Endosulfan does not bio accumulate due to microbes in soil- report

This article was downloaded by: [Consortium for e-Resources in Agriculture]
On: 16 September 2009
Access details: Access Details: [subscription number 912062045]
Publisher Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
37-41 Mortimer Street, London W1T 3JH, UK

Journal of Environmental Science and Health, Part B
Publication details, including instructions for authors and subscription information:
http://www.informaworld.com/smpp/title~content=t713597269

Enrichment and isolation of endosulfan-degrading microorganism from tropical
acid soil
Surya Kalyani S a; Jitender Sharma b; Surender Singh c; Prem Dureja d; Lata c
a
Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India b Department of
Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India c Division of Microbiology, Indian
Agricultural Research Institute, New Delhi, India d Division of Agricultural Chemicals, Indian Agricultural
Research Institute, New Delhi, India

Online Publication Date: 01 September 2009

To cite this Article Kalyani S, Surya, Sharma, Jitender, Singh, Surender, Dureja, Prem and Lata(2009)'Enrichment and isolation of
endosulfan-degrading microorganism from tropical acid soil',Journal of Environmental Science and Health, Part B,44:7,663 — 672
To link to this Article: DOI: 10.1080/03601230903163665
URL: http://dx.doi.org/10.1080/03601230903163665

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.informaworld.com/terms-and-conditions-of-access.pdf

This article may be used for research, teaching and private study purposes. Any substantial or
systematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or
distribution in any form to anyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representation that the contents
will be complete or accurate or up to date. The accuracy of any instructions, formulae and drug doses
should be independently verified with primary sources. The publisher shall not be liable for any loss,
actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directly
or indirectly in connection with or arising out of the use of this material.

Journal of Environmental Science and Health Part B (2009) 44, 663–672
Copyright C Taylor & Francis Group, LLC
ISSN: 0360-1234 (Print); 1532-4109 (Online)
DOI: 10.1080/03601230903163665

Enrichment and isolation of endosulfan-degrading
microorganism from tropical acid soil

SURYA KALYANI S1 , JITENDER SHARMA2 , SURENDER SINGH3 , PREM DUREJA4 and LATA3
1
Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India
2
Department of Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India
3
Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India
4
Division of Agricultural Chemicals, Indian Agricultural Research Institute, New Delhi, India
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009

Endosulfan (6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9-methano-2,3,4-benzo-dioxathiepin-3-oxide) is a cyclodiene
organochlorine currently used as an insecticide all over the world and its residues are posing a serious environmental threat.
This study reports the enrichment and isolation of a microbial culture capable of degrading endosulfan with minimal production of
endosulfan sulfate, the toxic metabolite of endosulfan, from tropical acid soil. Enrichment was achieved by using the insecticide as
sole sulfur source. The enriched microbial culture, SKL-1, later identified as Pseudomonas aeruginosa, degraded up to 50.25 and 69.77
% of α and β endosulfan, respectively in 20 days. Percentage of bioformation of endosulfan sulfate to total formation was 2.12% by
the 20th day of incubation. Degradation of the insecticide was concomitant with bacterial growth reaching up to an optical density of
600 nm (OD600) 2.34 and aryl sulfatase activity of the broth reaching up to 23.93 µg pNP/mL/hr. The results of this study suggest
that this novel strain is a valuable source of potent endosulfan–degrading enzymes for use in enzymatic bioremediation. Further, the
increase in aryl sulfatase activity of the broth with the increase in degradation of endosulfan suggests the probable involvement of
the enzyme in the transformation of endosulfan to its metabolites.
Keywords: Biodegradation; endosulfan; endosulfan sulfate; Pseudomonas aeruginosa; tropical acid soil.

