Diese Präsentation wurde erfolgreich gemeldet.
Wir verwenden Ihre LinkedIn Profilangaben und Informationen zu Ihren Aktivitäten, um Anzeigen zu personalisieren und Ihnen relevantere Inhalte anzuzeigen. Sie können Ihre Anzeigeneinstellungen jederzeit ändern.
Joris Veltman<br />(onderzoeker)<br />
Personalized genomic medicine<br />Joris Veltman<br />j.veltman@antrg.umcn.nl<br />www.genomicdisorders.nl<br />
Het probleem; Ineffectieve medicijnen!<br />
1953<br />
Het humane genoom<br />receptenboek voor leven<br />6 miljard bouwstenen<br />2001<br />
NIJMEGEN INTERNATIONALE EXPERT ERFELIJKE ZIEKTEN<br />VCAN<br />CFH<br />CHM<br />USH2Aisob<br />RPGRIP1<br />TECTA<br />N...
Complexiteit genonderzoek beperkt klinische impact!<br />Fout in bouwstenen DNA ?        OF   	Fout in aantal chromosomen?...
Genomics wordt spotgoedkoop!<br />Kosten in kaart brengen 1 genoom<br />
Genoomdiagnostiek in 2015 <br />DNA<br />?<br />Genoomsequentie<br />< 1 uur<br />< 500 euro<br />
Nijmegen investeert in genoomsequencing<br />Roche, GS FLX Titanium<br />Since 11-2008<br />Life Technologies, SOLiD<br />...
Van sequentie tot genoom:Veel puzzelwerk<br />Miljoenen korte sequenties per individu<br />Supercomputers en <br />Bioinfo...
ACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAGTCGA<br />ATCGATCGATCGATCGCGCTCGCTAG...
NRC 13 feb 2010<br />
Personal genomics en impact op geneeskunde<br />
Waarom reageren mensen verschillend op medicijnen?Oftewel: Hoe verschillend zijn ze nu echt?<br />5,999 miljard<br />overe...
Wie ben ik en wat zijn mijn gezondheidsrisoco’s?<br />Hoe zit het bij mij?<br />
Een ander probleem; Recessieve ziekten<br />Kans op<br />dragerschap<br />1: 1000<br />Kans op<br />dragerschap<br />1: 10...
Personalizedmedicine and the role of genomics<br />PERSONALIZED GENOMIC MEDICINE<br />DE TOEKOMST VAN DE GENEESKUNDE!<br />
THANK YOU !<br />
NEXT<br />
Nächste SlideShare
Wird geladen in …5
×

03 joris veltman

816 Aufrufe

Veröffentlicht am

Op dinsdag 22 juni 2010 was er REshape UnConference X Pecha Kucha. Op 12 oktober 2010 is de tweede editie. Kijk op www.reshapehealthcare.eu.

  • Als Erste(r) kommentieren

  • Gehören Sie zu den Ersten, denen das gefällt!

03 joris veltman

  1. 1. Joris Veltman<br />(onderzoeker)<br />
  2. 2. Personalized genomic medicine<br />Joris Veltman<br />j.veltman@antrg.umcn.nl<br />www.genomicdisorders.nl<br />
  3. 3. Het probleem; Ineffectieve medicijnen!<br />
  4. 4. 1953<br />
  5. 5. Het humane genoom<br />receptenboek voor leven<br />6 miljard bouwstenen<br />2001<br />
  6. 6.
  7. 7. NIJMEGEN INTERNATIONALE EXPERT ERFELIJKE ZIEKTEN<br />VCAN<br />CFH<br />CHM<br />USH2Aisob<br />RPGRIP1<br />TECTA<br />NDP<br />EHMT1<br />EYS<br />MYCN<br />FXYD2<br />DFNB59 <br />TSPAN12<br />ABCA4<br />CDH7<br />ESRRB<br />P63<br />LARGE<br />PDE6C<br />SETBP1<br />RPGRIP1L<br />OFD1<br />17Q21<br />LRTOMT<br />TKS4<br />IKAROS<br />MAOA<br />SS18/SSX<br />CEP290<br />SENP1/MESDC2<br />ZNF674<br />CNTNAP2<br />GRXCR1 <br />TET2<br />CRB1<br />PRPS1<br />TBX4<br />RPGR<br />TRPN<br />L1/L2<br />LCA5<br />ROR2<br />EPCAM<br />COL4A3<br />
  8. 8. Complexiteit genonderzoek beperkt klinische impact!<br />Fout in bouwstenen DNA ? OF Fout in aantal chromosomen?<br />
  9. 9. Genomics wordt spotgoedkoop!<br />Kosten in kaart brengen 1 genoom<br />
  10. 10. Genoomdiagnostiek in 2015 <br />DNA<br />?<br />Genoomsequentie<br />< 1 uur<br />< 500 euro<br />
  11. 11. Nijmegen investeert in genoomsequencing<br />Roche, GS FLX Titanium<br />Since 11-2008<br />Life Technologies, SOLiD<br />Since 9-2009<br />
  12. 12. Van sequentie tot genoom:Veel puzzelwerk<br />Miljoenen korte sequenties per individu<br />Supercomputers en <br />Bioinformatica expertise!<br />Totale genoomsequentie 1 individu<br />
  13. 13. ACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAGTCGA<br />ATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCACA<br />CGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGA<br />TCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGCGGGGCAAACGCACCG<br />GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCCAACCAC<br />GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGATCGA<br />ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCG<br />CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTACGATCG<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGTCGT<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACTCGCTA<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCAGCTAGCTAGCTC<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAGCT<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACACT<br />CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATTCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGAC<br />GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCACT<br />GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGCG<br />ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCGGCT<br />CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGA<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGGAC<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCATCG<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCATC<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGA<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAATC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCCAC<br />CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATTCGCGCGGGGGCAAACGCACCAACCACCACAGCGGGGGCAAAGGGGCCAA<br />GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGAAACGCAC<br />ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCGGTGC<br />CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGAT<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACG<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCAAGC<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCATTAGCTA<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAACG<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACCC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACTCGA<br />CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGAT TCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCCAACT<br />GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCT<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGTCGT<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACTCGCTA<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCAGCTAGCTAGCTC<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAGCT<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACACT<br />
  14. 14. NRC 13 feb 2010<br />
  15. 15. Personal genomics en impact op geneeskunde<br />
  16. 16. Waarom reageren mensen verschillend op medicijnen?Oftewel: Hoe verschillend zijn ze nu echt?<br />5,999 miljard<br />overeenkomsten<br />1 miljoen <br />verschillen<br />
  17. 17.
  18. 18. Wie ben ik en wat zijn mijn gezondheidsrisoco’s?<br />Hoe zit het bij mij?<br />
  19. 19.
  20. 20. Een ander probleem; Recessieve ziekten<br />Kans op<br />dragerschap<br />1: 1000<br />Kans op<br />dragerschap<br />1: 1000<br />Indien beide drager<br />Dan kans van 1 op 4!<br />Kans op ziekte<br />1: 4,000,000<br />
  21. 21. Personalizedmedicine and the role of genomics<br />PERSONALIZED GENOMIC MEDICINE<br />DE TOEKOMST VAN DE GENEESKUNDE!<br />
  22. 22. THANK YOU !<br />
  23. 23. NEXT<br />

×