1
Short title: Ethylene- and shade-induced stress escape1
Corresponding authors: Rashmi Sasidharan, Ronald Pierik2
Address...
2
ABSTRACT33
Plants have evolved shoot elongation mechanisms to escape from diverse34
environmental stresses such as flood...
3
of the different signalling pathways controlling these traits along with the65
characterization of underlying molecular ...
4
phenotypes (Pierik et al., 2004). However, these responses are mediated by98
ethylene concentrations of a much lower mag...
5
points in both the treatments. Correlation of genome-wide hypocotyl and cotyledon-131
specific transcriptomic changes to...
6
et al., 1997; Fig. 1E), the latter four of which are either prior to start of accelerated164
growth or during it in resp...
7
Interestingly, at 1.5 h, there was more transcriptional regulation in ethylene- than198
shade-exposed hypocotyls even th...
8
Next, a hypergeometric over-representation test for selected MapMan bins (“stress”,229
“hormone”, “signalling”, “RNA.Reg...
9
photomorphogenesis were enriched. The latter is striking given that ethylene does261
not alter the light environment. Th...
10
Both shade and ethylene also significantly induced transcript levels of the bHLH291
transcription factor INCREASED LEAF...
11
Fig. 7B, application of NPA (25 µM) inhibited hypocotyl elongation and also strongly323
reduced staining in the hypocot...
12
hypocotyl elongation control. Although the BR biosynthetic mutant br6ox1 (cyp85a1-356
2) mutant did not show any phenot...
13
Hypocotyl growth promotion and photosynthesis repression occur389
concurrently under ethylene and shade390
By identifyi...
14
themselves would integrate information from the ethylene pathway as well (Park et423
al., 2012; Li et al., 2012). It wa...
15
promotion. Transcriptomics data for 35S:MIF1 (displaying short hypocotyl457
phenotype), shows downregulation of auxin, ...
16
exposed hypocotyls. (Fig. 7). The positive role of GA in flooding-associated shoot490
elongation (Voesenek and Bailey-S...
17
as it inactivates both CS and BL (Neff et al., 1999; Turk et al., 2005). In shade523
avoidance research, likewise, HFR1...
18
ibl1 (N657437), cyp85a1 (N681535), wei8-1 (N16407) and ga20ox1-3 (N669422)555
were obtained from NASC seed-stock centre...
19
Imaging and Hypocotyl Length Measurements589
For hypocotyl elongation assays, experiments were replicated twice. Seedli...
20
Extracted RNA was verified (for quality check) and quantified using NanoDropTM
ND-623
1000 Spectrophotometer (Isogen Li...
21
and accordingly as many clusters were obtained. DEGs were clustered temporally657
based on log2FC.658
659
MapMan bin ov...
22
(22k genes). Accordingly, many locus IDs could not be included (those which were691
newly incorporated in the aragene1....
23
indicated by the use of different letters. All statistical analyses were done in the R725
software environment. Graphs ...
24
753
FIGURE LEGENDS754
Figure 1. Physiological responses, hypocotyl length and epidermal cell length755
kinetics under e...
25
each main sample) into a dendrogram. C, Distribution of differentially expressed785
genes (DEGs) in hypocotyl and cotyl...
26
signalling and cell wall genes after application of a log2fold-change (log2FC) filter.817
Log2FC at the three time-poin...
27
acetic acid; NPA is 1-N-Naphthylphthalamic acid; BRZ is Brassinazole; PBZ is850
Paclobutrazol.851
852
Figure 8. Hypocot...
28
transcription factor, is regulated by PHYTOCHROME‐INTERACTING FACTOR894
1 to promote hypocotyl elongation. New Phytolog...
29
Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act:942
Matching growth with environment by the...
30
Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic992
mechanisms of abiotic stress tolerance that...
31
Pierik, R. and De Wit, M. (2014). Shade avoidance: Phytochrome signalling and1042
other aboveground neighbour detection...
32
Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome1092
in cotyledons regulates the expressio...
33
Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and1141
Guo, H. (2012). A molecular fra...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of...
Parsed Citations
Abdi, H., and Williams, L. J. (2010). Principal component analysis. WileyInterdisciplinaryReviews:Computa...
Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and Estelle, M. (2012). Hypocotyl transcrip...
Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.
Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.
Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.
Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.
Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.
Nächste SlideShare
Wird geladen in …5
×

Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.

71 Aufrufe

Veröffentlicht am

Plants have evolved shoot elongation mechanisms to escape from diverse environmental stresses such as flooding and vegetative shade. The apparent similarity in growth responses suggests possible convergence of the signalling pathways. Shoot elongation is mediated by passive ethylene accumulating to high concentrations in flooded plant organs and by changes in light quality and quantity under vegetation shade. Here we study hypocotyl elongation as a proxy for shoot elongation and delineated Arabidopsis hypocotyl length kinetics in response to ethylene and shade. Based on these kinetics, we further investigated ethylene and shade-induced genome-wide gene expression changes in hypocotyls and cotyledons separately. Both treatments induced a more extensive transcriptome reconfiguration in the hypocotyls compared to the cotyledons. Bioinformatics analyses suggested contrasting regulation of growth promotion- and photosynthesis-related genes. These analyses also suggested an induction of auxin, brassinosteroid and gibberellin signatures and the involvement of several candidate regulators in the elongating hypocotyls. Pharmacological and mutant analyses confirmed the functional involvement of several of these candidate genes and physiological control points in regulating stress-escape responses to different environmental stimuli. We discuss how these signaling networks might be integrated and conclude that plants, when facing different stresses, utilise a conserved set of transcriptionally regulated genes to modulate and fine tune growth.

Veröffentlicht in: Wissenschaft
  • Als Erste(r) kommentieren

  • Gehören Sie zu den Ersten, denen das gefällt!

Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.

  1. 1. 1 Short title: Ethylene- and shade-induced stress escape1 Corresponding authors: Rashmi Sasidharan, Ronald Pierik2 Address: Padualaan 8, 3584 CH, Utrecht, The Netherlands3 Telephone number: +31 30 25368384 Email: r.sasidharan@uu.nl, r.pierik@uu.nl5 6 Ethylene- and shade-induced hypocotyl elongation share transcriptome7 patterns and functional regulators8 Das D.1 , St. Onge K.R.1,2 , Voesenek L.A.C.J.1 , Pierik R.1 * and Sasidharan R.1 *9 *shared senior and corresponding authors10 1 Plant Ecophysiology, Institute of Environmental Biology, Utrecht University, 3584CH Utrecht, The11 Netherlands12 2 Department of Biological Sciences, CW405 BioSci Building, University of Alberta, T6J2E9, Canada13 14 Summary: Ethylene and shade share a conserved set of molecular regulators to15 control plasticity of hypocotyl elongation in Arabidopsis.16 17 AUTHOR CONTRIBUTIONS18 R.P., R.S and L.A.C.J.V. conceived the original research plans and project. R.S.,19 R.P, L.A.C.J.V., K.R.S. supervised the experiments. D.D. performed most of the20 experiments. D.D., K.R.S., R.P. and R.S. designed the experiments. D.D. and21 K.R.S. analyzed the data. D.D. wrote the article with contributions of all the authors.22 FUNDING INFORMATION23 This research was supported by the Netherlands Organisation for Scientific24 Research (grant nos. ALW Ecogenomics 84410004 to L.A.C.J.V., ALW VENI25 86312013 and ALW 82201007 to R.S., ALW VIDI 86412003 to R.P.) and a Utrecht26 University Scholarship to D.D.27 28 CORRESPONDING AUTHOR EMAIL: r.sasidharan@uu.nl, r.pierik@uu.nl29 30 31 32 Plant Physiology Preview. Published on June 21, 2016, as DOI:10.1104/pp.16.00725 Copyright 2016 by the American Society of Plant Biologists www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  2. 2. 2 ABSTRACT33 Plants have evolved shoot elongation mechanisms to escape from diverse34 environmental stresses such as flooding and vegetative shade. The apparent35 similarity in growth responses suggests possible convergence of the signalling36 pathways. Shoot elongation is mediated by passive ethylene accumulating to high37 concentrations in flooded plant organs and by changes in light quality and quantity38 under vegetation shade. Here we study hypocotyl elongation as a proxy for shoot39 elongation and delineated Arabidopsis hypocotyl length kinetics in response to40 ethylene and shade. Based on these kinetics, we further investigated ethylene and41 shade-induced genome-wide gene expression changes in hypocotyls and cotyledons42 separately. Both treatments induced a more extensive transcriptome reconfiguration43 in the hypocotyls compared to the cotyledons. Bioinformatics analyses suggested44 contrasting regulation of growth promotion- and photosynthesis-related genes.45 These analyses also suggested an induction of auxin, brassinosteroid and gibberellin46 signatures and the involvement of several candidate regulators in the elongating47 hypocotyls. Pharmacological and mutant analyses confirmed the functional48 involvement of several of these candidate genes and physiological control points in49 regulating stress-escape responses to different environmental stimuli. We discuss50 how these signaling networks might be integrated and conclude that plants, when51 facing different stresses, utilise a conserved set of transcriptionally regulated genes52 to modulate and fine tune growth.53 54 INTRODUCTION55 All organisms, including plants, assess and respond to both biotic and abiotic factors56 in their environments (Pierik and De Wit, 2014; Pierik and Testerink, 2014; Franklin57 et al., 2011; Quint et al., 2016; Osakabe et al., 2014; Voesenek and Bailey-Serres,58 2015). However, unlike animals, plants, cannot move away from extremes in their59 surrounding environment but rather rely on various plastic morphological and60 metabolic responses. Such response traits include changes in plant architecture to61 escape the stress and optimize resource capture (Pierik and Testerink, 2014;62 Mickelbart et al., 2015). With energy reserves being invested in escape traits, plants63 often have lower plant biomass and crop yield (Casal, 2013). Molecular investigation64 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  3. 3. 