SlideShare a Scribd company logo
1 of 6
Download to read offline
International Journal of Trend in Scientific Research and Development (IJTSRD)
Volume 5 Issue 5, July-August 2021 Available Online: www.ijtsrd.com e-ISSN: 2456 – 6470
@ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1243
Isolation and Molecular Characterization of
Pullulanase Producing Bacillus Strains
Nwozor, N. C; Ogbo, F. C
Department of Appalled Microbiology and Brewing, Nnamdi Azikiwe University, Awka, Nigeria
ABSTRACT
Pullulanase is an extracellular carbohydrase responsible for the
hydrolysis of pullulan and amylopectin toproduce maltotriose. The
product maltotriose is used in detergent industry, bakeryindustryand
in the production of biotechnological products. In the present
investigation pullulanase producing bacillus species were isolated
and characterized using different biochemical and molecular
methodologies. The isolates were identified as Bacillus cereus and
Bacillus thuringiensis respectively. The pullulanase acivity was
higher in Bacillus cereus, 0.62U/ml than B. thuringiensis, 0.53U/ml.
This research reveals that pullulanase enzyme production from these
Bacillus species shows great promise for use in industrial processes.
KEYWORDS: Pullulanase, Bacillus, Molecular, Characterization
How to cite this paper: Nwozor, N. C |
Ogbo, F. C "Isolation and Molecular
Characterization of Pullulanase
Producing Bacillus Strains" Published in
International
Journal of Trend in
Scientific Research
and Development
(ijtsrd), ISSN: 2456-
6470, Volume-5 |
Issue-5, August
2021, pp.1243-
1248, URL:
www.ijtsrd.com/papers/ijtsrd45051.pdf
Copyright © 2021 by author (s) and
International Journal of Trend in
Scientific Research and Development
Journal. This is an
Open Access article
distributed under the
terms of the Creative Commons
Attribution License (CC BY 4.0)
(http://creativecommons.org/licenses/by/4.0)
INTRODUCTION
Pullulanase is an extracellular carbohydrase which
debranches pullulan. They are also called
debranching enzymes and have been widely used to
hydrolyse 1,6-glucosidic linkages in starch,
amylopectin, pullulan and other oligosaccharides to
produce maltotriose [1].
Pullulanase is of great significance due to its wide
area of potential application. It is a very potent
enzyme for degradation of starch to glucose and
maltose. It has been reported that Pullulanase enzyme
is used on a large scale in glucose and maltose syrup
industries. It is widely used in industries in the
Saccharification of Starch. It converts starch into
glucose and maltose which are used in the production
of glucose syrup more efficiently [2]. The enzyme is
used in detergent industry, baking industryand for the
production of cyclodextrins which in turn is used in
the production of Biotechnological products and low
calorie beer [3].
A number of pullulanase have been produced and
characterized from bacterial sources. Factors such as
temperature, substrate concentration, agitation and
time have been reported to greatly affect its
production [4]. Pullulanase type I has been
characterised from mesophilic bacteria such as
Aerobacter aerogenes [5], Bacillus acidopullulyticus,
Klebsiella pneumonia and Streptomyces sp. Moderate
thermophilic gram positive bacteria such as Bacillus
flavocaldarius, Bacillus thermoleovorans,
Clostridium sp, and Thermos caldophilus also have
ability to secrete pullulanase type I. Pullulanase type I
from hyperthermophilic bacterium Fervidobacterium
pennavorans, has also been reported.[6]. The aim of
this study is the isolation and molecular
characterization of pullulanase producing Bacillus
strains.
MATERIALS AND METHODOLOGY
Screening, Isolation and identification of
microorganism for the production of pullulanase
enzyme
Collection of soil sample: Soil sample from different
flour mills was collected and 1g of sample was
weighed and a suspension was prepared using 10ml
IJTSRD45051
International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470
@ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1244
of saline. It was allowed to settle down and the clear
top layer in the tube was used as inoculums.
Isolation of organism by using specific media: The
pullulanase media was sterilized and 500μl of the
inoculum was inoculated through pour plate method.
The plates were Incubated at 37ºC for two days and
observed for the growth of microorganism in each
plate. The colonies were marked; pure cultures of
those isolated colonies were maintained.
Screening for the production of pullulanase
Fresh isolates that showed high pullulan degradation
efficiency were inoculated in culture medium, which
consisted of: {(g/l) cassava flour (10), NaCl (2),
MgSO4.7H2O (0.1), K2HPO4 (0.17),
KH2PO4.7H2O (0.12) and NaNO3 (5), pH 7} .The
flask was loaded on a rotary shaker incubator at a
speed of 200 rpm at 37°C for 48 h. The cells were
removed from the culture medium by
centrifugation at4,000 rpm for 20 min..Supernatant
was collected and used for the pullulanase assay.
Pullulanase assay was done as described by [9].
Pullulanase assay was determined by measuring the
release of reducing sugar from pullulan. The reaction
mixture containing 0.5 ml of crude enzyme and
0.5ml of (1% pullulan in 0.2M sodium acetate
buffer- pH 5.0) was incubated at 40°C for 30 min.
The reaction was stopped by the addition of 2 ml of
3, 5-dinitrosalicylic acid, followed by boiling for 10
min to develop color. The absorbance of the mixture
was measured at 540 nm, and enzyme activity was
calculated.
Identification of microorganisms by
morphological and biochemical test The
colony characteristics of the test organism was
observed and recorded.
Gram staining: A thin smear of the pure culture was
made on a clean, grease free glass slide, heat fixed.
Crystal violet was added, left for 1min followed by
water wash, added grams iodine for 1min and
washed, 70% alcohol for 30 sec, washed and added a
counter stain saffrainin for 30 sec and observed under
oil immersion.
Methyl red – Voges proskauer: MRVP broth was
autoclaved and about 10ml of broth was taken in four
test tubes. Labelled as MR control, MR test, VP
control, VP test. The test organism was inoculated
into the MR test and VP test tubes, all the tubes were
incubated at 37ºC for 24 – 48 hrs. After the
incubation time methyl red solution was added to the
MR test and control tubes. For VP, Barrets reagent I
(40% KOH) and Barrets reagent II (α-naphthol in
95ml of 95% alcohol) was added and observed for the
results.
Catalase test: The container containing Hydrogen
peroxide solution was shaken to expel the
dissolved oxygen. One drop of the solution was
dropped on a clean glass slide followed by the
addition of a loop-full 24-hour old inoculum on the
slide. The presence of gas bubbles indicated a
positive test while the absence of gas bubbles
indicated negative reaction.
