencia. </li></ul><ul><li>La conciencia, definida sencillamente, es el estado de darse cuenta. </li></ul><ul><li>Explícita/Implícita </li></ul>Cortesía Dra. M. Camacho, PUCPR 2005
  34. 35. Niveles de Consciencia <ul><li>Alerta </li></ul><ul><ul><li>Pendiente a estímulos internos y externos </li></ul></ul><ul><li>Letargo o Somnolencia </li></ul><ul><ul><li>No totalmente alerta y muestra de sueño cuando no se estimula activamente. </li></ul></ul><ul><li>Obtundación o confusión </li></ul><ul><ul><li>Difícil de estar pendiente de alertar, y cuando se hace, está confundido. </li></ul></ul><ul><li>Estupor o semicoma </li></ul><ul><ul><li>Solo responde a estimulación persistente o vigorosa. </li></ul></ul><ul><li>Coma </li></ul><ul><ul><li>No reacciona a estimulación. </li></ul></ul>
  35. 36. ¿Cómo funciona la consciencia? <ul><li>Se relaciona con los niveles de atención. </li></ul><ul><li>Requiere de la regulación de todo el sistema nervioso para: </li></ul><ul><ul><li>estar alerta, </li></ul></ul><ul><ul><li>seleccionar el estímulo, </li></ul></ul><ul><ul><li>focalizar en él, y </li></ul></ul><ul><ul><li>sostener la atención </li></ul></ul><ul><li>Envuelve principalmente el Tallo Cerebral, Sistema Límbico y Lóbulo frontal (corteza prefrontal). </li></ul>
  36. 37. La conducta, ¿es genética o aprendida? El dilema vs. Nurture Nature
  37. 38. Herencia vs ambiente <ul><li>Dicotomias tradicionales </li></ul><ul><ul><li>John B. Watson : conductismo </li></ul></ul><ul><ul><li>En contra de la dicotomia: </li></ul></ul><ul><ul><ul><li>Evidencia que cambios psicológicos complejos pueden ser causados por lesiones o estimulaciones cerebrales. </li></ul></ul></ul><ul><ul><ul><li>Algunos animales tienen capacidades que antes se creían que eran únicamente humanas. </li></ul></ul></ul>
  38. 39. Un modelo de la biología de la conducta Evolución Genes Experiencia Organismo en el momento Situación Actual Conducta Actual
  39. 40. Psicología evolucionista <ul><li>Entender la conducta humana considerando las presiones que llevaron a su evolución </li></ul><ul><li>Vínculos del apareamiento: relaciones de apareamiento duraderas. </li></ul><ul><ul><li>El apareamiento es totalmente promiscuo en la mayoría de las especies. </li></ul></ul>
  40. 41. Psicología evolucionista <ul><li>El vinculo de apareamiento se desarrolla por que las hembras mamíferas paren una cantidad relativamente pequeñas de crías indefensas y que se desarrollan lentamente (Trivers, 1972). </li></ul><ul><li>El macho puede traspasar sus características hereditarias. </li></ul>
  41. 42. Psicología evolucionista <ul><li>Poligamia </li></ul><ul><ul><li>Las hembras hacen una mayor aportación en la crianza de las crías. </li></ul></ul><ul><ul><li>Los machos pueden engendrar muchos descendientes. </li></ul></ul><ul><li>Poliandria </li></ul><ul><ul><li>La hembra establece vínculos de apareamiento con más de un macho. </li></ul></ul><ul><ul><li>Los machos contribuyen más a la reproducción. </li></ul></ul>
  42. 43. Psicología evolucionista <ul><li>Monogamia: </li></ul><ul><ul><li>Un macho y una hembra. </li></ul></ul><ul><li>Teoría de la evolución de elección de pareja: (Buss, 1992) </li></ul><ul><ul><li>Los hombres de la mayoría de las culturas valoran la juventud y el atractivo en sus parejas más de lo que lo hacen las mujeres. </li></ul></ul><ul><ul><li>Las mujeres valoran el poder y la capacidad de ingreso económico más que los hombres. </li></ul></ul>
  43. 44. Psicología evolucionista <ul><li>Cont. Teoría de la evolución de elección de pareja: (Buss, 1992) </li></ul><ul><ul><li>El atractivo físico es lo que mejor predice que mujeres se unirán con hombres de alto nivel profesional. </li></ul></ul><ul><ul><li>La principal estrategia de las mujeres para atraer a una pareja es aumentar su atractivo físico. </li></ul></ul><ul><ul><li>La de los hombres, hacer alarde de su poder y sus recursos. </li></ul></ul><ul><ul><li>Los hombres son más propensos que las mujeres a ser adúlteros. </li></ul></ul>
  44. 45. Clase II: Genética y Genética Conductual