3 of the different signalling pathways controlling these traits along with the65 characterization of underlying molecular components would not only enhance66 fundamental knowledge of stress-induced plasticity but also benefit crop67 improvement.68 Plants are highly sensitive to changes in their light environment. Young plants69 growing in a canopy experience changes in light quality and quantity due to70 neighbouring plants and compete to harvest optimum light (Pierik and De Wit, 2014;71 Casal et al., 2013). When a plant cannot outgrow its neighbours, it experiences72 complete vegetation shade (hereafter termed as “shade”) which, in addition to low73 red: far-red (R:FR), is marked by a significant decline in blue light and overall light74 quantity. These changes initiate so-called Shade Avoidance Syndrome (SAS)75 responses consisting of petiole, hypocotyl and stem elongation; reduction of76 cotyledon and leaf expansion; upward movement of leaves (hyponasty), decreased77 branching and increased apical dominance (Vandenbussche et al., 2005; Franklin,78 2008; Casal, 2012; Pierik and De Wit, 2014). Shade-induced elongation comprises a79 complex network of photoreceptor-regulated transcriptional and protein-level80 regulation involving BASIC HELIX LOOP HELIX (BHLH) and HOMEODOMAIN-81 LEUCINE ZIPPER, (HD-ZIP) transcription factors and auxin, gibberellin and82 brassinosteroid hormone genes (Casal, 2012; 2013). Flooding often leads to partial83 or complete submergence of plants. Water severely restricts gas diffusion and the84 consequent limited exchange of O2 and CO2 restricts respiration and photosynthesis.85 Another consequence is the rapid accumulation of the volatile hormone ethylene.86 Ethylene is considered an important regulator of adaptive responses to flooding,87 including accelerated shoot elongation responses that bring leaf tips from the water88 layer into the air (Sasidharan and Voesenek, 2015; Voesenek and Bailey-Serres,89 2015). In deepwater rice, this flooding-induced elongation response involves90 ethylene-mediated induction of members of the group VII Ethylene Response91 Factors (ERF-VII) family, a decline in active abscisic acid (ABA) and consequent92 increase in gibberellic acid (GA) responsiveness and promotion of GA biosynthesis93 (Hattori et al., 2009). In submerged Rumex palustris petioles, ethylene also rapidly94 stimulates cell wall acidification and transcriptional induction of cell wall modification95 proteins to facilitate rapid elongation (Voesenek and Bailey-Serres, 2015). Shade96 cues are reported to enhance ethylene production resulting in shade avoidance97 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  4. 4. 4 phenotypes (Pierik et al., 2004). However, these responses are mediated by98 ethylene concentrations of a much lower magnitude than that occuring in flooded99 plant organs (1µl L-1 ) (Sasidharan and Voesenek, 2015).100 So far, it is largely unknown to what extent these growth responses to such highly101 diverse environmental stimuli, share physiological and molecular components102 through time. A preliminary study in R. palustris showed that GA is a common103 regulator of responses to both submergence and shade (Pierik et al. 2005). Although104 submergence is a compound stress, rapid ethylene accumulation is considered an105 early and reliable flooding signal triggering plant adaptive responses. High ethylene106 concentrations as occur within submerged plant organs, promote rapid shoot107 elongation (Voesenek and Bailey-Serres, 2015). This submergence response, which108 has been extensively characterised in rice and Rumex (Hattori et al. 2009; van Veen109 et al., 2013), can be almost completely mimicked by the application of saturating (1µl110 L-1 ) ethylene concentrations (Sasidharan and Voesenek, 2015). Saturating ethylene111 concentrations were therefore used here as a submergence mimic. Shade was given112 as true shade which combines the three known key signals that trigger elongation113 (red and blue light depletion with relative far-red enrichment).114 A hypocotyl elongation assay in Arabidopsis thaliana (Col-0) was used as a proxy for115 shoot elongation under ethylene and shade in order to study to what extent ethylene116 and shade responses share molecular signalling components. Although ethylene117 suppresses Arabidopsis hypocotyl elongation in dark, high ethylene concentrations118 in light (as occurs during submergence) stimulate hypocotyl elongation in119 Arabidopsis (Smalle et al., 1997; Zhong et al., 2012). Also upon simulated shade,120 Arabidopsis demonstrates pronounced hypocotyl elongation (Morelli and Ruberti,121 2000). To capture early physiological responses and gene expression changes in122 response to ethylene and shade, Arabidopsis seedling hypocotyl elongation and123 cotyledon expansion were examined over time. The two treatments elicited124 characteristic hypocotyl growth kinetics. To uncover the transcriptomic changes125 regulating the elongation response to these signals, an organ-specific genome-wide126 investigation was carried out on hypocotyls and cotyledons separately at three time-127 points corresponding to distinct hypocotyl elongation phases. Clustering analyses in128 combination with biological-enrichment tests allowed identification of gene clusters129 with expression patterns matching the hypocotyl growth trends across the three time-130 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  5. 5. 5 points in both the treatments. Correlation of genome-wide hypocotyl and cotyledon-131 specific transcriptomic changes to publicly available microarray data on hormone132 treatments identified enriched hormonal signatures of auxin, brassinosteroid and133 gibberellin in hypocotyl tissues and several potential growth regulatory candidate134 genes. Using hormone mutants and chemical inhibitors, we confirmed the combined135 involvement of these hormones and candidate regulators in the hypocotyl elongation136 response to ethylene and shade. We suggest that growth responses to diverse137 environmental stimuli like ethylene and shade converge on a common regulatory138 module consisting of both positive and negative regulatory proteins that interact with139 a hormonal triad to achieve a controlled fine-tuned growth response.140 141 142 RESULTS143 Delineation of hypocotyl elongation kinetics under ethylene and shade in144 Arabidopsis seedlings145 Exogenous application of ethylene (1 µl L-1 ) in light-grown seedlings resulted in thick,146 yet elongated hypocotyls and smaller cotyledons as compared to untreated controls.147 Shade, achieved by the use of a green filter, stimulated strong hypocotyl elongation148 in seedlings but resulted in mildly smaller cotyledons compared to controls (Fig. 1A).149 Hypocotyl length increments in the two treatments relative to control were around 2-150 fold under ethylene and greater than 3-fold under shade (Figs. 1, A and B). For both151 treatments growth stimulation was strongest in the first two days of treatment (Fig.152 1C) and faded out in the subsequent days. When combined, shade and ethylene153 exposure resulted in hypocotyl lengths that were intermediate to the individual154 treatments (Supplemental Fig. S1).155 To get a more detailed time-line of the early elongation kinetics, we performed a156 follow-up experiment with 3 h measurement intervals for the first 33 h (Fig. 1D).157 Ethylene-mediated stimulation of hypocotyl elongation started only in the middle of158 the dark period after 15 h. However, under shade, longer hypocotyls were recorded159 already after 3 h and this rapid stimulation continued until the start of the dark period.160 Interestingly, accelerated elongation was again observed at around 24 h after the161 start of the treatments (when the lights were switched on). Based on this time-line,162 we determined epidermal cell lengths at time-points 0, 3, 7.5, 15 and 27 h (Gendreau163 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  6. 6. 6 et al., 1997; Fig. 1E), the latter four of which are either prior to start of accelerated164 growth or during it in response to ethylene and shade. The rapid stimulation of165 elongation under shade starts at the base of the hypocotyl (3 h) and then progresses166 all along the hypocotyl with maximum elongation occurring in the middle segment167 while under ethylene accelerated elongation is observed at the middle-bottom of168 hypocotyl (27 h).169 170 Organ-specific transcriptomics in hypocotyl and cotyledon under ethylene and171 shade172 The transcriptome response to ethylene and shade in hypocotyl and cotyledon173 tissues was characterised using Affymetrix Arabidopsis Gene 1.1 ST arrays at three174 time points of hypocotyl length kinetics (1.5 h, 13.5 h and 25.5 h) (Fig. 1D). Principal175 component analysis (PCA) (Abdi and Williams, 2010) of all replicate samples for176 hypocotyl and cotyledon exposed to control, ethylene or shade conditions showed177 that replicate samples generally clustered together (Fig. 2A). The first principal178 component (34.2%) separates tissue-specific samples, whereas the second principal179 component (13.0%) showed separate clustering of the 13.5h samples which falls180 during the dark period.181 Hierarchical clustering (HC) (Eisen et al., 1998) of mean absolute expression182 intensities for the different main samples (combination of 3 replicates) revealed183 similar trends (Fig. 2B). Fig. 2C shows the distribution of up- and down-regulated184 differentially expressed genes (DEGs) (genes with adjusted p-value ≤ 0.01) in185 hypocotyl and cotyledon for ethylene and shade at the three harvest time points 1.5186 h, 13.5 h, 25.5 h respectively. In both the conditions and tissues, the number of both187 up- and down-regulated DEGs increased with time. Ethylene regulated substantially188 more DEGs in the hypocotyl as compared to shade at all harvest time points (Fig.189 2C). Data analysis identified 6668 and 4741 genes (hereafter termed as “total190 DEGs”) that were differentially expressed in hypocotyl at one or more of the three191 tissue harvest time points by ethylene and shade respectively. Interestingly, in the192 cotyledon, at 1.5 h, the number of significant DEGs under ethylene was higher than193 under shade but at the subsequent two time points, shade regulated more genes. In194 the cotyledon, 1197 and 2173 DEGs were identified that were differentially195 expressed at one or more of the three tissue harvest time points by ethylene and196 shade respectively.197 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  7. 7. 7 Interestingly, at 1.5 h, there was more transcriptional regulation in ethylene- than198 shade-exposed hypocotyls even though subsequent hypocotyl elongation was much199 more rapid in shade (Figs. 2C and 1D). For ethylene-specific downregulated DEGs200 at 1.5 h, the topmost enriched GO term was cell wall organization (containing 30201 genes), which suggested a repression of growth-promoting genes and possible lack202 of ethylene-mediated elongation at 1.5 h (Supplemental Fig. S2). We also found 6203 genes (AT1G65310, XYLOGLUCAN ENDOTRANSGLUCOSYLASE / HYDROLASE204 17 (XTH17); AT5G23870, pectin acetyl esterase; AT3G06770, glycoside hydrolase;205 AT5G46240, POTASSIUM CHANNEL IN ARABIDOPSIS THALIANA 1 (KAT1);206 AT1G29460, SMALL AUXIN UPREGULATED RNA 65 (SAUR65) and AT3G02170,207 LONGIFOLIA 2 (LNG2)) in the shade-specific upregulated 32 genes at 1.5 h, with208 implied cell expansion roles and could possibly be associated with the rapid209 elongation response (Sasidharan et al., 2010; Philippar et al., 2004; Nozue et al.,210 2015; Chae et al., 2012; Lee et al., 2006).211 212 Different gene expression clusters contributing to hypocotyl growth in213 ethylene and shade214 In order to find specific genes regulating the elongation phenotype under both215 treatments, we used temporal clustering of DEGs based on expression values. Due216 to distinct hypocotyl length kinetics in response to ethylene and shade (Fig. 1D), we217 searched for a set of temporally co-expressed genes that could potentially contribute218 to this treatment-specific kinetics. Time-point based clustering was performed for the219 6668 ethylene and 4741 shade total DEGs based on the positive or negative220 magnitude of log2FC for DEGs at the three time points (Fig. 3, A and D). The gene221 expression patterns in clusters-1 and 5 across the three time points matched the222 ethylene hypocotyl growth kinetics closely (Fig. 3, B and C). Similarly, gene223 expression kinetics in clusters-1 and 3 matched the hypocotyl length kinetics in224 shade (Fig. 3, E and F). These growth pattern matching clusters were termed225 “positive”. All the clusters with mirror image of gene expression profiles to that of the226 positive clusters (clusters-8 and 4 in ethylene and clusters-8 and 6 in shade) were227 termed as “negative” clusters.228 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  8. 8. 