Introduction step in the investigation of enzymatic technologies for en-
dosulfan detoxification is the definitive identification of a
Endosulfan (6, 7, 8, 9, 10, 10-hexachloro-1, 5, 5a, 6, 9a- biological source of endosulfan–degrading activity.
hexahydro-6, 9-methano-2, 3, 4-benzodioxyanthiepin- 3- In a bioremediation process, heterotrophic microorgan-
oxide) is widely employed as an insecticide in world agri- isms break down substrates (hazardous compounds) to ob-
culture. Technical grade endosulfan contains two stereoiso- tain chemical energy, hence organic pollutants can serve as
mers, α and β endosulfan in the ratio of 7: 3. In the close carbon, energy and nutrient sources for microbial growth.
vicinities of agricultural fields, the contamination of at- Some studies have described endosulfan as a sulfur source
mosphere, soils, sediments, surface and rain waters and for microbial growth and a poor biological energy source
foodstuffs by endosulfan has been documented in numer- when used as a sole carbon source.[8,9] Sutherland et al.[8]
ous previous studies.[1] The persistence of endosulfan in selected microorganisms for their ability to release the sul-
soil and water environments has been observed by different fite group from endosulfan and to use this insecticide as
researchers under different conditions.[2,3] Its harmful im- a source of sulfur for bacterial growth. Awasthi et al.[10]
pacts on aquatic fauna and numerous mammalian species isolated a bacterial co-culture using endosulfan as a sole
including human beings have been reported several times carbon source. To date, some physicochemical and biolog-
in literature.[4−7] ical remedial strategies have been described by researchers
Detoxification of pesticides through biological means which lead to degradation of endosulfan into both toxic
is receiving serious attention as an alternative to existing and non-toxic metabolites.[8−22]
methods, such as incineration and landfill. A preliminary In this study we are reporting a bacterial strain SKL-1,
isolated using enrichment with endosulfan as sole sulfur
Address correspondence to Jitender Sharma, Department of source. The organism identified as Pseudomonas aerugi-
Biotechnology, Kurukshetra University, Kurukshetra, Haryana, nosa, is the most active endosulfan-degrading single strain
India; E-mail: jksharma.kuk@gmail.com of microorganism, with minimal production of endosul-
Received December 3, 2008. fan sulfate, the toxic metabolite of endosulfan degradation.

664 Kalyani et al.

This strain will be further investigated for its endosulfan- culture). Thereafter, 0.1 mL of the enriched medium was
degrading potential in soil and for the enzymatic reactions transferred into 10 mL of fresh sterile enrichment medium
in detoxification of endosulfan. containing 100 ppm endosulfan and further incubated for
two weeks (Round 2 enrichment culture).

Materials and methods Endosulfan degrading monocultures
Pesticide standards To obtain pure cultures of single strains, 1 mL aliquots
of round 2 enrichment culture was centrifuged (8000 rpm,
Endosulfan isomers and metabolites, viz., endosulfan sul- 10 min), the supernatant was removed and cell residues
fate (C9 H8 Cl4 S), endosulfan diol (C9 H8 Cl6 O), endosulfan were resuspended in 50 µL of sterile enrichment media
ether (C9 H6 ClO2 ) and endosulfan lactone (C9 H4 Cl6 O2 ) by vortexing. Aliquots of this suspension were plated on
to be used as standards were purchased from Merck, enrichment medium agar by spread plating and incubated
Germany. under aerobic conditions at 28◦ C 7d. Isolates were further
purified by streaking on fresh plates. Intrinsic antibiotic

Sample collection for enrichment studies resistance pattern of the selected cultures was carried out
to avoid redundancy among the isolates.
Samples of laterite, coastal sandy and red loam soils were
collected from Kerala (India) having a history of endosul-
Screening of isolates for endosulfan degradation in liquid
fan application. Top 0–15 cm of soil was collected using
culture media
core samplers and covered with plastic bags to minimize
changes in physical parameters. The samples were stored at Four isolates of bacteria exhibiting luxury growth on the en-
4◦ C. richment medium were selected, and grown in nutrient cul-
ture broth containing 100 ppm endosulfan. Cultures were
Enrichment of microbial communities incubated (28◦ C, 160 rpm) for one week and cells were har-
vested by centrifugation (5000 rpm, 20 min) and washed
Soil (approximately 50 g) was first enriched for endosulfan- thrice in 30 mL of nutrient culture media. Cells were there-
degrading organisms by the addition of 5 mg of technical after resuspended in the same media. Endosulfan dissolved
grade endosulfan in 200 µL of acetone to remoistened soil, in acetone was used to spike Erlenmeyer flasks as described
followed by incubation in the dark at room temperature earlier to obtain a final concentration of 100 ppm endosul-
for 1 month. Further enrichment was achieved by initiating fan in the media. Two milliliters of inoculum was added to
shake flask enrichment cultures from these samples by using each spiked flask except the control flasks after adjusting
endosulfan as the only added source of sulfur. their optical densities and incubated (28◦ C, 160 rpm) for
The enrichment medium (pH 6.8) consisted of 0.225 g of 20 d. This study was performed in triplicates.
K2 HPO4 , 0.225 g of KH2 PO4, 0.225 g of NH4 Cl, 0.845 g of For studying degradation of endosulfan sulfate by SKL-
(MgCl)2 .6H2 O, 0.005 g of CaCO3, 0.005 g of FeCl2 .4H2 O, 1, endosulfan sulfate dissolved in acetone was used to spike
1.0 g of D-glucose and 1 mL of a trace element solu- Erlenmeyer flasks as described earlier to obtain a final con-
tion per liter. The stock trace element solution contained centration of 10 ppm endosulfan sulfate in the media.
198.0 mg of MnCl2 .4H2 O, 136.0 mg of ZnCl2, 171.0 mg
of CuCl2 .2H2 O, 24.0 mg of CoCl2 .6H2 O and 24.0 mg of Molecular identification of bacterial isolate
NiCl2 .6H2 O per liter.
Erlenmeyer flasks (50 mL) and nutrient culture media The bacterial isolate, tentatively designated SKL-1, was
were autoclaved separately for 20 min at 121◦ C. Fifty mi- identified by analysis of 16S rDNA. Amplification of 16S r
croliters of acetone containing 1.0 mg of technical-grade DNA was carried out by polymerase chain reaction using a
endosulfan (99% pure) was aseptically added to each ster- thermal cycler (M. J. Research PTC-100). The polymerase
ilized flask in a laminar flow hood allowing the acetone chain reactions (PCR) were carried out with 50–90 ng of
to evaporate. Nine milliliters of enrichment medium was pure genomic DNA. The forward (PA) and reverse primers
added to each flask. (PH) were custom synthesized from Bangalore Genei Pvt.
Microbial inoculums for the enrichment studies were pre- Ltd. The sequence of the oligonucleotide primers used for
pared by shaking 20 g of the enriched soil sample overnight amplification of 16S rDNA genes were:
in 100 mL of enrichment medium at 25◦ C and 160 rpm. The PA: 5 CACGGATCCAGAGTTTGAT(C/T)(A/C)-
solid particles were allowed to settle for one hour and 1 mL TGGCTCAG3
of supernatant solution from the source flasks was used PH: 5 GTGCTGCAGGGTTACCTTGTTACGACT3
to inoculate the spiked flasks. Uninoculated spiked flasks
were also set up as a control to compensate for any chemi- The primers PA and PH, located at the extreme 5 and
cal degradation. The flasks were incubated at 28◦ C with or- 3 ends, respectively, of the ribosomal rDNA sequence, en-
bital shaking (160 rpm) for two weeks (Round 1 enrichment able the amplification of the entire gene. Purity of the PCR