Citrate utilization: The media (Simons citrate
media) was prepared, autoclaved and two slants were
prepared out of which one was labelled as control and
another as test. The tube (test) was inoculated with
the test organism and incubated for 2 days to observe
the results.
Spore stain
A drop of distilled water was placed on a clean
grease free glass slide and a colony from the isolate
was picked with a sterilized wire loop and
emulsified. The glass slide was passed over the flame
three times to heat fix. The smear was flooded with
malachite green and allowed to heat for 3-5
minutes, the stain was rinsed off with tap water.
Safranin was used to counter stain the smear and
allowed to stand for 60 seconds. The slide was then
rinsed to remove the secondary stain and allowed to
air dry. It was observed under the microscope using x
100 objective (oil immersion). The vegetative cells
appeared pink, while the spores appeared green in
colour.
Starch hydrolysis
A starch agar was prepared, containing : g/500ml:
peptone (5.0 ), sodium chloride: (5.0), yeast extract
(1.5), beef extract (1.5), soluble starch (1.5) and
agar-agar (15). A single was streak inoculation of
the organisms was made at the centre of the
labeled plates. The plates were incubated for 48 hours
at 37oC. Following incubation, the plates were
flooded with iodine solution using a dropper and
allowed to stand for 30 seconds. Excess iodine was
poured off and the plates were examined for clear
zones around the bacterial growth. a positive test was
indicated by clear zones around the line of growth
showing that the organism hydrolyzed the starch.
Motility Test
A semisolid agar was prepared in a test tube and
sterilized by autoclaving. It was allowed to cool and
then it was inoculated with the test organism using a
straight wire by making a stab down the centre of the
tube to about half the depth of the medium. It was
incubated at 37oC and examined at time intervals: 12
hours, 24, 36 and 48 hours . the non motile bacteria
had growth confined to the stab line, having sharply
defined margins and leaving the surrounding medium
International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470
@ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1245
very transparent. The motile bacteria didn‘t grow on
a confined stab line but had hazy growth that spread
throughout the medium, rendering it slightly opaque.
Molecular identification of the pullulanase
producing isolates
Extraction of DNA
Hundred (100) mg of the bacterial cell was added to
200µl of isotonic buffer. The solution was mixed in a
bashing lysis tube. Seven hundred and fifty (750) µl
of lysis solution was added to the tube. The resulting
solution was filled with bashing beads and mixed
using a vortex mixer for five minutes. The solution
contained in the tube was then centrifuged for 1
minute at 10000 x g using a microcentrifuge.400 µl
of the supernatant was transferred to a spin filter in a
collection tube and centrifuged at 7,000 x g for 1
minute. One thousand, two hundred (1200) µl of
bacterial DNA binding buffer was added to the
filtrate in the collection tube. 800µl of the mixture
was transferred to a spin column in a collection tube
and centrifuged at 10,000 x g for 1 minute, this
procedure was repeated then, 200 µl of DNA pre-
wash buffer was added to the zymo spin in a new
collection tube and centrifuged at 10,000 x g for 1
minute. Then, 500 µl of the bacterial DNA wash
buffer was added to the Zymo spin column and
centrifuged again at 10,000 x g for 1 minute. The
zymo spin column was transferred to a clean 1.5ml
microcentrifuge tube and100 µl of DNA elution
buffer was added directly to the column matrix. It
was centrifuged at 10,000 x g for 30 seconds to elute
the DNA. The DNA was then suitable for PCR and
other downstream applications.
Amplification of DNA by polymerase chain
reaction (PCR)
The PCR cocktail mix consisted of: 2.5µl of 10x
PCR buffer, 1µl if 25mM MgCl2 ,1µl each of
forward primer (27F
TCCTCCGCTTATTGATATGS) and reverse
primer(1535R
GGAAGTAAAAGTCGTAACAAGG), 1µl of
DMSO, 2µl of 2.5m MDNTPs, 0.1µl of 5 µ/µl Taq
DNA polymerase, and 3µl of 10ng/µl DNA. The
total reaction volume was made up to 25µl using
13.4µl nuclease free water. Initial denaturation of the
DNA was done at 94o
C for 5minutes, followed by 36
cycles of denaturation for 94oC for 30 seconds,
annealing was done at 54oC for 30 seconds and
elongation was done at 72oC for 45 seconds. This
was followed immediately by a final elongation at
72oC for 7 minutes and its hold-temperature was at
10oC. Amplified fragments were visualized onsafe-
view stained 1.5% agarose electrophoresis gels.
The size of the amplicon is about 650bp and the
DNA ladder from NEB.(IITA, Ibadan).
Sanger Sequencing of Amplified DNA
A GeneAmp PCR system 9700 was used for the
sequencing. The tubes, which contained the products
from the PCR amplification were placed in a thermal
cycler and set to the correct volume. An initial
denaturation was performed at 96oC for 1 minute.
Then, the following was repeated for 25 cycles: a
rapid thermal ramp at 96o
C for 10 seconds, a rapid
thermal ramp of 50oC for 5 seconds, a rapid thermal
ramp of 60oC for 10 minutes.
In order to purify, the 96-well reaction plate was
removed from the thermal cycler and briefly spun.
Five, 5µl of 125mM EDTA was added to each
well. 60µl of 100% ethanol was added to each
well. The plate was sealed with aluminium tape
and mixed by inverting it four times. It was then
incubated at room temperature for 15 minutes. A
Beckman Allegra 6A centrifuge was used to spin the
plate at 1650 x g for 45 minutes at 4oC. The plate
was inverted and spinned up to 185 x g, then
removed from the centrifuge and 60µl of 70%
ethanol was added to each well. The mixture was
spun at 1650 x g for 15 minutes at 4o
C. The plate was
inverted and spun up to 185 x g for 1 minute, then it
was removed from the centrifuge and stored at 4oC.
RESULTS AND DISCUSSION
Isolation, morphological and biochemical
identification of pullulanase producing bacteria:
Forty bacterial isolates were obtained from the
different cassava processing sites. The identification
of the isolates obtained from different cassava
processing sites which was done through primary
screening on pullulan media showed five of the
isolates to possess pullulan degradation potential by
forming zones of clearing on the pullulan media
plates. These isolates were identified by employing
morphological and biochemical identification test
procedures, which revealed the presumptive organism
to be Bacillus sp (Table 1). Similar reports have been
made [10], where different Bacillus species showed
varying degrees of pullulan degradation. Cassava
wastes from processing sites are rich sources of
different microorganisms with many industrial
advantages.