8 Next, a hypergeometric over-representation test for selected MapMan bins (“stress”,229 “hormone”, “signalling”, “RNA.Regulation of transcription” and “cell wall”) was carried230 out for the temporal gene clusters (Fig. 3G). Interestingly, “cell wall”, “hormone” and231 “signalling” were highly co-enriched in positive clusters (cluster-1 and 5 for ethylene232 and cluster-1 for shade) which hints at co-regulation of genes mapped to these terms233 during transcriptomic response to ethylene and shade in the hypocotyl.234 To identify growth promotion related DEGs, we identified DEGs common to both the235 treatments in the clusters previously designated as ‘positive’ and ‘negative’ clusters236 (Fig. 3, H and I). 997 DEGs were obtained from a venn diagram between the237 treatment-specific positive clusters, upregulated at atleast two time-points, and238 hereafter called “Common Up”. Similarly, 824 DEGs were shared between ethylene239 and shade negative clusters, were downregulated at atleast two time points and240 hereafter called “Common Down”.241 Enriched functional categories in the different gene sets from Venn diagrams of242 positive and negative clusters, were identified using the GeneCodis tool (Tabas-243 Madrid et al., 2012) (Fig. 4). In the Common Up set, we found a variety of growth244 associated GO categories including cell wall modification, hormone (auxin and245 brassinosteroid) signaling and metabolism, transport processes, tropisms, response246 to abiotic stimuli and signal transduction. The ethylene-specific set for positive247 clusters was enriched for ethylene-associated terms as expected, but also for248 various sugar metabolic, endoplasmic reticulum (ER)-related and protein post-249 translational modification-related processes. Some of the enriched GO terms in the250 ethylene-specific set for positive clusters were also found in the Common Up set, but251 caused by different genes in the same GO category, including those associated with252 growth, hormones and transport processes. The shade-specific set for positive253 clusters showed only few clear GO enrichments such as trehalose metabolism,254 secondary cell wall biogenesis and amino acid metabolism, but also shared some255 with the Common Up set like shade avoidance and protein phosphorylation and with256 both Common Up and ethylene-specific set for positive clusters, such as response to257 auxin and unidimensional growth.258 In the Common Down set, GO terms associated with photosynthesis, primary and259 secondary metabolism, response to biotic and abiotic stress, as well as260 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  9. 9. 9 photomorphogenesis were enriched. The latter is striking given that ethylene does261 not alter the light environment. The ethylene-specific set for negative clusters262 included strong enrichment of circadian rhythm and a variety of photosynthesis-and263 chloroplast-associated GO terms, partially shared with the Common Down set. In the264 shade-specific set for negative clusters, flavonoid/anthocyanin biosynthesis and265 response to UV-B and heat were enriched. The shade-specific set for negative266 clusters shared terms from defence-associated GO categories and cadmium, karrikin267 response with Common Down set. Terms common to all three sets of negative268 clusters were related to photomorphogenesis and metabolic process.269 270 Functional characterization: shared components in ethylene -and shade-271 mediated regulation of hypocotyl length272 We classified Common Up and Down set genes into transcriptional regulators,273 hormone metabolism genes, signalling genes and cell wall genes and also applied a274 logFC filter (see “Materials and Methods” sub-section “LogFC Filter and Gene275 Classification”) to obtain a final list of 53 and 8 genes in the two sets respectively276 (Fig. 5, A and B). We selected a subset of candidate regulators for functional testing277 and made sure to include two transcription factors since these may be relatively278 upstream in the convergence of signaling pathways. Obvious targets for these279 regulators would be different plant hormones, and before zooming in on these, we280 ran a hormonometer analysis with our transcriptome data to further subset our281 candidate regulators.282 283 Transcription factor candidates:284 ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 28 (ATHB28) is a zinc-finger285 homeodomain (ZF-HD) transcription factor that showed upto 2-fold induction in the286 hypocotyls in ethylene and shade respectively. A homozygous null mutant287 (Supplemental Fig. S3, A-D), “athb28”, showed a significant reduction in hypocotyl288 lengths under both ethylene and shade (Fig. 6A), consistent with its induction upon289 both the treatments.290 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  10. 10. 10 Both shade and ethylene also significantly induced transcript levels of the bHLH291 transcription factor INCREASED LEAF INCLINATION1 BINDING bHLH1 like-1292 (IBL1) Arabidopsis hypocotyls. However, the ibl1 (SALK T-DNA insertion line)293 showed wild-type responses to the treatments (Fig. 6B). The bHLH transcription294 factors IBL1 and its homolog IBH1 have been implicated in repressing BR-mediated295 cellular elongation. In an ibl1 mutant, IBH1 is still present and may negatively296 regulate cell elongation independently of IBL1. The 35S overexpression line, IBL1OE297 (Zhiponova et al., 2014), had shorter hypocotyls than the wild-type under control298 conditions. IBL1OE also lacked ethylene and shade-induced hypocotyl elongation299 implying an inhibitory role for IBL1 (Fig. 6C).300 301 Hormone candidates: auxin, brassinosteroid and gibberellin302 To further investigate the significant hormone related changes amongst the growth303 related DEGs we analysed our data using Hormonometer (Volodarsky et al., 2009).304 For both treatments, the hormonal signatures across the three time-points for BR305 and GA most closely matched the hypocotyl elongation kinetics (Figs. 1D and 7A).306 The analysis also showed significant correlations with auxin responses for all data307 sets.308 In the Common Up set 49 genes were present that were all also auxin-regulated,309 whereas there were 14 that were also BR-regulated. In the Common Down set 16310 genes were present that can be regulated by auxin, 16 that can also be ABA-311 regulated and 13 genes that are also JA-regulated. Interestingly, there were no312 genes for BR in the Common Down set. In addition, genes involved in auxin-313 conjugation genes (GRETCHEN HAGEN 3 FAMILY PROTEIN 3.17 (GH3.17) and314 AT5G13370), GA catabolising genes (GIBBERELLIN 2 OXIDASE (GA2OX) 2,315 GA2OX4 and GA2OX7) and JA augmenting genes (LIPOXYGENASE (LOX) 1,316 LOX2 and LOX3) were down-regulated.317 In order to test the possible role of auxin, GA and BR, in mediating shade and318 ethylene-induced hypocotyl elongation, we first tested the effects of pharmacological319 inhibitors of these hormones on shade and ethylene-induced hypocotyl elongation.320 To visualize the auxin effect we treated the pIAA19:GUS auxin response marker line321 with the auxin transport inhibitor, 1-N-Naphthylphthalamic acid (NPA). As shown in322 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  11. 11. 11 Fig. 7B, application of NPA (25 µM) inhibited hypocotyl elongation and also strongly323 reduced staining in the hypocotyl region. This inhibition was rescued by IAA (10 µM).324 The auxin perception inhibitor, α-(phenylethyl-2-one)-indole-3-acetic acid, PEO-IAA325 (100 µM), strongly reduced staining in the whole pIAA19:GUS seedling and inhibited326 elongation in response to both treatments. The significant inhibition of ethylene and327 shade-induced hypocotyl elongation by the different auxin inhibitors is quantitated in328 Fig. 7,C-E. The addition of NPA, yucasin (auxin biosynthesis inhibitor) and α-329 (phenylethyl-2-one)-indole-3-acetic acid (PEO-IAA; auxin antagonist) inhibited330 hypocotyl elongation under both the treatments confirming that all three aspects of331 auxin are required for ethylene- and shade-induced hypocotyl elongation. BR332 biosynthesis inhibitor brassinazole (BRZ) and GA biosynthesis inhibitor paclobutrazol333 (PBZ) fully inhibited these elongation responses as well (Fig. 7, F and G).334 To further validate the involvement of auxin, BR and GA in ethylene and shade-335 induced hypocotyl elongation we tested hypocotyl elongation responses in a variety336 of hormone mutants, including mutants for candidate genes from Figure 5.337 Both the auxin receptor (tir1-1) and biosynthesis (wei8-1) mutants showed338 significantly impaired hypocotyl elongation responses compared to the wild type339 ethylene and shade response (Fig. 8, A and B). A similar effect was seen in the340 auxin transport mutant pin3pin4pin7 which had severely reduced hypocotyl341 elongation in both treatments (Fig. 8C).342 The GA biosynthesis (ga1-3) and insensitive (gai) mutant both showed a complete343 lack of hypocotyl elongation in both treatments (Fig. 8, D and E). We also tested the344 GA biosynthesis mutant ga20ox1-3, since it was identified as a ‘common Up’ gene,345 induced in response to both treatments (Fig. 5A). The ga20ox1-3 mutant showed a346 significantly reduced elongation phenotype in both treatments compared to the wild347 type response (Fig. 8F).348 The BR receptor (bri1-116) and biosynthesis (dwf4-1) mutants both showed severe349 hypocotyl elongation phenotypes, and did not respond to either treatment (Fig. 8, G350 and I). In another biosynthesis mutant, rot3-1, while the ethylene elongation351 response was absent there was a severely reduced shade response (Fig. 8H). Two352 BR-metabolism related genes were identified in the common Up set (Fig. 5A):353 BR6OX1 and BAS1. The bas1-2 mutant showed constitutive elongation in all354 treatments ((Fig. 8J) confirming a negative role of BR catabolism through BAS1 in355 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  12. 12. 12 hypocotyl elongation control. Although the BR biosynthetic mutant br6ox1 (cyp85a1-356 2) mutant did not show any phenotypic alteration (Fig. 8K), a double mutant of357 BR6OX1 and BR6OX2 (cyp85a1cyp85a2) showed a complete lack of elongation in358 response to both ethylene and shade (Fig. 8L).359 360 361 Discussion362 Accelerated shoot elongation is a common mode of stress escape that allows plants363 to grow away from stressful conditions (Pierik and Testerink, 2014). Stress escape364 does, however, come at an energetic cost and is only beneficial if improved365 conditions are achieved. Here our goal was to establish to what extent shade and366 ethylene elicit similar responses through shared or distinct molecular pathways. In367 our study we found distinct elongation kinetics in ethylene and shade for Arabidopsis368 hypocotyls, differing in both temporal regulation and the degree of response. Shade369 treatment evoked a rapid, strong and persisting hypocotyl elongation, whereas370 ethylene initially inhibited elongation and only in the first night period started to371 promote hypocotyl length (Fig. 1). In both treatments, hypocotyl growth involved372 enhanced epidermal cell elongation. Previous studies have shown that low R:FR373 induces ethylene biosynthesis in Arabidopsis (Pierik et al., 2009) and it could be374 argued that the shade response might act through ethylene. However, ethylene375 marker genes were not induced in shade, and the ethylene-insensitive ein3eil1376 mutant retained a full response to shade (Supplemental Fig. S4), ruling out a role for377 ethylene in the shade response. Interestingly, combining shade and ethylene378 treatments did not lead to an additive response and instead dampened shade-379 induced hypocotyl elongation (Supplemental Fig. S1). The growth inhibitory effect of380 ethylene under shaded conditions could function similar to its effects in limiting381 hypocotyl elongation in the dark i.e. via induction of negative growth regulators such382 as ERF1 (Zhong et al., 2012). Transcriptome characterisation of the elongating383 hypocotyl upon exposure to single shade and ethylene stresses indicated384 considerable overlap between the two treatments. Thus, a large portion of DEGs385 under both treatments may contribute to similar processes implying that they target386 shared genetic components but have treatment-specific upstream regulatory factors.387 388 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  13. 