Endosulfan-degrading microorganism 665

product was checked by agarose gel electrophoresis. Se- dx = endosulfan degraded on nth day (ppm) – endosulfan
quencing of the purified PCR product was carried out degraded on n-1th day (ppm) and
at an automated fluorescent sequencing facility of Ban- dy = 1 (day)
glore Genei Pvt. Ltd. DNA sequence similarity search was
done by computing at Basic Local Alignment Search Tool
(BLAST), developed by National Center for Biotechnol- Results and discussion
ogy Information (NCBI), US[23] for searching the DNA
and protein database. Enrichment of endosulfan degrading microorganisms
from soil
Analytical procedures The different colonies of bacteria isolated from the enrich-
For determination of endosulfan and endosulfan sulfate ment media were numbered SKL-1 to 11. Intrinsic antibi-
concentration, 5 mL of broth sample kept for incubation otic resistance has been used extensively as a technique for
was centrifuged (10000 rpm; 10 min) and the supernatant strain identification in soil bacteria and it has been reported
that the pattern of antibiotic resistance of each strain is a

was mixed with 0.5 g of activated charcoal. The sample
was poured in a funnel containing 4 cm layer of anhydrous stable property by which the strains could be recognized.[25]
sodium sulfate over a plug of cotton. The sample was eluted Keeping this in mind, the colony morphology and intrinsic
with 100 mL of n-hexane:acetone (7:3) and the solvent was antibiotic resistance pattern of the eleven different isolates
evaporated to dryness and final volume was made with n- was studied and it was revealed that only four of them were
hexane at the time of analysis. Appropriate dilutions of the essentially unique and hence were used for further studies.
sample extract were then analyzed with a Hewlett Packard The method of enrichment relies on bacteria being able
5890, Series II gas chromatograph equipped with a methyl to grow in the minimal media and hence the number of
silicon column (10 m × 0.53 mm × 2.65 µm film thickness) culturable bacteria is severely restricted.
packed with HP - 1 and electron capture detector (ECD)
63
Ni. The oven temperature was 200◦ C, injector tempera- Screening microbial isolates for their ability to utilize
ture was 250◦ C and the detector temperature was 250◦ C. endosulfan for growth
Nitrogen was the carrier gas at a flow rate of 60 mL min−1 .
Bacterial densities in liquid cultures were determined Regression analysis of bacterial population (106 CFU/mL)
spectrophotometrically by measuring the absorbance at on OD600 revealed that it followed a linear kinetics, the
600 nm. Aryl sulfatase activity was also measured regression equation being y=34.204x with an R2 value of
spectrophotometrically.[24] 0.9045 indicating perfect fit. Hence measurement of OD600
was performed to quantify the growth of the isolate in
broth.
Calculation of degradation The isolates were screened for their ability to utilize en-
Percentage of biodegradation of endosulfan is the differ- dosulfan as the sole sulfur source. Endosulfan is a poor
ence between the percentage of degradation of endosulfan biological energy source, as it contains only six potential
in the inoculated flasks and the uninoculated control. reducing electrons. But it has a relatively reactive cyclic sul-
Percentage of bioformation of endosulfan sulfate to total fite diester group and can serve as a good sulfur source.[26]
formation of endosulfan sulfate was calculated according This selection procedure enriches for a culture capable of
to Equation 1. either the direct hydrolysis of endosulfan or the oxidation of
the insecticide followed by its hydrolysis, thereby reducing
BES = [(Ein − Eun ) × 100] /Ein (1) formation of toxic endosulfan sulfate.[8]
Where, SKL-1 was the only isolate able to grow utilizing endo-
BES = Percentage of bioformation of endosulfan sulfate to sulfan as a sulfur source and hence was used for further
total formation of endosulfan sulfate (%) studies.
Ein = Endosulfan sulfate formation in inoculated flask
(ppm) and
Endosulfan degradation by enriched culture
Eun = Endosulfan sulfate formation in uninoculated flask
(ppm) The gas chromatography (GC) Rt (retention times) for α
Progressive rate of degradation of endosulfan was calcu- endosulfan and β endosulfan were 2.70 and 3.70 minutes,
lated according to Equation 2. respectively (Fig. 1). The total degradation of α endosul-
fan and β endosulfan was 94.40 and 96.38% , respectively
K = dx/dy (2)
after 20 days of incubation (Figs. 2 and 3). Thus the to-
Where, tal degradation of β endosulfan was more than that of
K = Progressive rate of degradation of endosulfan for nth α endosulfan. This may be because of the fact that the
day (ppm/day) rate of non-biological degradation involving hydrolysis and