International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470
@ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1246
Table 1: Biochemical Identification of pullulanase producing isolates
Isolate No Pul Degrd(mm) Starch hydrolysis (mm) Catalase VP Motility Citrate
Bp1 9.00 10.00 + - - +
Bp2 15.00 15.00 + + + -
Bp3 13.00 11.00 + + + +
Bp4 10.00 13.00 + - - +
Bp5 6.00 9.00 + + - -
Pullulanase Production and Assay
The production and assay of pullulanase for the isolates (Table 2) which showed pullulan degradation potential
revealed isolate BP2 and BP3 as the isolates with the highest pullulanase activity (0.62U/ml and 0.53U/ml).
These two isolates were selected for molecular identification. [2] reported a similar findings in which Bacillus sp
was found to produce pullulanase enzyme in large quantity.
Fig 1: pullulanse Quantity in choice isolates
Molecular identification of pullulanase producing bacteria
In 1% agarose gel electrophoresis, 1500bp band was obtained by PCR amplification (Plate 1). Also partial
sequencing of 16SrRNA was done to identify the isolate. BLAST analysis of the sequence data revealed that the
isolates showed closest similarity (99%) with Bacillus thuringiensis and Bacillus cereus.
Plate 1: PCR on gel electrophoresis for B. cereus and B. thuringiensis
International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470
@ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1247
Phylogenetic analysis: the phyletic relationship between the Bacillus species. Bacillus cereus was clustered
towards B. mycoides, while B. cereus clustered towards B. weidmanni. This shows great similaritybetween the
species (Fig 1). The Bacillus species possessed separate branches, representing different species of different
strains within a group of Bacillus genus, therefore indicating a level of singularity in the different identities.
NR 026140.1 Bacillus clausii strain DSM 8716 16S ribosomal RNA, partial sequence
NR 025446.1 Bacillus halodurans strain DSM 497 16S ribosomal RNA, partial sequence
NR 112056.1 Bacillus halodurans strain ATCC 27557 16S ribosomal RNA, partial sequence
NR 041523.1 Bacillus coagulans strain NBRC 12583 16S ribosomal RNA, partial sequence
NR 118954.1 Bacillus coagulans strain NCDO 1761 16S ribosomal RNA, partial sequence
NR 115580.1 Bacillus coagulans strain JCM 2257 16S ribosomal RNA, partial sequence
NR 118950.1 Bacillus amyloliquefaciens DSM 7 strain ATCC 23350 16S ribosomal RNA, partial sequence
NR 074923.1 Bacillus licheniformis strain ATCC 14580 16S ribosomal RNA, partial sequence
NR 113588.1 Bacillus licheniformis strain NBRC 12200 16S ribosomal RNA, partial sequence
NR 118996.1 Bacillus licheniformis strain DSM 13 16S ribosomal RNA, partial sequence
NR 116023.1 Bacillus licheniformis strain BCRC 11702 16S ribosomal RNA, partial sequence
NR 118959.1 Bacillus licheniformis strain NCDO 1772 16S ribosomal RNA, partial sequence
NR 041248.1 Bacillus anthracis strain ATCC 14578 16S ribosomal RNA, partial sequence
NR 118379.1 Bacillus anthracis strain SB1 16S ribosomal RNA, partial sequence
NR 118536.1 Bacillus anthracis strain SBS1 16S ribosomal RNA, partial sequence
NR 043403.1 Bacillus thuringiensis strain IAM 12077 16S ribosomal RNA, partial sequence
NR 114581.1 Bacillus thuringiensis strain ATCC 10792 16S ribosomal RNA, partial sequence
NR 112780.1 Bacillus thuringiensis strain NBRC 101235 16S ribosomal RNA, partial sequence
NR 152692.1 Bacillus wiedmannii strain FSL W8-0169 16S ribosomal RNA, partial sequence
NR 036880.1 Bacillus mycoides strain 273 16S ribosomal RNA, partial sequence
NR 113990.1 Bacillus mycoides strain NBRC 101228 16S ribosomal RNA, partial sequence
NR 074540.1 Bacillus cereus ATCC 14579 16S ribosomal RNA (rrnA), partial sequence (Isolate 79)
NR 114582.1 Bacillus cereus ATCC 14579 16S ribosomal RNA, partial sequence
Fig 2: Phylogenetic tree of Bacillus cereus
CONCLUSION
Biochemical and Molecular identification tests
confirmed the presence of pullulanase-producing
Bacillus species: B. thuringiensis and B.cereus from
cassava processing sites. Enzyme assay confirmed
these organisms as producers of the pullulanase
enzyme in high quantites. This research has therefore
shown that the production of extracellular enzyme,
pullulanase by these Bacillus species is of great value
for many industrial processes.
ACKNOWLEDGEMENT
The authors would like to greatly appreciate the
financial support of the TetFund of Nnamdi Azikiwe
University, Awka towards the research. Also
Chifumnanya, Chief technologist, Biotechnology
Research laboratory, Nnamdi Azikiwe University,
Awka is appreciated for assistance in the Enzyme
production procedures.
REFERENCES
[1] S. L Hii, J. S Tan, T. C Ling, and A. B Ariff.
“Pullulanase: Role in Starch Hydrolysis and
Potential Industrial Applications”. Enzy. Res.
Vol 9, pp: 1-14, 2012.
[2] A K. Khalaf, and S. B. Aldeen. “Optimum
condition of pullulanase production by liquid
state and solid state fermentation (SSF) Method
from Bacillus licheniformis (BS18)”. Iraq J. of
Sci. Vol 54 pp: 35-49. 2013.
International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470
@ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1248
[3] H. S. Ling, T. C. Rosfarizan, and A. B Ariff.
“Characterization of Pullulanase type-II from
Bacillus cereus H1. 5”. Am. J. Biochem and
Biotec. Vol 5, pp: 170-179, 2009.
[4] R. Asha, F. N. Niyonzima, and S. More.
“Purification and properties of pullulanase from
Bacillus halodurans”. Int. Res. J. Biol. Sci.
Vol. 2, pp: 35-43. 2013.
[5] N. Prakash, S. Gupta, M. Ansari, Z. Khan, and
V. Suneetha. “Production of economically
important products by the use of pullulanase
enzyme”. International Journal of Scientific
Innovation and Discovery. Vol 2, pp: 266-273,
2012.
[6] B. Zhang, L. Chen, Y. Zhao, and X. Li.
“Structure and enzymatic resistivity of
debranched high temperature pressure treated
high-amylose corn starch”. J. of Cereal Sci Vol.
57, pp: 348–55, 2013.
[7] X. Duan, and J. Wu. “Enhancing the secretion 1
efficiency and thermostability of Bacillus
deramificans pullulanase mutant D437H/
D503Y by N-terminal domain truncation”.
Applied Environmental Microbiology. Vol81,
pp: 1926-31, 2015.
[8] S. Noorwez, Ezhilvannan, M. and
Satyanarayana, T, “Production of a High
Maltose-Forming Hyperthermostable and Ca2+
Independent Amylopullulanase by an Extreme
Thermophil Geobacillus thermoleovorans in
submerged fermentation”. Ind J. of Biotech.
Vol. 5, pp. 337-345, 2006.
[9] A. N Shehata, D. A Darwish, and H. M.
Masoud, “Extraction, Purification and
Characterization of Endo- acting Pullulanase
Type I from White Edible Mushrooms”. J.
Appl. Pharma. Sci. Vol. 6, pp: 147-152 2016.
[10] M. Waleed, A. A Faiza and I. Nizar,
“Production optimization of pullulanase
enzyme produced by Bacillus cereus isolated
from Syrian sources”. Intl Food Research J. Vol
22, pp: 1824-1830, 2015.