13. 13 Hypocotyl growth promotion and photosynthesis repression occur389 concurrently under ethylene and shade390 By identifying gene clusters with expression patterns closely matching the distinct391 ethylene and shade growth kinetics, we identified positive and negative clusters for392 the respective treatments. These clusters were also among the bigger clusters that393 contributed to most of the transcriptomic changes, suggesting that a large part of394 transcriptomic response are associated with the hypocotyl growth and concurrent395 biological processes. Functional enrichment analysis for the Common Up set (shared396 between positive clusters of ethylene and shade) (Fig. 4), suggested an involvement397 of growth promoting genes. Cell wall genes are all involved in mediating cellular398 expansion in growing hypocotyls. However, they need to be controlled by either the399 environmental signal directly or by upstream factors in the signal transduction400 pathway. The Common Down set (shared between negative clusters of ethylene and401 shade) (Fig. 4), was highly enriched in photosynthesis-related terms and proteins.402 The effects of ethylene on photosynthesis can be positive or negative depending on403 the context (Iqbal et al., 2012; Tholen et al., 2007). Low R:FR treated stems of404 tomato showed reduced expression of photosynthetic genes (Cagnola et al., 2012).405 This reduction was mainly due to a decrease in expression of Calvin cycle genes,406 which we also observed for our Common Down set (Supplemental Table S1). In407 addition, under ethylene specifically, Photosystem II and I genes were mostly408 repressed. Thus acceleration of hypocotyl elongation is accompanied by repression409 of genes associated with non-elongation processes like metabolism and410 photosynthesis. This was also shown to be true for low R:FR treated elongating411 stems of tomato (Cagnola et al., 2012). Light capture and carbon fixation are412 minimized and energy is apparently invested in stimulating growth (Sulpice et al.,413 2014; Henriques et al., 2014; Lilley et al., 2012). It would be interesting to investigate414 how photomorphogenic responses are associated with and influence photosynthesis415 and growth promotion.416 417 Convergence of signaling pathways in response to ethylene and shade in418 control of hypocotyl elongation419 In shade avoidance responses, photoreceptors like phyB and cry1/2 would regulate420 the elongation phenotype via control of Phytochrome Interacting Factor (PIF) levels.421 However, since these are photoreceptors, it seems unlikely that these proteins422 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  14. 14. 14 themselves would integrate information from the ethylene pathway as well (Park et423 al., 2012; Li et al., 2012). It was shown by van Veen et al. (2013), that in the424 submerged petioles of R. palustris (which displays petiole elongation under complete425 submergence), early molecular components of light signalling (KIDARI, COP1, PIFs,426 HD-ZIP IIs) are induced by ethylene independently of any change in light quality.427 Over expression of PIF5 on the other hand leads to increased ethylene production in428 etiolated Arabidopsis seedlings, causing inhibition of hypocotyl length (Khanna et al.,429 2007). Interestingly, the downstream ethylene signal transduction protein EIN3 was430 shown to physically interact with PIF3 (Zhong et al., 2012). We, therefore, suggest431 that ethylene and shade might both induce this shared gene pool by, for example,432 targeting (different) members of the PIF family of transcription factors. Since different433 PIFs likely regulate the expression of at least partly shared target genes (Leivar and434 Monte, 2014), this would explain our observed partial overlap in the transcriptional435 response to shade and ethylene. PIFs are also known to directly bind and regulate436 expression of other transcription factors like homeodomain (HD) TFs (Capella et al.,437 2015; Kunihiro et al. 2011) in the control of shade avoidance responses. Indeed, our438 TAIR motif analysis hinted towards the presence of significantly enriched binding439 signatures of PIF/MYC proteins (CACATG) as well as HD proteins (TAATTA) in the440 upstream promoter sequences of the Common Up set genes (Pfeiffer et al., 2014;441 Kazan and Manners, 2013; Supplemental Fig. S5).442 Several potential transcriptional regulators were identified in the narrowed down443 Common Up gene set. A growth-promoting role of KIDARI in regulating elongation in444 response to shade and ethylene was suggested previously (Hyun and Lee 2006; van445 Veen et al., 2013). Upregulation of another bHLH encoding gene and a negative446 regulator of elongation, IBL1 was observed for both treatments (Fig. 6C)). While447 PIF4 induces IBH1 and IBL1, IBH1 represses PIF4 targets (Zhiponova et al., 2014).448 IBH1 and its homolog IBL1 collectively regulate expression of a large number of BR-,449 GA- and PIF4-regulated genes and this might their mode of action in shade- and450 ethylene-induced hypocotyl elongation. In addition to these bHLH proteins, we show451 that the ZF-HD transcription factor ATHB28 is also involved in regulating hypocotyl452 elongation under ethylene and shade (Fig. 6A). Hong et al. (2011) showed that453 another ZF-HD protein, MIF1 interacts strongly with four other ZF-HD proteins454 including ATHB33 and ATHB28. This leads to non-functional MIF1-ATHB455 heterodimers and inhibition of e.g. ATHB33-regulated expression and growth456 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  15. 15. 15 promotion. Transcriptomics data for 35S:MIF1 (displaying short hypocotyl457 phenotype), shows downregulation of auxin, BR and GA responsive genes and458 upregulation of ABA genes (Hu and Ma, 2006). We can speculate that MIF1 on one459 hand and ATHB33 and ATHB28 on the other hand, might target the same set of460 hormone genes, but in an opposite manner, to control growth. What remains to be461 studied is how ethylene and shade regulate ZF-HD transcription factors and this will462 be an important topic for future studies.463 Well-established targets for above-mentioned PIFs and HD TFs are various aspects464 of auxin signalling and homeostasis, such as YUCCA biosynthetic enzymes and465 AUX/IAA proteins for signalling (Kunihiro et al. 2011; Li et al., 2012; Sun et al., 2012;466 De Smet et al., 2013). Our list of candidate genes (Fig. 5) contained auxin-467 responsive transcriptional regulator IAA3 and many of the auxin-responsive SAUR468 genes which have been shown to positively modulate hypocotyl elongation (Kim et469 al., 1998; Sun et al., 2012; Chae et al., 2012; Spartz et al., 2012) and may act470 individually or in concert to regulate the phenotype. With reference to elongation471 responses under shade in Arabidopsis seedlings, auxin seems to play a major role.472 An increase in free auxin levels and its transport towards epidermal cells in hypocotyl473 is necessary for low R:FR-mediated hypocotyl elongation (Tao et al., 2008;474 Keuskamp et al., 2010; Zheng et al., 2016). The importance of YUCCAs and TAA1 in475 low R:FR responses has been previously demonstrated (Li et al., 2012). It is476 generally assumed that auxin synthesized in the cotyledons is required to regulate477 hypocotyl elongation in response to e.g. low R:FR light conditions (Procko et al.478 2014). Indeed, cotyledons are key regulators of hypocotyl elongation in a479 phytochrome-dependent way (Endo et al., 2005; Warnasooriya and Montgomery,480 2009; Estelle, 1998; Tanaka et al., 2002). In our data, hormonometer analysis481 identified strong induction of auxin-associated genes in the cotyledons in both482 treatments (Fig. 7). We speculate that the physiological regulation of hypocotyl483 elongation in our study depends on cotyledons via auxin dynamics. However, we484 also show that auxin is certainly not the only shared physiological regulator between485 the ethylene and shade response.486 GA20OX1 and BR6OX1 expression were up-regulated in patterns that closely487 matched the hypocotyl elongation profiles (Fig. 5A), and hormonometer analysis also488 revealed enrichment of GA and BR hormonal signatures in ethylene and shade489 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  16. 16. 16 exposed hypocotyls. (Fig. 7). The positive role of GA in flooding-associated shoot490 elongation (Voesenek and Bailey-Serres, 2015) and shade avoidance (Djakovic-491 Petrovic et al., 2007) is well established. It is well known that GA20OX1 specifically492 affects plant height without having any other major phenotypic effects (Barboza et493 al., 2013; Rieu et al., 2008), and it has been shown to be involved in shade494 avoidance (Nozue et al. 2015; Hisamatsu et al. 2005). In our data, ga20ox1 knockout495 showed reduced elongation to shade as well as ethylene, extending its function from496 controlling shade avoidance to ethylene mediated elongation responses (Fig. 8F).497 GA biosynthesis via GA20OX1 can be induced by brassinosteroids, suggesting a498 possible cross-talk between the two growth-promoting hormones (Unterholzner et499 al., 2015). Although future studies are needed to establish if this crosstalk occurs500 under the conditions tested here, we do confirm that BR is an important hormone501 involved in both the responses since several BR mutants showed disturbed502 elongation responses to ethylene and shade (Fig. 8G-8L). Interestingly, also auxin503 and brassinosteroids have partially overlapping roles in hypocotyl elongation control504 (Chapman et al., 2012; Nemhauser et al., 2004), further extending the crosstalk505 towards a tripartite network. Among the BR mutants tested is the cyp85a1cyp85a2506 mutant, encoding a double mutant for BR6OX2 and BR6OX1 which showed a507 complete lack of elongation to both treatments (Fig. 8L) similar to a BRZ treatment508 (Figs. 7F). BR6OX1 was one of the direct candidate genes identified from the509 transcriptomics analysis (Figure 5A). A tripartite bHLH transcription factor module510 consisting of IBH1, PRE and HBI1, has been previously implicated in regulating cell511 elongation in response to hormonal and environmental signals (Bai et al., 2012).512 Several BR biosynthesis and signaling genes are direct targets of HBI1, including513 BR6OX1 (Fan et al. 2014), indicating the possible involvement of this bHLH514 regulatory module in promoting BR responses during shade and ethylene exposure.515 Why is there be such an elaborate network of regulators and even hormones516 involved in controlling unidrectional cell expansion in hypocotyl growth responses?517 To achieve a controlled growth, feedback loops are likely required, and crosstalk518 between different routes are probably a necessity to deal with multiple environmental519 inputs simultaneously. We found BAS1 transcriptional upregulation in hypocotyls in520 response to ethylene and shade. BAS1 may act to balance the hypocotyl growth521 promotion mediated by brassinosteroids (castasterone (CS) and brassinolide (BL))522 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  17. 17. 