666 Kalyani et al.

recently, Siddique et al.[18] reported that bacteria degraded
relatively more β endosulfan than α endosulfan.
The percentage of biodegradation to total degradation
was 76.04 and 72.39% for α and β isomers, respectively after
20 days of incubation. Thus biotransformation contributed
to a major portion of total transformation of both the iso-
mers in the present study. The predominance of biological
degradation over non-biological degradation or vice versa
depends on the culture conditions in addition to the effi-
ciency of the microbial culture. Endosulfan is susceptible
to alkaline hydrolysis, with approximately ten fold increase
in hydrolysis occurring with each increase in pH unit.[12]
Many previous studies have been unable to differentiate
between chemical and biological hydrolysis of endosulfan

because microbial growth has led to increases in the alkalin-
ity of the culture medium.[12,13] To minimize non-biological
hydrolysis, the enrichment medium was buffered to pH
6.8 and cultures were monitored constantly for change in
pH.
The progressive rate of degradation of endosulfan exhib-
ited a prominent increase by the 3rd day of incubation and
reached its peak value of 13 ppm/day. Afterwards, there
was a steady decrease in the progressive rate of degradation
(Fig. 4). The low initial rate of degradation might represent
a lag phase while it got accelerated as the incubation pro-
ceeded, most likely due to induction/activation of enzymes
in the inoculated cultures. Similar observations were made
by Hussain et al.[19] The steady decrease in rate of degra-
dation afterwards may be due to exhaustion of nutrients in
the media.
The metabolites formed during the degradation of endo-
sulfan were identified as endosulfan diol (Rt = 0.89 min),
endosulfan ether (Rt = 2.21 min) endosulfan lactone (Rt =
3.21 min) and endosulfan sulfate (Rt = 4.90 min) (Fig. 1).
Miles and Moy[13] and Katayama and Matsumura[20] have
confirmed the formation of these metabolites by microbial
isolates during biodegradation of endosulfan.
Fig. 1. Separation of endosulfan and its metabolites by gas liquid Endosulfan diol, endosulfan ether and endosulfan lac-
chromatography. (A) Uninoculated control – Day 0; (B) inocu- tone are nontoxic, where as endosulfan sulfate is toxic in
lated with SKL-1– Day 0; (C) uninoculated control– Day 20; and nature. Unlike the isomers of endosulfan, the toxic metabo-
(D) inoculated with SKL-1 – day 20. 1 – solvent peak; 2 – endo- lite endosulfan sulfate can accumulate in animal fat and
sulfan diol; 3 – endosulfan ether; 4 – α endosulfan; 5 – endosulfan hence the formation of endosulfan sulfate was studied in
lactone; 6 – β endosulfan; 7 – endosulfan sulfate. detail.[30] It was observed that by the 20th day 15.91% of the
applied endosulfan was transformed to endosulfan sulfate.
Of the total endosulfan degraded 16.74% was converted
photodecomposition is more for the β isomer and the differ- to endosulfan sulfate. There was a steady decrease in the
ence is all the more prominent in alkaline conditions.[13,27,28] percentage of bioformation of endosulfan sulfate to total
Further, the recent discovery that the isomers form a eutec- formation as period of incubation progressed. By the 20th
tic mixture indicates that application of a mixture is most day of incubation, the percentage of bioformation of en-
likely to enhance the volatilization of the β isomer.[29] dosulfan sulfate to total transformation was only 2.12%
The biodegradation of α endosulfan and β endosulfan (Table 1).
by SKL- 1 was 71.78 and 69.77% , respectively after 20 days In order to clarify whether endosulfan sulfate was further
of incubation (Figs. 2 and 3) indicating that biodegradation degraded by SKL-1, biodegradation of endosulfan sulfate
of the α isomer is more than that of the β isomer. Earlier by SKL-1 was studied by spiking the medium with 10 ppm
studies have shown that microbial species prefer α endo- endosulfan sulphate. Table 2 indicates that there was no fur-
sulfan for degradation over β endosulfan.[10,22] However, ther degradation of endosulfan sulfate by SKL-1. Similar