  45. 46. Genética <ul><li>El origen de todo ser vivo. </li></ul><ul><li>Estudia las variaciones biológicas (herencia). </li></ul><ul><li>Gregorio Mendel (1865) </li></ul><ul><ul><li>Estudió y estableció las leyes de la herencia. </li></ul></ul><ul><ul><li>Base de la genética: DNA </li></ul></ul><ul><ul><ul><li>Secuencia de aminoácidos que constituyen la información genética, de las células y del organismo. </li></ul></ul></ul><ul><ul><ul><li>Se encuentra en el núcleo de cada célula del cuerpo </li></ul></ul></ul>
  46. 47. Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Genotipo: </li></ul></ul><ul><ul><ul><li>material genético de algún rasgo. </li></ul></ul></ul><ul><ul><li>Fenotipo: </li></ul></ul><ul><ul><ul><li>rasgo observable, producto de un genotipo. </li></ul></ul></ul><ul><ul><li>Estudios con guisantes: </li></ul></ul><ul><ul><ul><li>Rasgos dicotómicos: ocurren de una manera o de otra. </li></ul></ul></ul><ul><ul><ul><li>Líneas reproductoras puras: siempre se produce una descendencia con el mismo rasgo. </li></ul></ul></ul>
  47. 48. Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Estudios con guisantes: </li></ul></ul><ul><ul><ul><li>Rasgos dominantes: se manifiesta en todos los descendientes de la primera generación. </li></ul></ul></ul><ul><ul><ul><li>Rasgos recesivos: se manifiesta alrededor de una cuarta parte de la descendencia de segunda generación. </li></ul></ul></ul>
  48. 49. Genética <ul><li>Mendel propuso que existen dos tipos de factores hereditarios para cada rasgo dicotómico. </li></ul><ul><ul><li>Gen </li></ul></ul><ul><li>Cada organismo posee dos genes para cada uno de sus rasgos dicotomicos. </li></ul><ul><ul><li>alelos </li></ul></ul>
  49. 50. Características heredadas <ul><li>Homocigoto </li></ul><ul><ul><li>Dos genes idénticos para un rasgo </li></ul></ul><ul><ul><li>Por ej. Padre y Madre con pelo lacio. </li></ul></ul><ul><li>Heterocigoto </li></ul><ul><ul><li>Dos genes diferentes para un rasgo </li></ul></ul><ul><ul><li>Por ej. Padre pelo lacio y Madre pelo rizo. </li></ul></ul><ul><li>Uno de los tipos de genes de cada rasgo dicotómico domina al otro en los organismo heterocigóticos. </li></ul>
  50. 51. ADN La información genética se encuentra en una secuencia de aminoácidos, en el núcleo de las células, llamado Ácido Deoxiribonucleico (ADN). Es una estructura de doble hélice con 4 bases nitrogenadas (“base pairs”): Adenina (A) , Guanina (G), Citocina (C) y Timina (T) que parean A-T, T-A y C-G, G-C.
  51. 52. Genes <ul><li>Son la unidad de herencia definidos por la secuencia de bases nitrogenadas y aminoácidos. </li></ul><ul><li>Por ejemplo, la secuencia de un gen podría ser: </li></ul><ul><li>GATGGAATCCGGGCAATGCGGCATGCCACATAGGCTAGCCCTAATCGCGTATTAACCGGCTGCAATGCAAGTACGTACGAATTGAACTTGGCATGAGTTCGTCCAGAACCT </li></ul>
  52. 53. <ul><li>Deficiencias en Genes </li></ul><ul><li>Se pueden dar mutaciones en el orden de la secuencia de bases pares, ya sea por omisión o repetición de las bases. </li></ul><ul><ul><li>Ejemplo 1: GAT CCT AAT se muta si se omite la segunda C : GAT CTA AT </li></ul></ul><ul><ul><li>Ejemplo 2: GAT CCT AAT se muta si se repite la segunda C : GAT CC C TAA T </li></ul></ul>
  53. 54. Cromosoma <ul><li>Estructuras filiformes en el núcleo de la célula. </li></ul><ul><li>Conjunto de la hélice de ADN. </li></ul><ul><li>Hay 23 pares de cromosomas en el humano, 22 pares somáticos y 1 par sexual, llamado XX (mujeres) o XY (hombres). </li></ul>http://genetics.gsk.com/graphics/chromosome.gif http://profiles.nlm.nih.gov/LL/B/B/P/D/_/llbbpd.jpg
  54. 55. Estructura del cromosoma
  55. 56. Algunas Anomalías Cromosómicas
  56. 57. Genoma <ul><li>Todo el material genético contenido en los cromosomas de un organismo. </li></ul><ul><li>El ser humano tiene: </li></ul><ul><ul><li>46 cromosomas </li></ul></ul><ul><ul><ul><li>22 pares somáticos y 1 par sexual </li></ul></ul></ul><ul><ul><li>80,000 a 100,000 genes </li></ul></ul><ul><ul><li>3,000,000 bases nitrogenadas </li></ul></ul>
  57. 58. En resumen…
