SlideShare ist ein Scribd-Unternehmen logo
1 von 35
Summer 2011 Cole Steber Knysnaand Monotropauniflora
Johannesburg, South Africa
Knysna, South Africa
Knysna Volunteer House
Two separate worlds
The People
Knysna Hospital
The “Theatre”
The Township
Sinetemba
Mad About Art
Tackle Africa
Fun Day
Exploring Knysna
Goodbye South Africa
Summer Research Project with monotropauniflora Microsatellite Primer Development Sampling trip Back in Danville…
Microsatellite(n): sequence composed of tandem repeat units usually two to five nucleotides in length (TC)12 CTAGGAGAGGTATATATGGGTCTTAAAATGTTTTAGATCATTATTTCAGATCTAAGTTCTCTCTCTCTCTCTCTCTCTCTCTCCACTTGAAGAACTCTAGACCTCTCTGTCCCTTCTCTTTTGATTTTGAGGTGGTTCCA
Microsatellite as a Tool Fine scale population analyses  Highly variable DNA Polymerase stutters Repeat units added or deleted DNA repair mechanisms not 100% effective http://studentreader.com/files/repeat_microsatellite.png
Monotropauniflora(Indian Pipe) Uniflora has large variation in color and in blooming periods Variation is evident across sympatric and allopatric populations
Characteristics Heterotrophic Grows 10-30 cm Predominantly underground Mycorrhizal Associates Russula Lactarius
Plant and Fungus Relationship 90% of plants have some association with mycorrhizal fungi Mutualism
Explanation for Variation Speciation Temporal reproductive isolation Cryptic speciation through mycorhizal fungal associate interactions Null hypothesis: No genetic differentiation among blooming periods
Final Progress Future Research:  Genotyping the populations of extracted DNA Study associations of mycorrhizal associates
Genetic Fingerprint Combine 10 different loci to get one fingerprint per individual.
Field Biology in New England
To the Coast
In Search of Beach Plum
Pristine Landscape
The G-Gnomes
Long Island, New York
A Perfect Sunset
Jersey Shore
Exploration of the Medical Field Assisted career decision making	 Exploration of Scientific Research Learned how scientific process works Gained an appreciation for conservation and nature Summer Enrichment
To the James Grahm Brown Foundation and all my mentors who assisted and made my summer experience possible A Sincere Thank You

Weitere ähnliche Inhalte

Ähnlich wie Kynsna and Monotropa Uniflora

Eight Primate Research
Eight Primate ResearchEight Primate Research
Eight Primate ResearchJan Champagne
 
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...Sryahwa Publications
 
Cassava green mite a case study of biological control
Cassava green mite   a case study of biological controlCassava green mite   a case study of biological control
Cassava green mite a case study of biological controlJawwad Mirza
 
Gil ecn2013 ppt
Gil ecn2013 pptGil ecn2013 ppt
Gil ecn2013 pptECNOfficer
 
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...Sam Herniman
 
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...Trinidad Mendez
 
Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...Nicole Angeli
 
Cassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - CopyCassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - CopyJawwad Mirza
 

Ähnlich wie Kynsna and Monotropa Uniflora (9)

Eight Primate Research
Eight Primate ResearchEight Primate Research
Eight Primate Research
 
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...
 
Cassava green mite a case study of biological control
Cassava green mite   a case study of biological controlCassava green mite   a case study of biological control
Cassava green mite a case study of biological control
 
Gil ecn2013 ppt
Gil ecn2013 pptGil ecn2013 ppt
Gil ecn2013 ppt
 
1334007 monika
1334007 monika1334007 monika
1334007 monika
 
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
 
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
 
Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...
 
Cassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - CopyCassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - Copy
 

Mehr von Brown Fellows Program

When Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
When Truths Collide Ways of Approaching The Religious Other by Jeannie CorbittWhen Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
When Truths Collide Ways of Approaching The Religious Other by Jeannie CorbittBrown Fellows Program
 
Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...
Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...
Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...Brown Fellows Program
 
Up, Up, and Away a Three Part Project by Kathryn Ashby
Up, Up, and Away a Three Part Project by Kathryn AshbyUp, Up, and Away a Three Part Project by Kathryn Ashby
Up, Up, and Away a Three Part Project by Kathryn AshbyBrown Fellows Program
 
Understanding and Preventing the Obesity Epidemic by Albert Anastasio
Understanding and Preventing the Obesity Epidemic by Albert AnastasioUnderstanding and Preventing the Obesity Epidemic by Albert Anastasio
Understanding and Preventing the Obesity Epidemic by Albert AnastasioBrown Fellows Program
 
Stochastic Modeling and Simulation of Football by David Newton
Stochastic Modeling and Simulation of Football by David NewtonStochastic Modeling and Simulation of Football by David Newton
Stochastic Modeling and Simulation of Football by David NewtonBrown Fellows Program
 
Selfless in South America by Rachel Geil
Selfless in South America by Rachel GeilSelfless in South America by Rachel Geil
Selfless in South America by Rachel GeilBrown Fellows Program
 
Medical Perspectives and Volunteering in Peru by Joey Shaw
Medical Perspectives and Volunteering in Peru by Joey ShawMedical Perspectives and Volunteering in Peru by Joey Shaw
Medical Perspectives and Volunteering in Peru by Joey ShawBrown Fellows Program
 
Materials Research in Ljubljana, Slovenia by Luke Guhy
Materials Research in Ljubljana, Slovenia  by Luke GuhyMaterials Research in Ljubljana, Slovenia  by Luke Guhy
Materials Research in Ljubljana, Slovenia by Luke GuhyBrown Fellows Program
 
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...Brown Fellows Program
 
Latin Epigraphy and Louisville by Matt Hughes
Latin Epigraphy and Louisville by Matt HughesLatin Epigraphy and Louisville by Matt Hughes
Latin Epigraphy and Louisville by Matt HughesBrown Fellows Program
 
Internship at the Rancho Santa Ana Botanic Garden by Katherine Roland
Internship at the Rancho Santa Ana Botanic Garden by Katherine RolandInternship at the Rancho Santa Ana Botanic Garden by Katherine Roland
Internship at the Rancho Santa Ana Botanic Garden by Katherine RolandBrown Fellows Program
 
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...Brown Fellows Program
 
Internship at the Bureau of Labor Statistics by Ashley El Rady
Internship at the Bureau of Labor Statistics by Ashley El RadyInternship at the Bureau of Labor Statistics by Ashley El Rady
Internship at the Bureau of Labor Statistics by Ashley El RadyBrown Fellows Program
 
Intensive Arabic at the University of Texas by Madeleine Loney
Intensive Arabic at the University of Texas by Madeleine LoneyIntensive Arabic at the University of Texas by Madeleine Loney
Intensive Arabic at the University of Texas by Madeleine LoneyBrown Fellows Program
 
IARC Takes on Cervical Cancer by Allison Grant
IARC Takes on Cervical Cancer by Allison GrantIARC Takes on Cervical Cancer by Allison Grant
IARC Takes on Cervical Cancer by Allison GrantBrown Fellows Program
 
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan DurhamHealth and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan DurhamBrown Fellows Program
 
Government Policy in the World of Business by Jessica Cruzan
Government Policy in the World of Business by Jessica CruzanGovernment Policy in the World of Business by Jessica Cruzan
Government Policy in the World of Business by Jessica CruzanBrown Fellows Program
 
From Panama To Uganda by Billy Menkhaus
From Panama To Uganda by Billy MenkhausFrom Panama To Uganda by Billy Menkhaus
From Panama To Uganda by Billy MenkhausBrown Fellows Program
 
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...Brown Fellows Program
 

Mehr von Brown Fellows Program (20)

When Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
When Truths Collide Ways of Approaching The Religious Other by Jeannie CorbittWhen Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
When Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
 
Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...
Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...
Using Brain Stimulation and Imaging Techniquues to Study Human Movement by Jo...
 