Fig. 2. Progressive degradation of α endosulfan by SKL-1 in pure culture.

observations were also made by Sutherland et al.[8] and fate by SKL-1 with time. This suggests that the metabolism
Shivaramaiah and Kennedy[21] in their studies on biodegra- of endosulfan is mediated by two divergent pathways, one
dation of endosulfan by soil bacteria. hydrolytic leading to the production of endosulfan diol,
The inability to transport the more polar compound endosulfan ether and endosulfan lactone and the other ox-
into the cell or the absence of an enzyme capable of hy- idative leading to the production of the toxic metabolite,
drolyzing the oxidized compound may be reasons for the endosulfan sulfate, which is resistant to further biodegra-
lack of biodegradation of endosulfan sulfate. The differ- dation. Kullman and Matsumura[15] while working with
ent oxidation states of the sulfur in endosulfan and en- Phanerochaete chrysosporium suggested similar mechanism
dosulfate make it unlikely that the same enzyme will be of degradation of endosulfan.
capable of releasing the sulfur containing moiety from
both.
Thus the decrease in the percentage of bioformation of
Bacterial density, culture pH and aryl sulfatase activity
endosulfan sulfate to total formation of endosulfan sul-
fate during the course of incubation may be attributed to The bacterial density, culture pH and aryl sulfatase activity
the reduction in the rate of formation of endosulfan sul- were measured to assess the relationship between growth

Fig. 3. Progressive degradation of β endosulfan by SKL-1 in pure culture.

668 Kalyani et al.
Table 1. Progressive formation of endosulfan sulfate from endo- Table 2. Incubation of endosulfan sulfate with SKL-1 in vitro.
sulfan by SKL-1 in pure culture.
Endosulfan sulfate remaining
Endosulfan Percentage of in broth (ppm)
Endosulfan sulfate bioformation of
sulfate formed formed to endosulfan Days of Control Incubation with
Days of endosulfan to endosulfan sulfate to incubation (Media) SKL-1
incubation applied (%) degraded (%) total formation
0 10.00 10.00
0 0.00 0.00 0.00 1 9.98 9.98
1 0.23 4.41 11.02 2 9.97 9.97
2 1.04 8.84 7.38 3 9.95 9.96
3 2.18 5.15 5.28 4 9.91 9.92
4 3.83 8.11 3.26 5 9.92 9.91
5 7.02 13.55 1.92 6 9.90 9.91
6 7.08 12.29 2.04 7 9.87 9.88

7 7.57 11.81 1.91 8 9.88 9.89
8 7.83 11.16 2.13 9 9.87 9.87
9 8.59 11.57 2.24 10 9.88 9.86
10 8.88 11.58 2.17 11 9.87 9.85
11 10.29 13.05 1.87 12 9.84 9.85
12 10.69 13.26 1.89 13 9.85 9.84
13 11.49 13.84 2.04 14 9.82 9.83
14 11.78 13.73 1.99 15 9.81 9.83
15 12.39 13.98 2.10 16 9.82 9.83
16 13.00 14.45 2.02 17 9.80 9.82
17 13.67 14.98 2.20 18 9.78 9.80
18 14.63 15.71 2.08 19 9.79 9.81
19 15.16 16.11 2.03 20 9.79 9.80
20 15.91 16.74 2.12 CV (%) 4.78
CV (%) 4.20 4.59 4.38 Days Treatment
SEm± 0.76 2.16 2.24 SEm± 0.03 0.01
CD (P = 0.05) 1.49 4.23 4.39 CD (P=0.05) 0.06 0.02

Fig. 4. Change in optical density (OD600 ) of medium inoculated with SKL-1 during endosulfan degradation.