More Related Content

What's hot

Optimization of process parameters for l asparaginase production by aspergill...
Optimization of process parameters for l asparaginase production by aspergill...Optimization of process parameters for l asparaginase production by aspergill...
Optimization of process parameters for l asparaginase production by aspergill...
eSAT Journals
 
Screening and acclimation of efficient simultaneous nitrification and denitri...
Screening and acclimation of efficient simultaneous nitrification and denitri...Screening and acclimation of efficient simultaneous nitrification and denitri...
Screening and acclimation of efficient simultaneous nitrification and denitri...
IJERA Editor
 

What's hot (19)

N0567379
N0567379N0567379
N0567379
 
Culture of fungus
Culture of fungusCulture of fungus
Culture of fungus
 
Cultivation of anaerobes
Cultivation of anaerobesCultivation of anaerobes
Cultivation of anaerobes
 
The International Journal of Engineering and Science (The IJES)
The International Journal of Engineering and Science (The IJES)The International Journal of Engineering and Science (The IJES)
The International Journal of Engineering and Science (The IJES)
 
Preservation of industrial cell culture
Preservation of industrial cell culturePreservation of industrial cell culture
Preservation of industrial cell culture
 
Phytochemical and acute toxicity study of leaves of artocarpus heterophyllus lam
Phytochemical and acute toxicity study of leaves of artocarpus heterophyllus lamPhytochemical and acute toxicity study of leaves of artocarpus heterophyllus lam
Phytochemical and acute toxicity study of leaves of artocarpus heterophyllus lam
 
Preservation
Preservation Preservation
Preservation
 
Isolation of Saccharomyces cerevisiae from pineapple and orange and study of ...
Isolation of Saccharomyces cerevisiae from pineapple and orange and study of ...Isolation of Saccharomyces cerevisiae from pineapple and orange and study of ...
Isolation of Saccharomyces cerevisiae from pineapple and orange and study of ...
 
SDA culture media
SDA culture media SDA culture media
SDA culture media
 
Fc24961966
Fc24961966Fc24961966
Fc24961966
 
Optimization of process parameters for l asparaginase production by aspergill...
Optimization of process parameters for l asparaginase production by aspergill...Optimization of process parameters for l asparaginase production by aspergill...
Optimization of process parameters for l asparaginase production by aspergill...
 
Microbiological & Analytical Techniques in Quality control of Beer
Microbiological & Analytical Techniques in Quality control of BeerMicrobiological & Analytical Techniques in Quality control of Beer
Microbiological & Analytical Techniques in Quality control of Beer
 
Isolation of Yeasts from Raisins and Palm-Juice and Ethanol Production in Mol...
Isolation of Yeasts from Raisins and Palm-Juice and Ethanol Production in Mol...Isolation of Yeasts from Raisins and Palm-Juice and Ethanol Production in Mol...
Isolation of Yeasts from Raisins and Palm-Juice and Ethanol Production in Mol...
 
Isolation & preservation of culture of microorganism
Isolation & preservation of  culture of microorganismIsolation & preservation of  culture of microorganism
Isolation & preservation of culture of microorganism
 
G041132939
G041132939G041132939
G041132939
 
Cleaning and sterilization during tissue culture
Cleaning and sterilization during tissue cultureCleaning and sterilization during tissue culture
Cleaning and sterilization during tissue culture
 
Screening and acclimation of efficient simultaneous nitrification and denitri...
Screening and acclimation of efficient simultaneous nitrification and denitri...Screening and acclimation of efficient simultaneous nitrification and denitri...
Screening and acclimation of efficient simultaneous nitrification and denitri...
 
4. optimization of culture condition for enhanced decolorization of reactive ...
4. optimization of culture condition for enhanced decolorization of reactive ...4. optimization of culture condition for enhanced decolorization of reactive ...
4. optimization of culture condition for enhanced decolorization of reactive ...
 
Preservation of bacteria
Preservation of bacteriaPreservation of bacteria
Preservation of bacteria
 

Similar to Isolation and Molecular Characterization of Pullulanase Producing Bacillus Strains

Bioprocess development for enhanced spore production in shake flask and pilot...
Bioprocess development for enhanced spore production in shake flask and pilot...Bioprocess development for enhanced spore production in shake flask and pilot...
Bioprocess development for enhanced spore production in shake flask and pilot...
iosrjce
 
Isolation and characterization of coprophilous cellulolytic fungi from asian ...
Isolation and characterization of coprophilous cellulolytic fungi from asian ...Isolation and characterization of coprophilous cellulolytic fungi from asian ...
Isolation and characterization of coprophilous cellulolytic fungi from asian ...
Alexander Decker
 
Bohomolets Microbiology Lesson #10
Bohomolets Microbiology Lesson #10Bohomolets Microbiology Lesson #10
Bohomolets Microbiology Lesson #10
Dr. Rubz
 
A purification and protein analysis of Granulosis virus from P
A purification and protein analysis of Granulosis virus from PA purification and protein analysis of Granulosis virus from P
A purification and protein analysis of Granulosis virus from P
Chad Schlagel
 
Phages presentation final final final
Phages presentation  final final finalPhages presentation  final final final
Phages presentation final final final
nicollearosa
 
Phages presentation final final final
Phages presentation  final final finalPhages presentation  final final final
Phages presentation final final final
anaelishockey
 

Similar to Isolation and Molecular Characterization of Pullulanase Producing Bacillus Strains (20)

Bacteriology&immunology lab1
Bacteriology&immunology lab1Bacteriology&immunology lab1
Bacteriology&immunology lab1
 
Usp 40 -71 sterility tests
Usp 40 -71 sterility testsUsp 40 -71 sterility tests
Usp 40 -71 sterility tests
 
Production of α-amylase using new strain of Bacillus polymyxa isolated from s...
Production of α-amylase using new strain of Bacillus polymyxa isolated from s...Production of α-amylase using new strain of Bacillus polymyxa isolated from s...
Production of α-amylase using new strain of Bacillus polymyxa isolated from s...
 
Bioprocess development for enhanced spore production in shake flask and pilot...
Bioprocess development for enhanced spore production in shake flask and pilot...Bioprocess development for enhanced spore production in shake flask and pilot...
Bioprocess development for enhanced spore production in shake flask and pilot...
 
Jsu symposium poster 2016 final draft
Jsu symposium poster 2016 final draftJsu symposium poster 2016 final draft
Jsu symposium poster 2016 final draft
 
WMB3
WMB3WMB3
WMB3
 
Microbiology
MicrobiologyMicrobiology
Microbiology
 
Isolation and characterization of coprophilous cellulolytic fungi from asian ...
Isolation and characterization of coprophilous cellulolytic fungi from asian ...Isolation and characterization of coprophilous cellulolytic fungi from asian ...
Isolation and characterization of coprophilous cellulolytic fungi from asian ...
 
Pglo Lab Report
Pglo Lab ReportPglo Lab Report
Pglo Lab Report
 
Bohomolets Microbiology Lesson #10
Bohomolets Microbiology Lesson #10Bohomolets Microbiology Lesson #10
Bohomolets Microbiology Lesson #10
 
Screening and characterization of biosurfactants producing microorganism form...
Screening and characterization of biosurfactants producing microorganism form...Screening and characterization of biosurfactants producing microorganism form...
Screening and characterization of biosurfactants producing microorganism form...
 