Up, Up, and Away a Three Part Project by Kathryn Ashby
Up, Up, and Away a Three Part Project by Kathryn AshbyUp, Up, and Away a Three Part Project by Kathryn Ashby
Up, Up, and Away a Three Part Project by Kathryn Ashby
 
Understanding and Preventing the Obesity Epidemic by Albert Anastasio
Understanding and Preventing the Obesity Epidemic by Albert AnastasioUnderstanding and Preventing the Obesity Epidemic by Albert Anastasio
Understanding and Preventing the Obesity Epidemic by Albert Anastasio
 
Stochastic Modeling and Simulation of Football by David Newton
Stochastic Modeling and Simulation of Football by David NewtonStochastic Modeling and Simulation of Football by David Newton
Stochastic Modeling and Simulation of Football by David Newton
 
Selfless in South America by Rachel Geil
Selfless in South America by Rachel GeilSelfless in South America by Rachel Geil
Selfless in South America by Rachel Geil
 
Medical Perspectives and Volunteering in Peru by Joey Shaw
Medical Perspectives and Volunteering in Peru by Joey ShawMedical Perspectives and Volunteering in Peru by Joey Shaw
Medical Perspectives and Volunteering in Peru by Joey Shaw
 
Materials Research in Ljubljana, Slovenia by Luke Guhy
Materials Research in Ljubljana, Slovenia  by Luke GuhyMaterials Research in Ljubljana, Slovenia  by Luke Guhy
Materials Research in Ljubljana, Slovenia by Luke Guhy
 
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
 
Latin Epigraphy and Louisville by Matt Hughes
Latin Epigraphy and Louisville by Matt HughesLatin Epigraphy and Louisville by Matt Hughes
Latin Epigraphy and Louisville by Matt Hughes
 
Internship at the Rancho Santa Ana Botanic Garden by Katherine Roland
Internship at the Rancho Santa Ana Botanic Garden by Katherine RolandInternship at the Rancho Santa Ana Botanic Garden by Katherine Roland
Internship at the Rancho Santa Ana Botanic Garden by Katherine Roland
 
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
 
Internship at the Bureau of Labor Statistics by Ashley El Rady
Internship at the Bureau of Labor Statistics by Ashley El RadyInternship at the Bureau of Labor Statistics by Ashley El Rady
Internship at the Bureau of Labor Statistics by Ashley El Rady
 
Intensive Arabic at the University of Texas by Madeleine Loney
Intensive Arabic at the University of Texas by Madeleine LoneyIntensive Arabic at the University of Texas by Madeleine Loney
Intensive Arabic at the University of Texas by Madeleine Loney
 
IARC Takes on Cervical Cancer by Allison Grant
IARC Takes on Cervical Cancer by Allison GrantIARC Takes on Cervical Cancer by Allison Grant
IARC Takes on Cervical Cancer by Allison Grant
 
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan DurhamHealth and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
 
Government Policy in the World of Business by Jessica Cruzan
Government Policy in the World of Business by Jessica CruzanGovernment Policy in the World of Business by Jessica Cruzan
Government Policy in the World of Business by Jessica Cruzan
 
From Panama To Uganda by Billy Menkhaus
From Panama To Uganda by Billy MenkhausFrom Panama To Uganda by Billy Menkhaus
From Panama To Uganda by Billy Menkhaus
 
Editorial Intern by Sara Loy
Editorial Intern by Sara LoyEditorial Intern by Sara Loy
Editorial Intern by Sara Loy
 