17 as it inactivates both CS and BL (Neff et al., 1999; Turk et al., 2005). In shade523 avoidance research, likewise, HFR1 is induced by PIFs to suppress the growth524 promotion induced the same PIF proteins, and putative control of DELLAs would525 modulate GA responses.526 Conclusion527 Hypocotyl elongation in response to ethylene and shade treatments is likely528 regulated at the upstream level by (a) a bHLH module consisting of positive growth529 regulators, PIFs (PIF3 in ethylene and PIF4 and PIF5 in shade) and inhibitory factors530 like IBL1 and (b) a homeodomain module, where ZF-HD TFs like ATHB28 may531 either act in parallel to the bHLH TFs or are regulated by PIFs (similar to induction of532 HD-ZIP TFs) to transcriptionally target genes related to the growth promoting533 hormone module (auxin, BR and GA), as hinted by promoter motif analysis. We534 hypothesize that in Arabidopsis seedlings, shade and ethylene stimulate auxin535 synthesis in the cotyledons, which is then transported to the hypocotyl to epidermal536 cell layers where it interacts with both GA and BR to co-ordinately induce hypocotyl537 elongation. This increased auxin response, indicated by elevated SAUR levels, and538 likely increased levels of GA and BR as indicated by increased GA20OX1 and539 BR6OX expression in the hypocotyl, likely act to induce unidirectional epidermal cell540 wall elongation via upregulation of genes encoding cell-wall modifying proteins,541 which promote cellular expansion leading to hypocotyl elongation.542 543 MATERIALS AND METHODS544 Plant Material and Growth Conditions545 Around 30 Arabidopsis thaliana (Col-0) and mutant seeds were sown per agar plate546 containing 1.1 g L-1 Murashige-Skoog (1/4 MS) and 8 g L-1 Plant-agar (0.8%w/v)547 (both Duchefa Biochemie, The Netherlands). Mutants or overexpression lines used548 in this work were: pin3pin4pin7 (Blilou et al., 2005); wei8-1 (Stepanova et al., 2008),549 tir1-1 (Ruegger et al., 1998), dwf4-1 (Azpiroz et al., 1998), rot3-1 (Kim et al., 1998),550 ga1-3 (Wilson et al., 1992), gai (Talon et al., 1990), ein3eil1 (Binder et al., 2004);551 bri1-116 (van Esse et al., 2012); ibl1 and IBL1OE (Zhiponova et al., 2014);552 cyp85a1/cyp85a2 and cyp85a1-2 (Nomura et al., 2005); bas1-2 (Turk et al., 2005);553 ga20ox1-3 (Hisamatsu et al., 2005).554 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  18. 18. 18 ibl1 (N657437), cyp85a1 (N681535), wei8-1 (N16407) and ga20ox1-3 (N669422)555 were obtained from NASC seed-stock centre; bri1-116 was kindly provided by Sacco556 de Vries Lab, Wageningen University while cyp85a1/cyp85a2 and dwf4-1 were557 kindly provided by Sunghwa Choe Lab, Seoul National University. IBL1OE558 overexpression lines were kindly provided by the Jenny Russinova lab (VIB Ghent,559 Belgium). bas1-2 mutant was kindly provided by Michael Neff lab (Washington State560 University, USA). Some GA mutants used were in the Ler background. All other561 mutants were in the Col-0 background. After stratification at 4°C for 3 d in the dark,562 seeds were transferred for 2 h to control light conditions (see below) and then kept in563 dark (at 20°C) again for another 15 h. Subsequently seedlings were allowed a period564 of 24 h growth under control light conditions in Short-Day photoperiod conditions (15565 h dark/9h light) before being transferred to 22.4 L glass desiccators with air-tight lids566 for specific treatments. Col-0 genotypes were grown at 21 ± 1 °C. Ler genotypes567 were grown at 19 ± 1 °C (Supplemental Figure S6).568 For athb28 (GK-326G12), lines were obtained from NASC (UK). Genotyping was569 performed using the following primers: for athb28, athb28_fwd570 (CTAAGTACCGGGAATGTCAGAAG); athb28_rev (TAACCAACTGAGCTATTCC571 AGCTA) and LB primer o8474: (ATAATAACGCTG CGGA CATCTACATTTT). For572 verifying transcript levels, ATHB28_fwd (GGAGAAGATGAAGGAATTTGCA) and573 ATHB28_rev (TGTTTCTCTTCA TTGCTTGCT) were used.574 575 Treatments576 Control and ethylene desiccators were kept in control light conditions577 (Photosynthetically Active Radiation, PAR = 140 μmol m-2 s-1 , blue light (400 nm-500578 nm) = 29 μmol m-2 s-1 and R:FR = 2.1). Ethylene treatments were started by injecting579 ethylene into the desiccators (with 1 µl L-1 final concentration in the dessicator) and580 levels were verified with a Gas Chromatograph (GC955; Synspec, The Netherlands).581 Shade treatment was started by putting desiccators under a single layer of Lee Fern582 Green Filter (Lee Hampshire, UK) (PAR = 40 μmol m-2 s-1 , blue light (400 nm-500583 nm) = 3 μmol m-2 s-1 and R:FR = 0.45). For growth curve experiments, two plates584 with 15 seedlings per treatment per genotype distributed over two desiccators were585 used. For mutant analyses, one plate with 15 seedlings per treatment per genotype586 was used.587 588 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  19. 19. 19 Imaging and Hypocotyl Length Measurements589 For hypocotyl elongation assays, experiments were replicated twice. Seedling plates590 were collected from the dessicators. Seedlings were flattened on the agar plates to591 reveal the full extent of their hypocotyl, and images of the seedlings were obtained592 by scanning the plates using EPSON Perfection v370 Photo scanner (Epson Europe593 BV, The Netherlands). Hypocotyl lengths were measured from these images using594 ImageJ (http://rsbweb.nih.gov/ij/) and values (per data point) were obtained for n ≥595 30-60 seedlings. Final values for the data was obtained by taking mean ± S.E. for596 values from the two independent experiments.597 598 Epidermal Cell Length Measurements599 Seedlings were mounted on microscopic slides and covered with a cover slip.600 Hypocotyl epidermal cells were imaged using Olympus AX70 (20x objective, Nikon601 DXM1200 camera), after which cell lengths were measured using ImageJ software602 tool (http://rsbweb.nih.gov/ij/).603 604 Microarray Tissue Harvest, RNA Isolation and Array Hybridization605 Seedlings were dissected using BD PrecisionGlide Hypodermic 27 Gauge 1 1/4"606 Grey Needle with outer diameter = 0.41 mm (Becton Dickinson B.V., The607 Netherlands) to separately harvest the hypocotyl and cotyledon + shoot apical608 meristem (hereafter termed “cotyledon”). The roots were discarded. Samples were609 harvested at 1.5 h, 13.5 h and 25.5 h after the start of the treatments. For 13.5 h time610 point, which occurs during the dark period, dissection was carried out under low611 intensity green safelight (≈ 5 μmol m-2 s-1 ). For minimizing the effects of green light612 on gene expression, seedlings were kept in the dark until dissected and dissection613 was carried out in several rounds with each round involving maximum 2-3 seedlings.614 In total, 3 replicate experiments were carried out. In each replicate experiment,615 tissues were harvested from two independent technical replicates (each with 25616 seedlings from the two technical replicate plates as mentioned in “Treatments”617 section above). Harvested material was immediately frozen in liquid nitrogen and618 stored at -80°C until further use.619 Frozen tissue was ground using tissue lyser and total RNA was isolated using620 RNeasy Mini Kit (QIAGEN, Germany). QIAGEN RNase-Free DNase set was used to621 eliminate Genomic DNA contamination by performing on-column DNase digestion.622 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  20. 20. 20 Extracted RNA was verified (for quality check) and quantified using NanoDropTM ND-623 1000 Spectrophotometer (Isogen Life Science, De Meern, The Netherlands).624 RNA samples were sent to AROS (AROS Applied Biotechnology A/S, Aarhus,625 Denmark). RNA was repurified on low-elution QIAGEN RNeasy columns, re-626 quantified with NanoDropTM 8000 UV-Vis Spectrophotometer and checked for quality627 with Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). RNA samples628 with RNA Integrity Number (RIN) value of > 7.5 were considered for further use. 50629 ng RNA from each of the two independent technical replicates was mixed in the ratio630 1:1 and the pooled sample was considered as one biological replicate for631 hybridization experiments. Thus, 3 biological replicates were obtained for the 3632 replicate experiments. 100 ng of RNA sample was processed for cDNA synthesis,633 fragmentation and labelling was carried out for the RNA samples. The samples were634 hybridized to the Affymetrix Gene 1.1 ST Arabidopsis Array Plate and washed on an635 Affymetrix GeneAtlas system followed by scanning of arrays at AROS Applied636 Biotechnology (http://arosab.com/services/microarrays/gene-expression/).637 638 Microarray Data Analysis639 Scanned arrays in the form of .cel files (provided by AROS) were checked for quality640 control using Affymetrix Expression Console Software and an in-house script in R641 and Bioconductor (http://www.r-project.org./; http://www.bioconductor.org/)642 (Bioconductor “oligo” and “pd.aragene.1.1.st” ). Bioconductor was used for Robust643 Multi-array Average (RMA) normalization of raw data at Gene level to obtain644 summarized signal intensity values for all genes present on the array (log2 format).645 Principal component analysis was carried out using Affymetrix Expression Console646 Software (http://www.affymetrix.com/) and dendrogram of all microarray samples647 according to the mean signal intensity values was generated using R (“plot”648 package). Bioconductor (“Limma” package) was used for carrying out differential649 expression analysis.650 651 Temporal Clustering And Bioinformatics Analysis652 We clustered the list of total DEGs (defined as number of DEGs that were regulated653 at atleast one of the three time points) under ethylene and shade based on positive654 or negative regulation at each of the three time-points. With three time-points and655 two directions of expression (positive or negative), 23 = 8 possible trends can occur656 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  21. 21. 21 and accordingly as many clusters were obtained. DEGs were clustered temporally657 based on log2FC.658 659 MapMan bin overrepresentation using hypergeometric test was done using R (“stats”660 package) and adjusted p-values for the statistical significance of enrichment were661 converted into negative logarithm score and plotted as a heatmap. A score above662 1.3 for this score was considered significant.663 GeneCodis (http://genecodis.cnb.csic.es/compareanalysis) webtool was used for GO664 analysis of different sets obtained from venn of Positive clusters and of Negative665 Clusters. A score above 1.3 for negative log of adjusted p-values was considered666 significant.667 668 LogFC Filter and Gene Classification669 In order to narrow down the genes for functional characterization (from the list of670 classified genes), we utilised a logFC filter. To narrow down the Common Up set, a671 filter of log2FC < 0.5 at 1.5 h and log2FC ≥ 0.5 at both 13.5 h and 25.5 h for ethylene672 and log2FC ≥ 0.5 at both 1.5 h and 25.5 h for shade was applied. To narrow down673 the Common Down set, we applied a filter of log2FC > - 0.5 at 1.5 h and log2FC ≤ -674 0.5 at both 13.5 h and 25.5 h under ethylene and of log2FC ≤ - 0.5 at both 1.5 h and675 25.5 h under shade. These resulting group of genes were then classified based on676 MapMan based classification for the terms: “RNA.regulation of transcription”, “Cell677 wall”, “Signalling” and “Hormone metabolism”. Genes from Plant TFDB678 (http://planttfdb.cbi.pku.edu.cn/index.php?sp=Ath) and Potsdam TFDB679 (http://plntfdb.bio.uni-potsdam.de/v3.0/index.php?sp_id=ATH) were also included as680 a source for gene-classification to select for additional transcriptional regulators.681 682 Hormone Correlational Analysis683 Hormonometer software (http://genome.weizmann.ac.il/hormonometer/) was used to684 evaluate transcriptional similarities between the transcriptome data obtained here685 and the published, indexed list of those elicited by exogenous application of plant686 hormones. Arabidopsis gene locus IDs were converted to Affymetrix GeneChip687 identifiers using the “at to AGI converter” tool (The Bio-Analytic Resource for Plant688 Biology, http://bar.utoronto.ca/). We used the new Affymetrix aragen1.1st arrays (28k689 genes) for transcriptomics but the hormonometer data is based on 3’ ATH1 arrays690 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  22. 