A purification and protein analysis of Granulosis virus from P
A purification and protein analysis of Granulosis virus from PA purification and protein analysis of Granulosis virus from P
A purification and protein analysis of Granulosis virus from P
 
Effect of Various Parameters on the Growth and Ethanol Production by Yeasts I...
Effect of Various Parameters on the Growth and Ethanol Production by Yeasts I...Effect of Various Parameters on the Growth and Ethanol Production by Yeasts I...
Effect of Various Parameters on the Growth and Ethanol Production by Yeasts I...
 
Culture media & culture methods.pptx
Culture media & culture methods.pptxCulture media & culture methods.pptx
Culture media & culture methods.pptx
 
Pure culture study of yogurt
Pure culture study of yogurtPure culture study of yogurt
Pure culture study of yogurt
 
Assessment of the Coliform Bacterial Load of Some Drinking Water Sources in D...
Assessment of the Coliform Bacterial Load of Some Drinking Water Sources in D...Assessment of the Coliform Bacterial Load of Some Drinking Water Sources in D...
Assessment of the Coliform Bacterial Load of Some Drinking Water Sources in D...
 
Phages presentation final final final
Phages presentation  final final finalPhages presentation  final final final
Phages presentation final final final
 
Report cnv sdasua07042021
Report cnv sdasua07042021Report cnv sdasua07042021
Report cnv sdasua07042021
 
Phages presentation final final final
Phages presentation  final final finalPhages presentation  final final final
Phages presentation final final final
 
Aspergillus
AspergillusAspergillus
Aspergillus
 

More from YogeshIJTSRD

Standardization and Formulations of Calotropis Procera
Standardization and Formulations of Calotropis ProceraStandardization and Formulations of Calotropis Procera
Standardization and Formulations of Calotropis Procera
YogeshIJTSRD
 
Criminology Educators Triumphs and Struggles
Criminology Educators Triumphs and StrugglesCriminology Educators Triumphs and Struggles
Criminology Educators Triumphs and Struggles
YogeshIJTSRD
 
Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...
Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...
Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...
YogeshIJTSRD
 
A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...
A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...
A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...
YogeshIJTSRD
 
Data Security by AES Advanced Encryption Standard
Data Security by AES Advanced Encryption StandardData Security by AES Advanced Encryption Standard
Data Security by AES Advanced Encryption Standard
YogeshIJTSRD
 
Antimicrobial and Phytochemical Screening of Phyllantus Niruri
Antimicrobial and Phytochemical Screening of Phyllantus NiruriAntimicrobial and Phytochemical Screening of Phyllantus Niruri
Antimicrobial and Phytochemical Screening of Phyllantus Niruri
YogeshIJTSRD
 
Stress An Undetachable Condition of Life
Stress An Undetachable Condition of LifeStress An Undetachable Condition of Life
Stress An Undetachable Condition of Life
YogeshIJTSRD
 
Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...
Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...
Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...
YogeshIJTSRD
 
To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...
To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...
To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...
YogeshIJTSRD
 
Comparative Analysis of Different Numerical Methods for the Solution of Initi...
Comparative Analysis of Different Numerical Methods for the Solution of Initi...Comparative Analysis of Different Numerical Methods for the Solution of Initi...
Comparative Analysis of Different Numerical Methods for the Solution of Initi...
YogeshIJTSRD
 
Evaluation of Different Paving Mixes Using Optimum Stabilizing Content
Evaluation of Different Paving Mixes Using Optimum Stabilizing ContentEvaluation of Different Paving Mixes Using Optimum Stabilizing Content
Evaluation of Different Paving Mixes Using Optimum Stabilizing Content
YogeshIJTSRD
 

More from YogeshIJTSRD (20)

Cosmetic Science An Overview
Cosmetic Science An OverviewCosmetic Science An Overview
Cosmetic Science An Overview
 
Standardization and Formulations of Calotropis Procera
Standardization and Formulations of Calotropis ProceraStandardization and Formulations of Calotropis Procera
Standardization and Formulations of Calotropis Procera
 
Review of the Diagnosis and Treatment of Paralysis
Review of the Diagnosis and Treatment of ParalysisReview of the Diagnosis and Treatment of Paralysis
Review of the Diagnosis and Treatment of Paralysis
 
Comparative Analysis of Forced Draft Cooling Tower Using Two Design Methods A...
Comparative Analysis of Forced Draft Cooling Tower Using Two Design Methods A...Comparative Analysis of Forced Draft Cooling Tower Using Two Design Methods A...
Comparative Analysis of Forced Draft Cooling Tower Using Two Design Methods A...
 
Criminology Educators Triumphs and Struggles
Criminology Educators Triumphs and StrugglesCriminology Educators Triumphs and Struggles
Criminology Educators Triumphs and Struggles
 
A Review Herbal Drugs Used in Skin Disorder
A Review Herbal Drugs Used in Skin DisorderA Review Herbal Drugs Used in Skin Disorder
A Review Herbal Drugs Used in Skin Disorder
 
Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...
Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...
Automatic Query Expansion Using Word Embedding Based on Fuzzy Graph Connectiv...
 
A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...
A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...
A New Proposal for Smartphone Based Drowsiness Detection and Warning System f...
 
Data Security by AES Advanced Encryption Standard
Data Security by AES Advanced Encryption StandardData Security by AES Advanced Encryption Standard
Data Security by AES Advanced Encryption Standard
 
Antimicrobial and Phytochemical Screening of Phyllantus Niruri
Antimicrobial and Phytochemical Screening of Phyllantus NiruriAntimicrobial and Phytochemical Screening of Phyllantus Niruri
Antimicrobial and Phytochemical Screening of Phyllantus Niruri
 
Heat Sink for Underground Pipe Line
Heat Sink for Underground Pipe LineHeat Sink for Underground Pipe Line
Heat Sink for Underground Pipe Line
 
Newly Proposed Multi Channel Fiber Optic Cable Core
Newly Proposed Multi Channel Fiber Optic Cable CoreNewly Proposed Multi Channel Fiber Optic Cable Core
Newly Proposed Multi Channel Fiber Optic Cable Core
 
Security Sector Reform toward Professionalism of Military and Police
Security Sector Reform toward Professionalism of Military and PoliceSecurity Sector Reform toward Professionalism of Military and Police
Security Sector Reform toward Professionalism of Military and Police
 
Stress An Undetachable Condition of Life
Stress An Undetachable Condition of LifeStress An Undetachable Condition of Life
Stress An Undetachable Condition of Life
 
Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...
Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...
Comparative Studies of Diabetes in Adult Nigerians Lipid Profile and Antioxid...
 
To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...
To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...
To Assess the Severity and Mortality among Covid 19 Patients after Having Vac...
 
Novel Drug Delivery System An Overview
Novel Drug Delivery System An OverviewNovel Drug Delivery System An Overview
Novel Drug Delivery System An Overview
 
Security Issues Related to Biometrics
Security Issues Related to BiometricsSecurity Issues Related to Biometrics
Security Issues Related to Biometrics
 
Comparative Analysis of Different Numerical Methods for the Solution of Initi...
Comparative Analysis of Different Numerical Methods for the Solution of Initi...Comparative Analysis of Different Numerical Methods for the Solution of Initi...
Comparative Analysis of Different Numerical Methods for the Solution of Initi...
 