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
 

Kürzlich hochgeladen

Sicily Holidays Guide Book: Unveiling the Treasures of Italy's Jewel
Sicily Holidays Guide Book: Unveiling the Treasures of Italy's JewelSicily Holidays Guide Book: Unveiling the Treasures of Italy's Jewel
Sicily Holidays Guide Book: Unveiling the Treasures of Italy's JewelTime for Sicily
 
5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)
5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)
5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)Mazie Garcia
 
Inspirational Quotes About Italy and Food
Inspirational Quotes About Italy and FoodInspirational Quotes About Italy and Food
Inspirational Quotes About Italy and FoodKasia Chojecki
 
How Safe Is It To Witness Whales In Maui’s Waters
How Safe Is It To Witness Whales In Maui’s WatersHow Safe Is It To Witness Whales In Maui’s Waters
How Safe Is It To Witness Whales In Maui’s WatersMakena Coast Charters
 
Aeromexico Airlines Flight Name Change Policy
Aeromexico Airlines Flight Name Change PolicyAeromexico Airlines Flight Name Change Policy
Aeromexico Airlines Flight Name Change PolicyFlyFairTravels
 
Haitian culture and stuff and places and food and travel.pptx
Haitian culture and stuff and places and food and travel.pptxHaitian culture and stuff and places and food and travel.pptx
Haitian culture and stuff and places and food and travel.pptxhxhlixia
 
69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)
69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)
69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)Escort Service
 
Authentic Travel Experience 2024 Greg DeShields.pptx
Authentic Travel Experience 2024 Greg DeShields.pptxAuthentic Travel Experience 2024 Greg DeShields.pptx
Authentic Travel Experience 2024 Greg DeShields.pptxGregory DeShields
 
Moroccan Architecture presentation ( Omar & Yasine ).pptx
Moroccan Architecture presentation ( Omar & Yasine ).pptxMoroccan Architecture presentation ( Omar & Yasine ).pptx
Moroccan Architecture presentation ( Omar & Yasine ).pptxOmarOuazzani1
 
a presentation for foreigners about how to travel in Germany.
a presentation for foreigners about how to travel in Germany.a presentation for foreigners about how to travel in Germany.
a presentation for foreigners about how to travel in Germany.moritzmieg
 
Where to Stay in Lagos, Portugal.pptxasd
Where to Stay in Lagos, Portugal.pptxasdWhere to Stay in Lagos, Portugal.pptxasd
Where to Stay in Lagos, Portugal.pptxasdusmanghaniwixpatriot
 
Italia Lucca 1 Un tesoro nascosto tra le sue mura
Italia Lucca 1 Un tesoro nascosto tra le sue muraItalia Lucca 1 Un tesoro nascosto tra le sue mura
Italia Lucca 1 Un tesoro nascosto tra le sue murasandamichaela *
 
Revolutionalizing Travel: A VacAI Update
Revolutionalizing Travel: A VacAI UpdateRevolutionalizing Travel: A VacAI Update
Revolutionalizing Travel: A VacAI Updatejoymorrison10
 
Hoi An Ancient Town, Vietnam (越南 會安古鎮).ppsx
Hoi An Ancient Town, Vietnam (越南 會安古鎮).ppsxHoi An Ancient Town, Vietnam (越南 會安古鎮).ppsx
Hoi An Ancient Town, Vietnam (越南 會安古鎮).ppsxChung Yen Chang
 
question 2: airplane vocabulary presentation
question 2: airplane vocabulary presentationquestion 2: airplane vocabulary presentation
question 2: airplane vocabulary presentationcaminantesdaauga
 

Kürzlich hochgeladen (17)

Sicily Holidays Guide Book: Unveiling the Treasures of Italy's Jewel
Sicily Holidays Guide Book: Unveiling the Treasures of Italy's JewelSicily Holidays Guide Book: Unveiling the Treasures of Italy's Jewel
Sicily Holidays Guide Book: Unveiling the Treasures of Italy's Jewel
 
5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)
5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)
5S - House keeping (Seiri, Seiton, Seiso, Seiketsu, Shitsuke)
 