  58. 59. División Celular <ul><li>Mitosis </li></ul><ul><ul><li>División en células somáticas. </li></ul></ul><ul><ul><li>Producto: 2 células iguales. </li></ul></ul><ul><ul><li>En la fertilización se forma el cigoto. </li></ul></ul><ul><li>Meiosis </li></ul><ul><ul><li>División en células sexuales (gametos) </li></ul></ul><ul><ul><li>Producto: 4 células con mitad de la información genética. </li></ul></ul>
  59. 60. <ul><li>Mitosis </li></ul><ul><li>Profase </li></ul><ul><li>Metafase </li></ul><ul><li>Anafase </li></ul><ul><li>Telofase </li></ul><ul><li>Meiosis </li></ul><ul><li>Profase I </li></ul><ul><li>Metafase I </li></ul><ul><li>Anafase I </li></ul><ul><li>Telofase I </li></ul><ul><li>Metafase II </li></ul><ul><li>Anafase II </li></ul><ul><li>Telofase II </li></ul>Pasos división celular: Mitosis vs. Meiosis
  60. 61. Pasos división celular: Mitosis vs. Meiosis
  61. 63. Genética Conductual <ul><li>Intenta buscar qué diferencias genéticas son responsables (en conjunto con la ambiental) de rasgos y/o conductas de índole psicológicos. </li></ul><ul><li>Francis Galton (1900). </li></ul><ul><ul><li>Genética e inteligencia. </li></ul></ul><ul><ul><li>“ Eugenics”. </li></ul></ul>
  62. 64. EU GENICS ( del griego ) EU = bueno GENICS =generación
  63. 65. Francis Galton: Eugenics <ul><li>Notó que los hijos de las personas inteligentes de su época, también eran inteligentes. </li></ul><ul><li>Decía que por naturaleza, el ser humano buscaba las personas más aptas para procrear y mejorar su progenie (y su especie). </li></ul><ul><li>Nature vs. Nurture </li></ul>
  64. 66. Métodos de investigación en la Genética y Genética Conductual <ul><li>Estudios estadísticos </li></ul><ul><li>Concordancia vs. Discordancia </li></ul><ul><ul><ul><li>Cuán parecido o cuan diferente son los rasgos. </li></ul></ul></ul><ul><li>Estudios con hermanos </li></ul><ul><ul><li>Monozigóticos (MZ) = gemelos idénticos </li></ul></ul><ul><ul><li>Dizigóticos (DZ) = gemelos fraternos </li></ul></ul><ul><li>Estudios: </li></ul><ul><ul><ul><li>Gemelos Idénticos Criados Separados </li></ul></ul></ul><ul><ul><ul><li>Gemelos Idénticos Criados en Conjunto </li></ul></ul></ul><ul><ul><ul><li>Gemelos Fraternos Criados Separados </li></ul></ul></ul><ul><ul><ul><li>Gemelos Fraternos Criados en Conjunto </li></ul></ul></ul><ul><ul><ul><li>Adoptados </li></ul></ul></ul><ul><ul><li>MZ correlaciona a 1.0 y DZ correlaciona a .50 </li></ul></ul>
  65. 67. <ul><li>Estudios Moleculares: </li></ul><ul><li>Polymerase Chain Reaction (PCR) </li></ul><ul><ul><li>Método para amplificar el DNA </li></ul></ul><ul><ul><ul><li>Cromosomal </li></ul></ul></ul><ul><ul><ul><ul><li>kariotipos , FISH </li></ul></ul></ul></ul><ul><ul><ul><li>Mapeo Genético (marcadores genéticos) </li></ul></ul></ul><ul><ul><ul><ul><li>electroforesis </li></ul></ul></ul></ul><ul><ul><ul><li>Secuenciación </li></ul></ul></ul><ul><ul><ul><ul><li>recuento de bases nitrogenadas de los genes. </li></ul></ul></ul></ul>Métodos de investigación en la Genética y Genética Conductual
  66. 68. Condiciones estudiadas <ul><li>Alcoholismo </li></ul><ul><li>Autismo </li></ul><ul><li>ADHD </li></ul><ul><li>Depresión </li></ul><ul><li>Alzheimer </li></ul><ul><li>Ansiedad </li></ul><ul><li>Esquizofrenia </li></ul><ul><li>Y muuuuuchos mas… </li></ul><ul><li>… ..… pero muuuuuuuuuuchos más … </li></ul>
  67. 69. Human Genome Project <ul><li>Human Genome Project </li></ul><ul><ul><li>Esfuerzo internacional que busca identificar todos los genes del genoma humano. </li></ul></ul><ul><li>Además de las características físicas, se han encontrado evidencia de bases genéticas de enfermedades y condiciones. </li></ul><ul><ul><li>Incluye condiciones psiquiátricas. </li></ul></ul>
  68. 70. ¿Qué se hereda? (cont) <ul><li>Se hereda la mitad de la información genética de padre y de madre. </li></ul><ul><li>Los genes pueden estar presentes, pero no implica que se manifieste la característica. </li></ul><ul><ul><li>Los genes se activan e inactivan. </li></ul></ul><ul><li>Si el genotipo está presente, existe la predisposición de presentar una característica. </li></ul>