Evaluation of Different Paving Mixes Using Optimum Stabilizing Content
Evaluation of Different Paving Mixes Using Optimum Stabilizing ContentEvaluation of Different Paving Mixes Using Optimum Stabilizing Content
Evaluation of Different Paving Mixes Using Optimum Stabilizing Content
 

Recently uploaded

1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
QucHHunhnh
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
QucHHunhnh
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
negromaestrong
 
Spellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please PractiseSpellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please Practise
AnaAcapella
 

Recently uploaded (20)

Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentation
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
On National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan FellowsOn National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan Fellows
 
Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
 
Asian American Pacific Islander Month DDSD 2024.pptx
Asian American Pacific Islander Month DDSD 2024.pptxAsian American Pacific Islander Month DDSD 2024.pptx
Asian American Pacific Islander Month DDSD 2024.pptx
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introduction
 
PROCESS RECORDING FORMAT.docx
PROCESS      RECORDING        FORMAT.docxPROCESS      RECORDING        FORMAT.docx
PROCESS RECORDING FORMAT.docx
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docx
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
 
Spellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please PractiseSpellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please Practise
 
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17  How to Extend Models Using Mixin ClassesMixin Classes in Odoo 17  How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdf
 

Isolation and Molecular Characterization of Pullulanase Producing Bacillus Strains