Table 3. Correlation coefficients between transformation of en- dation of endosulfan by SKL-1 resulted in an increase
dosulfan and OD600 , pH and aryl sulfatase activity in vitro. in the pH of the culture medium. Though this observa-
tion is in conformity with the observations of Miles and
At Ab Bt Bb St Sb
Moy[13] and Martens,[12] it is contradictory to the observa-
OD 0.061 0.332∗∗ 0.068 0.468∗∗ −0.041 −0.164 tions of Hussain et al.[19] and Siddique et al.[18] In either
pH 0.205∗ 0.284∗∗ 0.201∗ 0.371∗∗ −0.355∗∗ 0.007 case the change in pH depends on the products of degra-
∗∗
As −0.140 0.310 −0.135 0.422∗∗ −0.131 −0.065 dation. The increase in pH in the present study due to
biological activity of SKL-1 could have further acceler-
At = Progressive rate of degradation of α endosulfan (total) (%).
Ab = Progressive rate of degradation of α endosulfan (biological) (%). ated the alkaline hydrolysis of endosulfan, especially the β
Bt = Progressive rate of degradation of β endosulfan (total) (%). isomer.[27]
Bb = Progressive rate of degradation of β endosulfan (biological) (%). Interestingly, pH change exhibited highly significant neg-
St = Progressive rate of formation of endosulfan sulfate (total) (%). ative correlation with total formation of endosulfan sulfate
Sb = Progressive rate of formation of endosulfan sulfate (biological) (Table 3). This may be due to the fact that under alka-
(%).
OD = Optical density of growth (600nm). line conditions hydrolysis of endosulfan is predominant

pH = pH of the broth. over its oxidation and hence formation of endosulfan sul-
As = Aryl sulfatase activity of the broth (µg/mL/hr). fate, the product of oxidative degradation of endosulfan is
∗
Significant at 5% level. minimized.
∗∗
Significant at 1% level. The aryl sulfatase activity of the broth followed the pro-
gressive rate of degradation of endosulfan closely (Fig. 6).
and metabolic activities of the organism and its capability Aryl sulfatase activity exhibited highly significant positive
to degrade endosulfan. correlation with biodegradation of α endosulfan and β en-
The growth of SKL-1 quantified by OD600 followed the dosulfan (Table 3). Aryl sulfatase activity reached 23. 93
progressive rate of degradation of endosulfan (Fig. 4). The µg pNP/mL/hr as progressive rate of α and β endosulfan
OD600 reached 2.34 as progressive rate of α and β endo- reached its peak. Further, aryl sulfatase activity did not ex-
sulfan reached its peak. Growth of SKL-1 exhibited highly hibit any significant correlation with endosulfan sulfate for-
significant positive correlation with biodegradation of α mation. Aryl sulfatase enzyme catalyzes the removal of sul-
endosulfan and β endosulfan (Table 3) indicating that the fur moiety from organic sulfur compounds.[24] Katayama
microorganism utilizes endosulfan for its growth. OD600 and Matsumura[20] studying biodegrdation of endosulfan
had no significant correlation with formation of endosulfan by Trichoderma harzianum had suggested that endosulfan
sulfate suggesting the limited role of the microbial isolate sulfate was further converted to endosulfan diol by hy-
in the formation of endosulfan sulfate. drolysis in presence of sulfatase enzyme. However, since in
Change in pH exhibited significant positive correlation our study endosulfan sulfate was not degraded further by
with total degradation and biodegradation of both α and β SKL-1, aryl sulfatase enzyme may be involved in the direct
endosulfan (Fig. 5 and Table 3). The growth and biodegra- hydrolysis of endosulfan to endosulfan diol.

Fig. 5. Change in pH of medium inoculated with SKL-1 during endosulfan degradation.

670 Kalyani et al.

Fig. 6. Change in aryl sulfatase activity of medium inoculated with SKL-1 during endosulfan degradation.

Phylogenetic identity of bacterial strain SKL-1 aeruginosa strains (Fig. 7). The sequence was submitted
in Genbank and the accession number was allotted as
The 16S rDNA gene of the microbial isolate was ampliﬁed EF443060.
and sequenced. Homology search in the BLAST server Earlier reports of degradation of endosulfan involved
developed by NCBI, USA revealed that the organism ex- mixed bacterial cultures, bacterial co-cultures, As-
hibited 99% homology with many of the Pseudomonas pergillus niger, Phanerochaete chrysosporium, Mucor

Fig. 7. Phylogenetic tree of Pseudomonas aeruginosa SKL-1.