Inspirational Quotes About Italy and Food
Inspirational Quotes About Italy and FoodInspirational Quotes About Italy and Food
Inspirational Quotes About Italy and Food
 
Enjoy ➥8448380779▻ Call Girls In Sector 74 Noida Escorts Delhi NCR
Enjoy ➥8448380779▻ Call Girls In Sector 74 Noida Escorts Delhi NCREnjoy ➥8448380779▻ Call Girls In Sector 74 Noida Escorts Delhi NCR
Enjoy ➥8448380779▻ Call Girls In Sector 74 Noida Escorts Delhi NCR
 
How Safe Is It To Witness Whales In Maui’s Waters
How Safe Is It To Witness Whales In Maui’s WatersHow Safe Is It To Witness Whales In Maui’s Waters
How Safe Is It To Witness Whales In Maui’s Waters
 
Aeromexico Airlines Flight Name Change Policy
Aeromexico Airlines Flight Name Change PolicyAeromexico Airlines Flight Name Change Policy
Aeromexico Airlines Flight Name Change Policy
 
Haitian culture and stuff and places and food and travel.pptx
Haitian culture and stuff and places and food and travel.pptxHaitian culture and stuff and places and food and travel.pptx
Haitian culture and stuff and places and food and travel.pptx
 
69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)
69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)
69 Girls ✠ 9599264170 ✠ Call Girls In East Of Kailash (VIP)
 
Authentic Travel Experience 2024 Greg DeShields.pptx
Authentic Travel Experience 2024 Greg DeShields.pptxAuthentic Travel Experience 2024 Greg DeShields.pptx
Authentic Travel Experience 2024 Greg DeShields.pptx
 
Moroccan Architecture presentation ( Omar & Yasine ).pptx
Moroccan Architecture presentation ( Omar & Yasine ).pptxMoroccan Architecture presentation ( Omar & Yasine ).pptx
Moroccan Architecture presentation ( Omar & Yasine ).pptx
 
a presentation for foreigners about how to travel in Germany.
a presentation for foreigners about how to travel in Germany.a presentation for foreigners about how to travel in Germany.
a presentation for foreigners about how to travel in Germany.
 
Where to Stay in Lagos, Portugal.pptxasd
Where to Stay in Lagos, Portugal.pptxasdWhere to Stay in Lagos, Portugal.pptxasd
Where to Stay in Lagos, Portugal.pptxasd
 
Italia Lucca 1 Un tesoro nascosto tra le sue mura
Italia Lucca 1 Un tesoro nascosto tra le sue muraItalia Lucca 1 Un tesoro nascosto tra le sue mura
Italia Lucca 1 Un tesoro nascosto tra le sue mura
 
Revolutionalizing Travel: A VacAI Update
Revolutionalizing Travel: A VacAI UpdateRevolutionalizing Travel: A VacAI Update
Revolutionalizing Travel: A VacAI Update
 
Enjoy ➥8448380779▻ Call Girls In Sector 62 Noida Escorts Delhi NCR
Enjoy ➥8448380779▻ Call Girls In Sector 62 Noida Escorts Delhi NCREnjoy ➥8448380779▻ Call Girls In Sector 62 Noida Escorts Delhi NCR
Enjoy ➥8448380779▻ Call Girls In Sector 62 Noida Escorts Delhi NCR
 
Hoi An Ancient Town, Vietnam (越南 會安古鎮).ppsx
Hoi An Ancient Town, Vietnam (越南 會安古鎮).ppsxHoi An Ancient Town, Vietnam (越南 會安古鎮).ppsx
Hoi An Ancient Town, Vietnam (越南 會安古鎮).ppsx
 
question 2: airplane vocabulary presentation
question 2: airplane vocabulary presentationquestion 2: airplane vocabulary presentation
question 2: airplane vocabulary presentation
 

Kynsna and Monotropa Uniflora