  • 1. International Journal of Trend in Scientific Research and Development (IJTSRD) Volume 5 Issue 5, July-August 2021 Available Online: www.ijtsrd.com e-ISSN: 2456 – 6470 @ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1243 Isolation and Molecular Characterization of Pullulanase Producing Bacillus Strains Nwozor, N. C; Ogbo, F. C Department of Appalled Microbiology and Brewing, Nnamdi Azikiwe University, Awka, Nigeria ABSTRACT Pullulanase is an extracellular carbohydrase responsible for the hydrolysis of pullulan and amylopectin toproduce maltotriose. The product maltotriose is used in detergent industry, bakeryindustryand in the production of biotechnological products. In the present investigation pullulanase producing bacillus species were isolated and characterized using different biochemical and molecular methodologies. The isolates were identified as Bacillus cereus and Bacillus thuringiensis respectively. The pullulanase acivity was higher in Bacillus cereus, 0.62U/ml than B. thuringiensis, 0.53U/ml. This research reveals that pullulanase enzyme production from these Bacillus species shows great promise for use in industrial processes. KEYWORDS: Pullulanase, Bacillus, Molecular, Characterization How to cite this paper: Nwozor, N. C | Ogbo, F. C "Isolation and Molecular Characterization of Pullulanase Producing Bacillus Strains" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456- 6470, Volume-5 | Issue-5, August 2021, pp.1243- 1248, URL: www.ijtsrd.com/papers/ijtsrd45051.pdf Copyright © 2021 by author (s) and International Journal of Trend in Scientific Research and Development Journal. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0) (http://creativecommons.org/licenses/by/4.0) INTRODUCTION Pullulanase is an extracellular carbohydrase which debranches pullulan. They are also called debranching enzymes and have been widely used to hydrolyse 1,6-glucosidic linkages in starch, amylopectin, pullulan and other oligosaccharides to produce maltotriose [1]. Pullulanase is of great significance due to its wide area of potential application. It is a very potent enzyme for degradation of starch to glucose and maltose. It has been reported that Pullulanase enzyme is used on a large scale in glucose and maltose syrup industries. It is widely used in industries in the Saccharification of Starch. It converts starch into glucose and maltose which are used in the production of glucose syrup more efficiently [2]. The enzyme is used in detergent industry, baking industryand for the production of cyclodextrins which in turn is used in the production of Biotechnological products and low calorie beer [3]. A number of pullulanase have been produced and characterized from bacterial sources. Factors such as temperature, substrate concentration, agitation and time have been reported to greatly affect its production [4]. Pullulanase type I has been characterised from mesophilic bacteria such as Aerobacter aerogenes [5], Bacillus acidopullulyticus, Klebsiella pneumonia and Streptomyces sp. Moderate thermophilic gram positive bacteria such as Bacillus flavocaldarius, Bacillus thermoleovorans, Clostridium sp, and Thermos caldophilus also have ability to secrete pullulanase type I. Pullulanase type I from hyperthermophilic bacterium Fervidobacterium pennavorans, has also been reported.[6]. The aim of this study is the isolation and molecular characterization of pullulanase producing Bacillus strains. MATERIALS AND METHODOLOGY Screening, Isolation and identification of microorganism for the production of pullulanase enzyme Collection of soil sample: Soil sample from different flour mills was collected and 1g of sample was weighed and a suspension was prepared using 10ml IJTSRD45051
  • 2. International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470 @ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1244 of saline. It was allowed to settle down and the clear top layer in the tube was used as inoculums. Isolation of organism by using specific media: The pullulanase media was sterilized and 500μl of the inoculum was inoculated through pour plate method. The plates were Incubated at 37ºC for two days and observed for the growth of microorganism in each plate. The colonies were marked; pure cultures of those isolated colonies were maintained. Screening for the production of pullulanase Fresh isolates that showed high pullulan degradation efficiency were inoculated in culture medium, which consisted of: {(g/l) cassava flour (10), NaCl (2), MgSO4.7H2O (0.1), K2HPO4 (0.17), KH2PO4.7H2O (0.12) and NaNO3 (5), pH 7} .The flask was loaded on a rotary shaker incubator at a speed of 200 rpm at 37°C for 48 h. The cells were removed from the culture medium by centrifugation at4,000 rpm for 20 min..Supernatant was collected and used for the pullulanase assay. Pullulanase assay was done as described by [9]. Pullulanase assay was determined by measuring the release of reducing sugar from pullulan. The reaction mixture containing 0.5 ml of crude enzyme and 0.5ml of (1% pullulan in 0.2M sodium acetate buffer- pH 5.0) was incubated at 40°C for 30 min. The reaction was stopped by the addition of 2 ml of 3, 5-dinitrosalicylic acid, followed by boiling for 10 min to develop color. The absorbance of the mixture was measured at 540 nm, and enzyme activity was calculated. Identification of microorganisms by morphological and biochemical test The colony characteristics of the test organism was observed and recorded. Gram staining: A thin smear of the pure culture was made on a clean, grease free glass slide, heat fixed. Crystal violet was added, left for 1min followed by water wash, added grams iodine for 1min and washed, 70% alcohol for 30 sec, washed and added a counter stain saffrainin for 30 sec and observed under oil immersion. Methyl red – Voges proskauer: MRVP broth was autoclaved and about 10ml of broth was taken in four test tubes. Labelled as MR control, MR test, VP control, VP test. The test organism was inoculated into the MR test and VP test tubes, all the tubes were incubated at 37ºC for 24 – 48 hrs. After the incubation time methyl red solution was added to the MR test and control tubes. For VP, Barrets reagent I (40% KOH) and Barrets reagent II (α-naphthol in 95ml of 95% alcohol) was added and observed for the results. Catalase test: The container containing Hydrogen peroxide solution was shaken to expel the dissolved oxygen. One drop of the solution was dropped on a clean glass slide followed by the addition of a loop-full 24-hour old inoculum on the slide. The presence of gas bubbles indicated a positive test while the absence of gas bubbles indicated negative reaction. Citrate utilization: The media (Simons citrate media) was prepared, autoclaved and two slants were prepared out of which one was labelled as control and another as test. The tube (test) was inoculated with the test organism and incubated for 2 days to observe the results. Spore stain A drop of distilled water was placed on a clean grease free glass slide and a colony from the isolate was picked with a sterilized wire loop and emulsified. The glass slide was passed over the flame three times to heat fix. The smear was flooded with malachite green and allowed to heat for 3-5 minutes, the stain was rinsed off with tap water. Safranin was used to counter stain the smear and allowed to stand for 60 seconds. The slide was then rinsed to remove the secondary stain and allowed to air dry. It was observed under the microscope using x 100 objective (oil immersion). The vegetative cells appeared pink, while the spores appeared green in colour. Starch hydrolysis A starch agar was prepared, containing : g/500ml: peptone (5.0 ), sodium chloride: (5.0), yeast extract (1.5), beef extract (1.5), soluble starch (1.5) and agar-agar (15). A single was streak inoculation of the organisms was made at the centre of the labeled plates. The plates were incubated for 48 hours at 37oC. Following incubation, the plates were flooded with iodine solution using a dropper and allowed to stand for 30 seconds. Excess iodine was poured off and the plates were examined for clear zones around the bacterial growth. a positive test was indicated by clear zones around the line of growth showing that the organism hydrolyzed the starch. Motility Test A semisolid agar was prepared in a test tube and sterilized by autoclaving. It was allowed to cool and then it was inoculated with the test organism using a straight wire by making a stab down the centre of the tube to about half the depth of the medium. It was incubated at 37oC and examined at time intervals: 12 hours, 24, 36 and 48 hours . the non motile bacteria had growth confined to the stab line, having sharply defined margins and leaving the surrounding medium