22. 22 (22k genes). Accordingly, many locus IDs could not be included (those which were691 newly incorporated in the aragene1.1st arrays) in this analysis. In few other cases692 where multiple ATH1 GeneChip IDs for one locus ID was obtained, all IDs were693 retained.694 695 Pharmacological Treatments696 Auxin transport was inhibited by use of 25 µM NPA (Duchefa Biochemie, The697 Netherlands) (Petrásek et al., 2003). Auxin perception was blocked by use of 100 µM698 PEO-IAA (Hayashi et al., 2008). Auxin biosynthesis was blocked by use of 50 µM699 yucasin (Nishimura et al., 2014). 2 µM brassinazole (TCI Europe, Japan) was used700 to inhibit BR biosynthesis (Asami et al., 2000). 2 µM paclobutrazol (Duchefa701 Biochemie, The Netherlands) was used to inhibit GA biosynthesis (Rademacher,702 2000). All chemicals were dissolved in respective solvents (DMSO or ETOH) with703 final solvent concentration in media < 0.1% to prevent toxicity due to solvents. All704 chemicals were applied by pipetting 150 µl of chemical solutions or mock solvents as705 a thin film over the MS-agar media in the petri plates and then allowing the solution706 to diffuse through the medium before starting the treatments.707 708 GUS Staining and Imaging709 For GUS assays, seedlings were transferred immediately from treatments to a GUS710 staining solution (1 mM X-Gluc (5-bromo-4-chloro-3-indolyl-D-glucoronide) (Duchefa711 Biochem, The Netherlands) in 100 mM Sodium phosphate buffer (pH=7.0) along with712 0.1 % Triton X-100, 0.5 mM each of Potassium ferrocyanide (K4Fe(CN)6 and713 Potassium ferricyanide (K3Fe(CN)6 and 10 mM of EDTA (Merck Darmstadt,714 Germany)) and kept at 37°C overnight. Seedlings were bleached in 70% ethanol for715 1 day before capturing images.716 717 Statistical Analysis and Graphing718 1-way ANOVAs followed by Tukey's HSD Post-Hoc tests were performed on the719 measurements obtained in hypocotyl length/cotyledon area kinetics to assess720 statistically significant differences between mean hypocotyl length/cotyledon area721 under ethylene or shade relative to control at the same time point.722 A two-way ANOVA followed by a Tukey's HSD Post-Hoc test was used for pairwise723 multiple comparison. For hypocotyl elongation assays, statistical significance was724 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  23. 23. 23 indicated by the use of different letters. All statistical analyses were done in the R725 software environment. Graphs were plotted using Prism 6 software (GraphPad726 Software, USA).727 728 Accession numbers729 .CEL files utilised in the organ-specific transcriptomics for hypocotyl and cotyledon730 tissues are posted with the GEO accession series GSE83212.731 732 Supplemental data733 The following materials are available in the online version of this article.734 Supplemental Figure S1. Hypocotyl elongation response in wild-type Col-0 under735 control, ethylene, shade and combination (ethylene + shade) treatments.736 Supplemental Figure S2. Venn diagram of gene intersection between up- and737 down- regulated DEGs of ethylene and shade separately at 1.5 h.738 Supplemental Figure S3. Genotyping and transcript level verification for (A)-(D)739 athb28.740 Supplemental Figure S4. Hypocotyl elongation response in ethylene signalling741 mutant, ein3eil1 under ethylene and shade.742 Supplemental Figure S5. TAIR motif analysis for Common Up and Down genesets.743 Supplemental Figure S6. Hypocotyl length of Ler under control and ethylene744 conditions when grown at 220 C day / 200 C night and 200 C day / 180 C night745 temperature regime.746 Supplemental Table S1. Photosynthesis gene proportion in genesets from Venn of747 negative clusters.748 ACKNOWLEDGMENTS749 We would like to thank all the group members of Plant Ecophysiology, Utrecht750 University, The Netherlands for their help in the harvest for the transcriptomics751 experiment.752 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  24. 24. 24 753 FIGURE LEGENDS754 Figure 1. Physiological responses, hypocotyl length and epidermal cell length755 kinetics under ethylene and shade in Arabidopsis (Col-0) seedlings. 1-day old756 seedlings were exposed to control conditions (PAR = 140 μmol m-2 s-1 , blue light =757 29 μmol m-2 s-1 and R:FR = 2.1), elevated ethylene (1 µl L-1 , PAR = 140 μmol m-2 s-1 ,758 blue light = 29 μmol m-2 s-1 and R:FR = 2.1) or shade (PAR = 40 μmol m-2 s-1 , blue759 light = 3 μmol m-2 s-1 and R:FR = 0.45). A, Figure shows representative seedlings760 displaying typical phenotypes after 96 h of exposure to control, ethylene or shade761 conditions. B, Mean hypocotyl lengths at 0 h, 24 h, 48 h, 72 h and 96 h under control762 (open circle), ethylene (closed circle) and shade (open triangle) are shown. C, Rate763 of increase in hypocotyl length. Differences between mean hypocotyl lengths of764 subsequent time points averaged over 1 d time interval for control, ethylene and765 shade are shown. D, Detailed hypocotyl length kinetics. 1-day old seedlings were766 exposed to control (open circle), ethylene (closed circle) and shade (open triangle)767 and measured at 3 h time intervals (s, e: first time point at which shade (s) or768 ethylene (e) treatment lead to significantly longer hypocotyls). Data are mean ± S.E.769 (n=60) for (A)-(D). Shaded area denotes the 15 h dark period in the 15 h dark/9 h770 light photoperiodic growth condition. e and s denote the first point of statistically771 significant differences in hypocotyl length or cotyledon area relative to control for772 ethylene and shade respectively. E, Epidermal cell length kinetics. 1-day old773 seedlings were exposed to control, ethylene or shade. Mean cell length ± S.E. (n ≥774 10) for epidermal cells of the Arabidopsis hypocotyl at 0 h control (black line) and at775 3 h, 7.5 h, 15 h and 27 h control (orange line), ethylene (blue line) and shade (green776 line) is shown. Apex denotes the hypocotyl-cotyledon junction and base denotes the777 hypocotyl-root junction.778 Figure 2. Overall description of microarray data. A, Principal component analysis779 (PCA) and hierarchical clustering (HC) was used to describe the structure in the780 microarray data. Expression intensities for all genes on the array for all 54 hypocotyl781 and cotyledon samples (3 time points, 3 treatments and 3 replicates) were projected782 onto the first three principal components. B, Hierarchical clustering was used to783 group 18 main samples (according to mean expression intensity of 3 replicates for784 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  25. 25. 25 each main sample) into a dendrogram. C, Distribution of differentially expressed785 genes (DEGs) in hypocotyl and cotyledon samples at three time-points in response786 to ethylene and shade. DEGs obtained for each time-point were plotted separately787 as up-regulated, down-regulated (adjusted p-value ≤ 0.01 and log2FC > or < 0) or788 non-significant (adjusted p-value > 0.01). Bar length denotes total DEGs obtained789 after combining DEGs from all 3 time points.790 Figure 3. Temporal gene expression clusters for ethylene (A) and shade (D);791 hypocotyl growth curve for ethylene (B) and shade (E); clusters with gene expression792 matching hypocotyl growth kinetics in ethylene (C) and shade (F). Heatmap for793 temporal clusters (A, D) based on the log2FC at the three microarray time points794 (grey box represents dark; arrows indicate heatmap time-points and treatments795 include control (open circle), ethylene (closed circle), shade (open triangle)). Yellow796 denotes up-regulation and blue denotes down-regulation. Two gene expression797 clusters (C, F) with mean log2FC temporal pattern resembling the hypocotyl length798 kinetics (B, E) were named positive clusters. G, Heatmap for hypergeometric799 enrichment of selected MapMan bins for temporal clusters under ethylene and800 shade. Horizontal-axis denotes the cluster number. More intense colours indicate801 higher statistical significance. Grey color indicates non-significant score or absence802 of genes in the bin. H, Venn intersection for positive clusters (clusters with gene803 expression pattern matching the hypocotyl length kinetics) from ethylene and shade804 to obtain “Common Up” genes. I, Venn intersection for negative clusters (mirror805 image to Positive clusters) from ethylene and shade to obtain “Common Down”806 genes.807 Figure 4. Gene Ontology (GO) enrichment analysis using GeneCodis for positive808 and negative clusters. Adjusted p-values for statistical significance of GO enrichment809 were converted into negative logarithm score (base10) (> 1.3 are considered810 significant). Heatmap colours denote this score and more intense colours indicate811 higher statistical significance. White color indicates non-significant score or absence812 of genes in the GO terms.813 814 Figure 5. Heatmap of (A) Common Up and (B) Common Down set of genes815 classified into the categories: transcriptional regulator, hormone metabolism,816 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  26. 26. 26 signalling and cell wall genes after application of a log2fold-change (log2FC) filter.817 Log2FC at the three time-points 1.5 h, 13.5 h, 25.5 h for ethylene and shade818 microarray dataset identified in the color scheme of the heatmap. Genes were819 categorized according to Mapman bin gene classification (shown on left side).820 821 Figure 6. Hypocotyl length measurements for (A) athb28 (B) ibl1 (C) IBL1-OE822 following 96 h of control, ethylene and shade treatments. Data represents mean ±823 S.E. (n=30 seedlings). Different letters above the bars indicate significant differences824 (2-way ANOVA followed by Tukey’s HSD Post-Hoc pairwise comparison).825 826 Figure 7. A, Identification of enriched hormonal signatures in the ethylene- and827 shade-induced Arabidopsis transcriptome. Ethylene and shade-induced hypocotyl828 and cotyledon transcriptomes were analyzed for hormonal signatures using the tool829 Hormonometer (Valdorsky et al., 2009) to establish correlations with expression data830 in an established hormonal transcriptome database. Positive correlations were831 colored yellow and negative correlations blue. Significant correlations were identified832 with absolute correlation values of 0.3 and higher. Numbers in the cells represent the833 exact correlation values. Rows denote hormone treatments that are indicated by the834 name of the hormone and the duration of hormone treatment. Columns denote835 ethylene and shade transcriptome in the hypocotyl and cotyledon at the three time-836 points of tissue harvest. The magnitude of correlation in gene expression is indicated837 by the color scale at top right side. B, Effect of auxin transport inhibitor NPA (25 µM),838 IAA (10 µM), NPA (25 µM) + IAA (10 µM) and auxin perception inhibitor PEO-IAA839 (100 µM) on GUS staining of the pIAA19:GUS lines. For NPA and PEO-IAA effect in840 GUS assay, seedlings were exposed to 2 days of treatment conditions. Arabidopsis841 (Col-0) seedlings were treated with chemical inhibitors for (C) auxin transport (NPA),842 (D) auxin biosynthesis (Yucasin), (E) auxin perception (PEO-IAA), (F)843 brassinosteroid biosynthesis (BRZ) and (G) gibberellin biosynthesis (PBZ) at the844 indicated concentrations in the legend and length was measured following 96h of845 ethylene and shade. Hypocotyl length was measured following 96 h of ethylene and846 shade. Mean ± S.E. was calculated for 30 seedlings. Different letters above the bars847 indicate significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-848 Hoc pairwise comparison. Abbreviations: PEO-IAA is α-(phenylethyl-2-one)-indole-3-849 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  27. 