thermohyalospora, Anabaena spp. and Fusarium [2] Rao, D. M.R.; Murty, A. S. Persistence of endosulfan in soils. J.
ventricosum.[8,10,14−18] Recently, Hussain et al.[19] reported Agric. Food Chem. 1980, 28, 1099–1101.
[3] Guerin, T. F.; Kennedy, I. R. Distribution and dissipation of endo-
that Pseudomonas spinosa, P. aeruginosa and Burkholderia
sulfan and related cyclodienes in sterile aqueous systems: implica-
cepacia degraded endosulfan efficiently. The bacteria tions for studies on biodegradation. J. Agric. Food Chem. 1992, 40,
belonging to Pseudomonas sp. are gram negative soil 2315–2323.
bacteria and have been previously documented as excellent [4] Sunderam, R.I.M.; Cheng, D.M.H.; Thompson, G.B. Toxicity of
degraders of a wide range of xenobiotics and recalcitrant endosulfan to native and introduced fish in Australia. Environ. Tox-
icol. Chem. 1992, 11, 1469–1476.
compounds both in soil and water environment.[31,32]
[5] Paul, V.; Balasubramaniam, E. Effect of single and repeated ad-
ministration of endosulfan on behaviour and its interaction with
Conclusion centrally acting drugs in experimental animals: A mini review. En-
viron. Toxicol. Pharmacol. 1997, 3, 151–157.
[6] Sinha, N.; Narayan, R.; Saxena, D.K. Effect of endosulfan on testis
We have successfully enriched and isolated endosulfan de- of growing rats. Bull. Environ. Contam. Toxicol. 1997, 58, 79–86.
grading bacterial strain Pseudomonas aeruginosa SKL-1 [7] Chaudhuri, K.; Selvaraj, S.; Pal, A.K. Studies on the genotoxicology
that can utilize endosulfan as sole sulfur source in broth cul- of endosulfan in bacterial system. Mutat. Res. 1999, 439, 63–67.

ture. After approximately 100 rounds of subculturing, the [8] Sutherland, T.D.; Horne, I.; Lacey, M.J.; Harcourt, R.L.; Russel,
R.J.; Oakeshott, J.G. Enrichment of an endosulfan-degrading mixed
culture metabolizes 100 ppm endosulfan to undetectable bacterial culture. Appl. Environ. Microbiol. 2000, 66, 2822–2828.
levels in less than 30 days. This rate of degradation is signif- [9] Guerin, T.F. The anaerobic degradation of endosulfan by indige-
icantly higher than those previously measured for bacteria, nous microorganisms from low-oxygen soils and sediments. Envi-
considering the fact that non-biological degradation has ron. Pollut. 1999, 106, 13–21.
been minimized. Further, it was also observed that there is [10] Awasthi, N.; Manickam, N.; Kumar, A. Biodegradation of endosul-
fan by a bacterial coculture. Bull. Environ. Contam. Toxicol. 1997,
a significant correlation between endosulfan degradation 59, 928–934.
and aryl sulfatase activity suggesting the possible involve- [11] Knoevenagel, K.; Himmelreich, R. Degradation of compounds con-
ment of this enzyme in the degradation of endosulfan by taining carbon atoms by photo-oxidation in the presence of water.
this organism. Arch. Environ. Contam. Toxicol. 1976, 4, 324–333.
The results have valuable applications for endosulfan [12] Martens, R. Degradation of endosulfan-8, 9-Carbon-14 in soil un-
der different conditions. Bull. Environ. Contam. Toxicol. 1977, 17,
bioremediation in polluted sites. From this study, we can- 438–446.
not predict the efficiency of the microbial isolate to utilize [13] Miles, J. R.W.; Moy, P. Degradation of endosulfan and its metabo-
endosulfan as a sulfur source in the soil environment. The lites by a mixed culture of soil microorganisms. Bull. Environ. Con-
majority of the sulfur content of soils is found in an or- tam. Toxicol. 1979, 23, 13–19.
ganic form, with over 95% present as sulfonates and sulfate [14] Mukherjee, I.; Gopal, M. Degradation of beta-endosulfan by As-
pergillus niger. Toxicol. Environ. Chem. 1994, 46, 217–221.
esters. Soil bacteria have numerous enzymes capable of re- [15] Kullman, S.W.; Matsumura, F. Metabolic pathways utilized by
leasing sulfur from organic compounds. The ability of the Phanerochaete chrysosporium for degradation of the cyclodiene
microbial isolate to degrade endosulfan in natural soil con- pesticide endosulfan. Appl. Environ. Microbiol. 1996, 62, 593–
ditions, where other sulfur sources are also present needs to 600.
be investigated. The use of microorganisms for bioremedia- [16] Shetty, P.K.; Mitra, J.; Murthy, N.B.K.; Namitha, K.K.; Savitha,
K.N.; Raghu, K. Biodegradation of cyclodiene insecticide endosul-
tion requires an understanding of all the physiological and fan by Mucor thermo-hyalospora MTCC 1384. Curr. Sci. 2000, 79,
biochemical aspects involved in chemical transformations. 1381–1383.
Future research will focus on identification and isolation [17] Lee, S.E.; Kim, J.S.; Kennedy, I.R.; Park, J.W.; Kwon, G.S.; Koh,
of the enzymes involved, including a study of their regu- S.C.; Kim, J.E. Biotransformation of an organochlorine insecticide,
lation and optimization of conditions. Modern molecular endosulfan, by Anabaena species. J. Agric. Food Chem. 2003, 51(5),
1336–40.
approaches developed for remediation would be suitably [18] Siddique, T.; Okeke, B.C.; Arshad, M.; Frankenberger, W.T. Jr. En-
applied to achieve these objectives. richment and isolation of endosulfan degrading microorganisms. J
Environ Qual. 2003, 32, 47–54.
[19] Hussain, S.; Arshad, M.; Saleem, M.; Khalid, A. Biodegradation of
Acknowledgements α - and β -endosulfan by soil bacteria. Biodegradation 2007, 18(6),
731–740.
The first author gratefully acknowledges the University [20] Katayama, A.; Matsumura, F. Degradation of organochlorine pes-
Grants Commission for providing fellowship during the ticides particularly endosulfan by Trichoderma harzianum. Environ.
Toxicol. Chem. 1993, 12, 1059–1065.
tenure of the research work at the Indian Agricultural Re- [21] Shivaramaiah, H. M.; Kennedy, I. R. Biodegradation of endosulfan
search Institute. by a soil bacterium. J. Environ. Sci. Health Part B. 2006, 41, 895–
905.
[22] Kwon, G.S.; Kim, J.E.; Kim, T.K.; Sohn, H.Y.; Koh, S.C.; Shin, K.S.;
References Kim, D.G. Klebsiella pneumoniae KE-1 degrades endosulfan with-
out formation of the toxic metabolite, endosulfan sulfate. FEMS
[1] United States Department of Health and Human Services. Toxi- Microbiol. Lett. 2002, 215, 255–259.
cological Profile for Endosulfan; Agency for Toxic Substances and [23] Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic
Disease Registry: Atlanta, GA, 1990. local alignment search tool. J. Mol. Biol. 1990, 215, 403–410.