  • 3. International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470 @ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1245 very transparent. The motile bacteria didn‘t grow on a confined stab line but had hazy growth that spread throughout the medium, rendering it slightly opaque. Molecular identification of the pullulanase producing isolates Extraction of DNA Hundred (100) mg of the bacterial cell was added to 200µl of isotonic buffer. The solution was mixed in a bashing lysis tube. Seven hundred and fifty (750) µl of lysis solution was added to the tube. The resulting solution was filled with bashing beads and mixed using a vortex mixer for five minutes. The solution contained in the tube was then centrifuged for 1 minute at 10000 x g using a microcentrifuge.400 µl of the supernatant was transferred to a spin filter in a collection tube and centrifuged at 7,000 x g for 1 minute. One thousand, two hundred (1200) µl of bacterial DNA binding buffer was added to the filtrate in the collection tube. 800µl of the mixture was transferred to a spin column in a collection tube and centrifuged at 10,000 x g for 1 minute, this procedure was repeated then, 200 µl of DNA pre- wash buffer was added to the zymo spin in a new collection tube and centrifuged at 10,000 x g for 1 minute. Then, 500 µl of the bacterial DNA wash buffer was added to the Zymo spin column and centrifuged again at 10,000 x g for 1 minute. The zymo spin column was transferred to a clean 1.5ml microcentrifuge tube and100 µl of DNA elution buffer was added directly to the column matrix. It was centrifuged at 10,000 x g for 30 seconds to elute the DNA. The DNA was then suitable for PCR and other downstream applications. Amplification of DNA by polymerase chain reaction (PCR) The PCR cocktail mix consisted of: 2.5µl of 10x PCR buffer, 1µl if 25mM MgCl2 ,1µl each of forward primer (27F TCCTCCGCTTATTGATATGS) and reverse primer(1535R GGAAGTAAAAGTCGTAACAAGG), 1µl of DMSO, 2µl of 2.5m MDNTPs, 0.1µl of 5 µ/µl Taq DNA polymerase, and 3µl of 10ng/µl DNA. The total reaction volume was made up to 25µl using 13.4µl nuclease free water. Initial denaturation of the DNA was done at 94o C for 5minutes, followed by 36 cycles of denaturation for 94oC for 30 seconds, annealing was done at 54oC for 30 seconds and elongation was done at 72oC for 45 seconds. This was followed immediately by a final elongation at 72oC for 7 minutes and its hold-temperature was at 10oC. Amplified fragments were visualized onsafe- view stained 1.5% agarose electrophoresis gels. The size of the amplicon is about 650bp and the DNA ladder from NEB.(IITA, Ibadan). Sanger Sequencing of Amplified DNA A GeneAmp PCR system 9700 was used for the sequencing. The tubes, which contained the products from the PCR amplification were placed in a thermal cycler and set to the correct volume. An initial denaturation was performed at 96oC for 1 minute. Then, the following was repeated for 25 cycles: a rapid thermal ramp at 96o C for 10 seconds, a rapid thermal ramp of 50oC for 5 seconds, a rapid thermal ramp of 60oC for 10 minutes. In order to purify, the 96-well reaction plate was removed from the thermal cycler and briefly spun. Five, 5µl of 125mM EDTA was added to each well. 60µl of 100% ethanol was added to each well. The plate was sealed with aluminium tape and mixed by inverting it four times. It was then incubated at room temperature for 15 minutes. A Beckman Allegra 6A centrifuge was used to spin the plate at 1650 x g for 45 minutes at 4oC. The plate was inverted and spinned up to 185 x g, then removed from the centrifuge and 60µl of 70% ethanol was added to each well. The mixture was spun at 1650 x g for 15 minutes at 4o C. The plate was inverted and spun up to 185 x g for 1 minute, then it was removed from the centrifuge and stored at 4oC. RESULTS AND DISCUSSION Isolation, morphological and biochemical identification of pullulanase producing bacteria: Forty bacterial isolates were obtained from the different cassava processing sites. The identification of the isolates obtained from different cassava processing sites which was done through primary screening on pullulan media showed five of the isolates to possess pullulan degradation potential by forming zones of clearing on the pullulan media plates. These isolates were identified by employing morphological and biochemical identification test procedures, which revealed the presumptive organism to be Bacillus sp (Table 1). Similar reports have been made [10], where different Bacillus species showed varying degrees of pullulan degradation. Cassava wastes from processing sites are rich sources of different microorganisms with many industrial advantages.
  • 4. International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470 @ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1246 Table 1: Biochemical Identification of pullulanase producing isolates Isolate No Pul Degrd(mm) Starch hydrolysis (mm) Catalase VP Motility Citrate Bp1 9.00 10.00 + - - + Bp2 15.00 15.00 + + + - Bp3 13.00 11.00 + + + + Bp4 10.00 13.00 + - - + Bp5 6.00 9.00 + + - - Pullulanase Production and Assay The production and assay of pullulanase for the isolates (Table 2) which showed pullulan degradation potential revealed isolate BP2 and BP3 as the isolates with the highest pullulanase activity (0.62U/ml and 0.53U/ml). These two isolates were selected for molecular identification. [2] reported a similar findings in which Bacillus sp was found to produce pullulanase enzyme in large quantity. Fig 1: pullulanse Quantity in choice isolates Molecular identification of pullulanase producing bacteria In 1% agarose gel electrophoresis, 1500bp band was obtained by PCR amplification (Plate 1). Also partial sequencing of 16SrRNA was done to identify the isolate. BLAST analysis of the sequence data revealed that the isolates showed closest similarity (99%) with Bacillus thuringiensis and Bacillus cereus. Plate 1: PCR on gel electrophoresis for B. cereus and B. thuringiensis
  • 5. International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470 @ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1247 Phylogenetic analysis: the phyletic relationship between the Bacillus species. Bacillus cereus was clustered towards B. mycoides, while B. cereus clustered towards B. weidmanni. This shows great similaritybetween the species (Fig 1). The Bacillus species possessed separate branches, representing different species of different strains within a group of Bacillus genus, therefore indicating a level of singularity in the different identities. NR 026140.1 Bacillus clausii strain DSM 8716 16S ribosomal RNA, partial sequence NR 025446.1 Bacillus halodurans strain DSM 497 16S ribosomal RNA, partial sequence NR 112056.1 Bacillus halodurans strain ATCC 27557 16S ribosomal RNA, partial sequence NR 041523.1 Bacillus coagulans strain NBRC 12583 16S ribosomal RNA, partial sequence NR 118954.1 Bacillus coagulans strain NCDO 1761 16S ribosomal RNA, partial sequence NR 115580.1 Bacillus coagulans strain JCM 2257 16S ribosomal RNA, partial sequence NR 118950.1 Bacillus amyloliquefaciens DSM 7 strain ATCC 23350 16S ribosomal RNA, partial sequence NR 074923.1 Bacillus licheniformis strain ATCC 14580 16S ribosomal RNA, partial sequence NR 113588.1 Bacillus licheniformis strain NBRC 12200 16S ribosomal RNA, partial sequence NR 118996.1 Bacillus licheniformis strain DSM 13 16S ribosomal RNA, partial sequence NR 116023.1 Bacillus licheniformis strain BCRC 11702 16S ribosomal RNA, partial sequence NR 118959.1 Bacillus licheniformis strain NCDO 1772 16S ribosomal RNA, partial sequence NR 041248.1 Bacillus anthracis strain ATCC 14578 16S ribosomal RNA, partial sequence NR 118379.1 Bacillus anthracis strain SB1 16S ribosomal RNA, partial sequence NR 118536.1 Bacillus anthracis strain SBS1 16S ribosomal RNA, partial sequence NR 043403.1 Bacillus thuringiensis strain IAM 12077 16S ribosomal RNA, partial sequence NR 114581.1 Bacillus thuringiensis strain ATCC 10792 16S ribosomal RNA, partial sequence NR 112780.1 Bacillus thuringiensis strain NBRC 101235 16S ribosomal RNA, partial sequence NR 152692.1 Bacillus wiedmannii strain FSL W8-0169 16S ribosomal RNA, partial sequence NR 036880.1 Bacillus mycoides strain 273 16S ribosomal RNA, partial sequence NR 113990.1 Bacillus mycoides strain NBRC 101228 16S ribosomal RNA, partial sequence NR 074540.1 Bacillus cereus ATCC 14579 16S ribosomal RNA (rrnA), partial sequence (Isolate 79) NR 114582.1 Bacillus cereus ATCC 14579 16S ribosomal RNA, partial sequence Fig 2: Phylogenetic tree of Bacillus cereus CONCLUSION Biochemical and Molecular identification tests confirmed the presence of pullulanase-producing Bacillus species: B. thuringiensis and B.cereus from cassava processing sites. Enzyme assay confirmed these organisms as producers of the pullulanase enzyme in high quantites. This research has therefore shown that the production of extracellular enzyme, pullulanase by these Bacillus species is of great value for many industrial processes. ACKNOWLEDGEMENT The authors would like to greatly appreciate the financial support of the TetFund of Nnamdi Azikiwe University, Awka towards the research. Also Chifumnanya, Chief technologist, Biotechnology Research laboratory, Nnamdi Azikiwe University, Awka is appreciated for assistance in the Enzyme production procedures. REFERENCES [1] S. L Hii, J. S Tan, T. C Ling, and A. B Ariff. “Pullulanase: Role in Starch Hydrolysis and Potential Industrial Applications”. Enzy. Res. Vol 9, pp: 1-14, 2012. [2] A K. Khalaf, and S. B. Aldeen. “Optimum condition of pullulanase production by liquid state and solid state fermentation (SSF) Method from Bacillus licheniformis (BS18)”. Iraq J. of Sci. Vol 54 pp: 35-49. 2013.
  • 6. International Journal of Trend in Scientific Research and Development @ www.ijtsrd.com eISSN: 2456-6470 @ IJTSRD | Unique Paper ID – IJTSRD45051 | Volume – 5 | Issue – 5 | Jul-Aug 2021 Page 1248 [3] H. S. Ling, T. C. Rosfarizan, and A. B Ariff. “Characterization of Pullulanase type-II from Bacillus cereus H1. 5”. Am. J. Biochem and Biotec. Vol 5, pp: 170-179, 2009. [4] R. Asha, F. N. Niyonzima, and S. More. “Purification and properties of pullulanase from Bacillus halodurans”. Int. Res. J. Biol. Sci. Vol. 2, pp: 35-43. 2013. [5] N. Prakash, S. Gupta, M. Ansari, Z. Khan, and V. Suneetha. “Production of economically important products by the use of pullulanase enzyme”. International Journal of Scientific Innovation and Discovery. Vol 2, pp: 266-273, 2012. [6] B. Zhang, L. Chen, Y. Zhao, and X. Li. “Structure and enzymatic resistivity of debranched high temperature pressure treated high-amylose corn starch”. J. of Cereal Sci Vol. 57, pp: 348–55, 2013. [7] X. Duan, and J. Wu. “Enhancing the secretion 1 efficiency and thermostability of Bacillus deramificans pullulanase mutant D437H/ D503Y by N-terminal domain truncation”. Applied Environmental Microbiology. Vol81, pp: 1926-31, 2015. [8] S. Noorwez, Ezhilvannan, M. and Satyanarayana, T, “Production of a High Maltose-Forming Hyperthermostable and Ca2+ Independent Amylopullulanase by an Extreme Thermophil Geobacillus thermoleovorans in submerged fermentation”. Ind J. of Biotech. Vol. 5, pp. 337-345, 2006. [9] A. N Shehata, D. A Darwish, and H. M. Masoud, “Extraction, Purification and Characterization of Endo- acting Pullulanase Type I from White Edible Mushrooms”. J. Appl. Pharma. Sci. Vol. 6, pp: 147-152 2016. [10] M. Waleed, A. A Faiza and I. Nizar, “Production optimization of pullulanase enzyme produced by Bacillus cereus isolated from Syrian sources”. Intl Food Research J. Vol 22, pp: 1824-1830, 2015.