27. 27 acetic acid; NPA is 1-N-Naphthylphthalamic acid; BRZ is Brassinazole; PBZ is850 Paclobutrazol.851 852 Figure 8. Hypocotyl elongation response in response to ethylene and shade in (B)–853 (D) auxin, (E)–(G) gibberellin (GA) and (H)–(J) brassinosteroid (BR) mutants. Mean854 ± S.E. was calculated for 30 seedlings. Different letters above the bars indicate855 significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-Hoc856 pairwise comparison.857 858 LITERATURE CITED859 860 Abdi, H., and Williams, L. J. (2010). Principal component analysis. Wiley861 Interdisciplinary Reviews: Computational Statistics, 2(4), 433-459.862 Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T.,863 Straeten, D. Van Der, Peng, J., and Harberd, N.P. (2006). Integration of Plant864 Responses to Environmentally Activated Phytohormonal Signals. Science 311:865 91–94.866 Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S.,867 Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000). Characterization of868 brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant869 Physiol. 123: 93–100.870 Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis871 brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell872 10: 219–230.873 Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) A triple helix-loop-helix/basic874 helix-loop-helix cascade controls cell elongation downstream of multiple875 hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24:876 4917-4929877 Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and878 Koornneef, M. (2013). Arabidopsis semidwarfs evolved from independent879 mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and880 barley. Proc. Natl. Acad. Sci. U. S. A. 110: 15818–15823.881 Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B.882 (2004). Short-Term Growth Responses to Ethylene in Arabidopsis. Plant883 Physiol. 136: 2921–2927.884 Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R.,885 Aida M., Palme K. & Scheres, B. (2005). The PIN auxin efflux facilitator886 network controls growth and patterning in Arabidopsis roots. Nature, 433(7021),887 39-44.888 Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J.889 J. (2012). Stem transcriptome reveals mechanisms to reduce the energetic cost890 of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119.891 Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis892 thaliana HomeoBox 1 (AtHB1), a Homedomain‐Leucine Zipper I (HD‐Zip I)893 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  28. 28. 28 transcription factor, is regulated by PHYTOCHROME‐INTERACTING FACTOR894 1 to promote hypocotyl elongation. New Phytologist, 207, 669-682.895 Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade.896 Annu. Rev. Plant Biol. 64: 403–27.897 Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10: e0157.898 Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P.,899 and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP RNA63 promotes900 hypocotyl and stamen filament elongation. Plant J. 71: 684–697.901 Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and902 Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-903 promoting genes through GA-dependent and -independent pathways. PLoS904 One 7: e36210.905 De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers,906 D., and Jurgens, G. (2013). Transcriptional repression of BODENLOS by HD-907 ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64: 3009–3019.908 Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007).909 DELLA protein function in growth responses to canopy signals. Plant J. 51: 117–910 126.911 Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster912 analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci.913 U. S. A. 95: 14863–14868.914 Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005).915 Phytochrome B in the Mesophyll Delays Flowering by Suppressing916 FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant917 Cell 17: 1941–1952.918 Estelle, M. (1998). Polar Auxin Transport: New Support for an Old Model. The Plant919 Cell 10: 1775–1778.920 Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S.,921 Kim S., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH transcription factor922 HBI1 mediates the trade-off between growth and pathogen-associated923 molecular pattern–triggered immunity in Arabidopsis. The Plant Cell Online,924 26(2), 828-841.925 Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu,926 P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray, W.M. (2011).927 Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high928 temperature. Proc. Natl. Acad. Sci. U. S. A. 108: 20231–5.929 Franklin, K. A. (2008). Shade avoidance. New Phytol. 179: 930–944.930 Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H.931 (1997). Cellular basis of hypocotyl growth in Arabidopsis thaliana. Plant Physiol.932 114: 295–305.933 Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu,934 J., Matsumoto, T., Yoshimura, A., Kitano, H., Matsuoka, M., Mori, H.,935 Ashikari, M. (2009). The ethylene response factors SNORKEL1 and936 SNORKEL2 allow rice to adapt to deep water. Nature 460: 1026–1030.937 Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki,938 H. (2008). Small-molecule agonists and antagonists of F-box protein-substrate939 interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A.940 105: 5632–5637.941 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  29. 29. 29 Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act:942 Matching growth with environment by the TOR signalling pathway. J. Exp. Bot.943 65: 2691–2701.944 Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The945 involvement of Gibberellin 20-Oxidase genes in phytochrome-regulated petiole946 elongation of Arabidopsis. Plant Physiol. 138: 1106–1116.947 Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear948 import and DNA binding of the ZHD5 transcription factor is modulated by a949 competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286: 1659–1668.950 Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene951 MIF1: Involvement in multiple hormonal regulation of Arabidopsis development.952 Plant J. 45: 399–422.953 Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNA Binding bHLH protein,954 represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 61:955 283–96.956 Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated957 photosynthesis results from increased nitrogen and sulfur assimilation in958 mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78: 84–959 90.960 Kazan, K. and Manners, J.M. (2013). MYC2: The master in action. Mol. Plant 6:961 686–703.962 Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik,963 R. (2010). Auxin transport through PIN-FORMED 3 (PIN3) controls shade964 avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107:965 22740–22744.966 Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J.,967 and Pierik, R. (2011). Blue-light-mediated shade avoidance requires combined968 auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67: 208–217.969 Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E.,970 and Quail, P.H. (2007). The basic helix-loop-helix transcription factor PIF5 acts971 on ethylene biosynthesis and phytochrome signaling by distinct mechanisms.972 Plant Cell. 19: 3915-3929.973 Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998).974 Photomorphogenic development of the Arabidopsis shy2-1D mutation and its975 interaction with phytochromes in darkness. Plant J. 15: 61–68.976 Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and977 Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4978 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in979 the coincidence mechanism underlying photoperiodic control of plant growth of980 Arabidopsis thaliana. The Plant Cell Physiol. 52: 1315–1329.981 Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006).982 LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate983 longitudinal cell elongation in Arabidopsis. Development 133: 4305–4314.984 Leivar, P. and Monte, E. (2014). PIFs: systems integrators in plant development.985 The Plant Cell 26: 56–78.986 Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture.987 Genes Dev. 26: 785–790.988 Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An989 Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and990 Hypocotyl Elongation. Plant Physiol. 160: 2261–2270.991 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  30. 30. 30 Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic992 mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat.993 Rev. Genet. 16: 237–251.994 Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000).995 Update on Light Signaling Shade Avoidance Responses. Driving Auxin along996 Lateral Routes. Plant Physiol. 122: 621–626.997 Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H.,998 Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S., and Chory, J. (1999).999 BAS1: A gene regulating brassinosteroid levels and light responsiveness in1000 Arabidopsis. Proc. Natl. Acad. Sci. 96: 15316–15323.1001 Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependency of1002 brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2: E258.1003 Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y.,1004 Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I., Kamiya, Y., and Koshiba,1005 T. (2014). Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin1006 biosynthesis. Plant J. 77: 352–366.1007 Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi,1008 S. (2005). The last reaction producing brassinolide is catalyzed by cytochrome1009 P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280:1010 17873–17879.1011 Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R.,1012 Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade Avoidance1013 Components and Pathways in Adult Plants Revealed by Phenotypic Profiling.1014 PLOS Genet. 11: e1004953.1015 Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of1016 plants to water stress. Front. Plant Sci. 5(86): 10-3389.1017 Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012).1018 Phytochrome B inhibits binding of phytochrome-interacting factors to their target1019 promoters. Plant J. 72: 537–546.1020 Petrásek, J., Cerná, A., Schwarzerová, K., Elckner, M., Morris, D. A., and1021 Zazímalová, E. (2003). Do phytotropins inhibit auxin efflux by impairing vesicle1022 traffic? Plant Physiol. 131: 254–263.1023 Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014).1024 Combinatorial Complexity in a Transcriptionally Centered Signaling Hub in1025 Arabidopsis. Mol. Plant 7: 1598–1618.1026 Philippar, K., Ivashikina, N., Ache, P., Christian, M., Lüthen, H., Palme, K., and1027 Hedrich, R. (2004). Auxin activates KAT1 and KAT2, two K+-channel genes1028 expressed in seedlings of Arabidopsis thaliana. Plant J. 37: 815–827.1029 Pierik, R., Cuppens, M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions1030 between ethylene and gibberellins in phytochrome-mediated shade avoidance1031 responses in tobacco. Plant Physiol. 136: 2928-2936.1032 Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek,1033 L.A.C.J. (2009). Auxin and ethylene regulate elongation responses to neighbor1034 proximity signals independent of gibberellin and DELLA proteins in Arabidopsis.1035 Plant Physiol. 149: 1701–1712.1036 Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). New1037 perspectives in flooding research: The use of shade avoidance and Arabidopsis1038 thaliana. Ann. Bot. 96: 533–540.1039 Pierik, R. and Testerink, C. (2014). The art of being flexible: how to escape from1040 shade, salt and drought. Plant Physiol. 