672 Kalyani et al.
[24] Tabatabhai, M.A.; Bremner, J.M. Aryl sulfatase activity of soils. tional evidence for the irreversible conversion of β- to α-endosulfan.
Soil. Sci. Soc. Am. Proc. 1970, 34, 427–429. J Agric Food Chem. 2001, 49, 5372–5376.
[25] Josey, D.P.; Beynon, J. L.; Johnston, A.W.B.; Beringer, J.E. Strain [30] Dorough, H.W.; Huhtanen, K.; Marshall, T.C.; Bryant, H.E.
identification in Rhizobium using intrinsic antibiotic resistance. J. Fate of endosulfan in rats and toxicological considerations
Appl. Microbiol. 2008, 46(2), 343–350. of apolar metabolites. Pest. Biochem. Physiol. 1978, 8, 241–
[26] Van Woerden, H.F. Organic sulfites. Chem. Rev. 1963, 63, 557–571. 252.
[27] Walse, S.S.; Scott, G.I.; Ferry, J.L. Stereo selective degradation of [31] Radehaus, P.M.; Schmidt, S.K. Characterization of a novel
aqueous endosulfan in modular estuarine mesocosms. J. Environ. Pseudomonas sp. that mineralizes high concentrations of pen-
Monit. 2003, 5, 373–379. tachlorophenol. Appl. Environ. Microbiol. 1992, 58, 2879–
[28] Singh, N.C.; Dasgupta, T.P.; Roberts, E.V.; Mansingh, A. Dynamics 2885.
of pesticides in tropical conditions. 1. Kinetic studies of volatiliza- [32] Filonov, A.E.; Puntus, I.F.; Karpov, A.V.; Kosheleva, I.A.; Akhme-
tion, hydrolysis and photolysis of dieldrin and alpha and beta- tov, L.I.; Yonge, D.R.; Petersen, J.N.; Boronin, A.M. Assessment
endosulfan. J. Agric. Food Chem. 1991, 39, 575–579. of naphthalene biodegradation efficiency of Pseudomonas and
[29] Schmidt, W.F.; Bilboulian, S.; Rice, C.P.; Fettinger, J.C.; McConnell, Burkholderia strains tested in soil model systems. J. Chem. Tech-
L.L.; Hapeman, C. J. Thermodynamic, spectroscopic and computa- nol. Biotechnol. 2006, 81, 216–224.

Endosulfan does not bio accumulate due to microbes in soil- report

Empfohlen

Empfohlen

Weitere ähnliche Inhalte

Was ist angesagt?

Was ist angesagt? (20)

Andere mochten auch

Andere mochten auch (6)

Ähnlich wie Endosulfan does not bio accumulate due to microbes in soil- report

Ähnlich wie Endosulfan does not bio accumulate due to microbes in soil- report (20)

Kürzlich hochgeladen

Kürzlich hochgeladen (20)

Endosulfan does not bio accumulate due to microbes in soil- report