166: 5–22.1041 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  31. 31. 31 Pierik, R. and De Wit, M. (2014). Shade avoidance: Phytochrome signalling and1042 other aboveground neighbour detection cues. J. Exp. Bot. 65: 2815–2824.1043 Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014).1044 Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in1045 Brassica rapa. Plant Physiol. 165: 1285–1301.1046 Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van1047 Zanten, M. (2016). Molecular and genetic control of plant1048 thermomorphogenesis. Nature Plants. 2: 15190.1049 Rademacher, W. (2000). GROWTH RETARDANTS: Effects on Gibberellin1050 Biosynthesis and Other Metabolic Pathways. Annu. Rev. Plant Physiol. Plant1051 Mol. Biol. 51: 501–531.1052 Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong,1053 F., Linhartova, T., Eriksson, S., Nilsson, O., Thomas, S.G., Phillips, A.L.,1054 and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and1055 AtGA20ox2 act, partially redundantly, to promote growth and development1056 throughout the Arabidopsis life cycle. Plant J. 53: 488–504.1057 Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M.1058 (1998). The TIR1 protein of Arabidopsis functions in auxin response and is1059 related to human SKP2 and yeast Grr1p. Genes Dev. 12: 198–207.1060 Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R.,1061 Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010). Light quality-1062 mediated petiole elongation in Arabidopsis during shade avoidance involves cell1063 wall modification by xyloglucan endotransglucosylase/hydrolases. Plant Physiol.1064 154: 978–990.1065 Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to1066 flooding stress. Plant Physiol.: pp.00387.1067 Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V (1997).1068 Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl.1069 Acad. Sci. U. S. A. 94: 2756–2761.1070 Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inzé, D., Peer, W.A.,1071 Murphy, A.S., Overvoorde, P.J., and Gray, W.M. (2012). The SAUR191072 subfamily of SMALL AUXIN UP RNA genes promote cell expansion. Plant J. 70:1073 978–990.1074 Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y.,1075 Doležal, K., Schlereth, A., Jürgens, G., and Alonso, J.M. (2008). TAA1-1076 Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant1077 Development. Cell 133: 177–191.1078 Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil,1079 R., Lunn, J.E., and Stitt, M. (2014). Arabidopsis coordinates the diurnal1080 regulation of carbon allocation and growth across a wide range of Photoperiods.1081 Mol. Plant 7: 137–155.1082 Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of1083 YUCCA8 expression integrates temperature into the auxin pathway in regulating1084 Arabidopsis hypocotyl growth. PLoS Genet. 8: e1002594.1085 Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012).1086 GeneCodis 3: a non-redundant and modular enrichment analysis tool for1087 functional genomics. Nucleic Acids Res. 40: W478–W483.1088 Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-1089 gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis1090 thaliana (L.) Heynh. Planta 182: 501–505.1091 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  32. 32. 32 Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome1092 in cotyledons regulates the expression of genes in the hypocotyl through auxin-1093 dependent and -independent pathways. The Plant Cell Physiol. 43: 1171–1181.1094 Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno,1095 J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao, Y., Ballaré, C.L.,1096 Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a1097 New Tryptophan-Dependent Pathway Is Required for Shade Avoidance in1098 Plants. Cell 133: 164–176.1099 Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene1100 insensitivity results in down-regulation of rubisco expression and photosynthetic1101 capacity in tobacco. Plant Physiol. 144: 1305–1315.1102 Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantly to modulate Arabidopsis1103 photomorphogenesis via unique brassinosteroid inactivation mechanisms. Plant1104 J. 42: 23–34.1105 Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler,1106 K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B. (2015).1107 Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in1108 Arabidopsis. The Plant Cell 27: 2261–2272.1109 Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de1110 Vries, S.C. (2012). A Mathematical Model for BRASSINOSTEROID1111 INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation.1112 Plant Physiol. 160: 523–532.1113 Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der1114 Straeten, D. (2005). Reaching out of the shade. Curr. Opin. Plant Biol. 8: 462–1115 468.1116 van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-1117 Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive, C.K., Pierik, R.,1118 Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two1119 Rumex species from contrasting hydrological niches regulate flooding tolerance1120 through distinct mechanisms. The Plant Cell 25: 4691–707.1121 Voesenek L.A.C.J.; and Bailey-serres, J. (2015). Flood adaptive traits and1122 processes : an overview. New Phytol. 206: 57–73.1123 Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009).1124 HORMONOMETER: a tool for discerning transcript signatures of hormone1125 action in the Arabidopsis transcriptome. Plant Physiol. 150: 1796–1805.1126 Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific1127 phytochrome responses using targeted expression of biliverdin reductase in1128 Arabidopsis. Plant Physiol. 149: 424–33.1129 Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required1130 for Flowering in Arabidopsis thaliana under Short Days. Plant Physiol. 100: 403–1131 408.1132 Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K.,1133 Revalska, M., Van Montagu, M., Grotewold, E., and Russinova, E. (2014).1134 Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell1135 elongation in Arabidopsis through an apparent incoherent feed-forward loop.1136 Proc. Natl. Acad. Sci. U. S. A. 111: 2824–9.1137 Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J.1138 (2016). Local auxin metabolism regulates environment-induced hypocotyl1139 elongation. Nat. Plants. 21: 16025. doi: 10.1038/nplants.2016.251140 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  33. 33. 33 Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and1141 Guo, H. (2012). A molecular framework of light-controlled phytohormone action1142 in Arabidopsis. Curr. Biol. 22: 1530–1535.1143 1144 1145 1146 1147 1148 1149 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  34. 34. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  35. 35. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  36. 36. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  37. 37. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  38. 38. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  39. 39. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  40. 40. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  41. 41. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  42. 42. Parsed Citations Abdi, H., and Williams, L. J. (2010). Principal component analysis. WileyInterdisciplinaryReviews:Computational Statistics, 2(4), 433-459. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T., Straeten, D. Van Der, Peng, J., and Harberd, N.P. (2006). Integration of Plant Responses to EnvironmentallyActivated Phytohormonal Signals. Science 311:91-94. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S., Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000). Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant Physiol. 123:93-100. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell 10:219-230. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) Atriple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstreamof multiple hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24:4917-4929 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and Koornneef, M. (2013). Arabidopsis semidwarfs evolved fromindependent mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and barley. Proc. Natl. Acad. Sci. U. S. A. 110:15818-15823. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B. (2004). Short-TermGrowth Responses to Ethylene in Arabidopsis. Plant Physiol. 136:2921-2927. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R., Aida M., Palme K. & Scheres, B. (2005). The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature, 433(7021), 39-44. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J. J. (2012). Stemtranscriptome reveals mechanisms to reduce the energetic cost of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine Zipper I (HD-Zip I) transcription factor, is regulated byPHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl elongation. NewPhytologist, 207, 669-682. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade. Annu. Rev. Plant Biol. 64:403-27. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10:e0157. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P., and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP RNA63 promotes hypocotyl and stamen filament elongation. Plant J. 71:684-697. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  43. 43. Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and -independent pathways. PLoS One 7:e36210. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers, D., and Jurgens, G. (2013). Transcriptional repression of BODENLOS byHD-ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64:3009-3019. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007). DELLAprotein function in growth responses to canopy signals. Plant J. 51:117-126. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster analysis and displayof genome-wide expression patterns. Proc. Natl. Acad. Sci. U. S. A. 95:14863-14868. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005). Phytochrome B in the Mesophyll Delays Flowering by Suppressing FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant Cell 17:1941-1952. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Estelle, M. (1998). Polar Auxin Transport:NewSupport for an Old Model. The Plant Cell 10:1775-1778. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S., KimS., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH transcription factor HBI1 mediates the trade-off between growth and pathogen-associated molecular pattern-triggered immunityin Arabidopsis. The Plant Cell Online, 26(2), 828-841. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu, P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray, W.M. (2011). Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. U. S. A. 108:20231-5. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Franklin, K. A. (2008). Shade avoidance. NewPhytol. 179:930-944. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H. (1997). Cellular basis of hypocotyl growth in Arabidopsis thaliana. Plant Physiol. 114:295-305. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu, J., Matsumoto, T., Yoshimura, A., Kitano, H., Matsuoka, M., Mori, H., Ashikari, M. (2009). The ethylene response factors SNORKEL1 and SNORKEL2 allowrice to adapt to deep water. Nature 460:1026-1030. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki, H. (2008). Small-molecule agonists and antagonists of F-box protein-substrate interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A. 105:5632-5637. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act:Matching growth with environment bythe TOR signalling pathway. J. Exp. Bot. 65:2691-2701. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The involvement of Gibberellin 20-Oxidase genes in www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.

×