1. Introduction
Increased oxidative stress and altered
antioxidant pool have been implicated in both
clinical and experimental type 1 diabetes(1,2).
Hyperglycemia, auto-oxidation of glycated
proteins, increased production of reactive
oxygen species (ROS), decreased antioxidant
defense, increased lipid peroxidation, and
associated membrane degeneration are
implicated as main causes of cellular
apoptosis or necrosis, which are common in
diabetes(3,4,5). Mitochondrial dysfunction,
apoptosis, and reduced ATP biosynthesis have
all been implicated in type 1 diabetes(6,7).
Streptozotocin (STZ), an analog of N-
acetylglucosamine, has been used to generate
animal models of type 1 diabetes. Release of
nitric oxide, increased glycation of pancreatic
proteins, and an increased production of ROS
have been proposed as possible causes of
STZ-induced pancreatic β-cell damage(8,9,10).
In STZ-induced diabetic rats, hyperglycemia
has been shown to induce typical apoptotic
changes in the pancreas and other target
tissues(11).
Elevated oxidative stress and ROS production
in diabetes often parallels an increased
expression of cytochrome P450 2E1
(CYP2E1)(11). CYP2E1 is known to metabolize
endogenous compounds such as fatty acids,
lipid hydroperoxides, and ketone bodies into
aldehyde and many xenobiotics and
carcinogens into nucleophilic reactive
species(11,12). In vitro-reconstituted CYP2E1
and that expressed in intact cells by transient
transfection has been shown to produce
superoxide (O2.-) and H2O2(11,12).
α-lipoic acid (LA) is a naturally occurring
compound present as a cofactor in several
mitochondrial enzymes that are involved in
metabolism and energy production(13). In its
free form, LA is a powerful antioxidant,
functioning as a ROS scavenging. Antioxidant
effects of LA is based on their interactions with
peroxyl radicals, which are essential for the
initiation of lipid peroxidation; and ascorbyl
radicals of Vitamin C. Reduced form of lipoic
acid, dihydrolipoic acid (DHLA), can recycle
a s c o r b y l r a d i c a l s a n d r e d u c e
dehydroascorbate generated in the course of
ascorbate oxidation by radicals. Therefore,
DHLA may act as a strong chain-breaking
antioxidant and may enhance the antioxidant
potency of other antioxidants like Vitamin C in
both the aqueous and in hydrophobic
membrane phase(14).
trans-Resveratrol is a naturally occurring
phytoalexin that has been shown to be a better
antioxidant and free radical scavenger than α-
tocopherol, a natural antioxidant of the human
body(15,16). Resveratrol has been shown to
have an insulin-like effect on the HepG2 cells,
increasing the glucose uptake of the cells
without depending on the availability of
insulin(17).
The aim of this study is to investigate the
effects of antioxidants such as α-lipoic acid,
Vitamin C and resveratrol on over-expression
of cytochrome P450 2E1, in streptozotocin-
induced diabetic rat tissues.
Effect of Vitamin C, lipoic acid and resveratrol
on streptozotocin-induced diabetes gene
expression: mRNA expression of Cyp2e1
Many studies have shown the effect of diabetes, in terms of, oxidative stress. It has also been
shown that the diabetes-induced oxidative stress causes over-expression of Cytochrome
P450 2E1 (CYP2E1). In this study, the effect of antioxidant administration on the diabetes-
induced over-expression of CYP2E1, in streptozotocin-induced diabetic rat liver tissues, have
been studied. The real time PCR and RT-PCR analyses have shown that administration of
diabetic rats with Vitamin C has the most significant effect in reducing the over-expression of
CYP2E1 and administration of Vitamin C together in combination with α-Lipoic Acid follows, to
cause the second most significant decrease in the over-expression.
Kemal AŞIK
1462407

2. Materials and methods
Induction of diabetes
Male Wistar rats were randomly divided into
ten groups. In five groups, diabetes was
induced by single intraperitonal injection of
Streptozotocin (50 mg/kg body weight)
dissolved in 0.05 M citrate buffer (pH 4.5) and
blood glucose concentrations were checked by
Accu-check-go blood glucose analyzer
(Roche) and animals having blood glucose
concentration higher than 200 mg/dL were
considered as diabetic. After one week of
diabetes, the experimental groups comprised
of the control group (n=9), untreated diabetic
group (n=9), diabetic (n=8) and control (n=8)
groups supplemented with DL-α-lipoic acid
(LA), diabetic (n=12) and control (n=4) groups
supplemented with Vitamin C, diabetic (n=7)
and control (n=4) groups supplemented with a
combination of LA and Vitamin C, diabetic
(n=7) and control (n=7) groups supplemented
with resveratrol. All experiment were carried
out with the approval of local animal use
committee. The procedure involving animals
and their care are conformed to the
institutional guidelines(18). At the end of the
four-week growing period, rats were
decapitated and livers were removed and
quickly frozen in liquid nitrogen and kept at
-85°C for subsequent biochemical analysis.
Tissue processing
For each tissue, an appropriate portion was
homogenized in ice-cold homogenization
solution containing 1.15% (w/v) KCl, 5 mM
EDTA, 0.2 mM PMSF, 0.2 mM DTT, in 25 mM
phosphate buffer and pH 7.4 using teflon glass
homogenizer. The homogenates were
centrifuged at 1500 g and the supernatants
were sampled.
Total RNA isolation and cDNA synthesis
Total RNAs were isolated from liver tissues by
guanidine isothiocyanide method(19). After
isolation of total RNAs, their integrities were
checked by formaldehyde agarose gel
electrophoresis and RNA concentrations and
protein contamination were determined by
spectrophotometry(28). The cDNA synthesis
was carried out by using M-MuLV Reverse
Transctiptase (MBI Fermentas, USA). To the
reverse transcription reaction, 1 µL oligo(dT)15
primer was addded to 1 µg total RNA. Then,
the volume was completed to 12 µL with
DEPC-treated water. Afterwards, the mixture
was gently mixed and incubated for 5 minutes
at 70°C and chilled on ice. Then 4 µL of 5x M-
MuLV reaction buffer and 1 µL of Ribolock™
(20u/µL) (MBI Fermentas, USA) was added.
After addition of 2 µL10 mM dNTP mix, tubes
were incubated at 37°C for 5 minutes. Finally,
1 µL of M-MuLV RT (200u/µL) was added and
reaction was carried out at 42°C for 1 hour and
stopped at 70°C for 10 minutes with
denaturation of reverse transcriptase. At the
end, cDNA mixture was chilled on ice and
store at ambient temperature until subsequent
PCR reaction.
Real time PCR
One µL of cDNA mixture (1:10 diluted) was
amplified in a 10µL of PCR mixture containing
5µL SYBR Green Mastermix (Roche FastStart
Universal SYBR Green Master (Rox) (2X)) and
1µL forward and 1µL reverse primer. Different
primer sets were used to amplify the internal
standard (β-actin gene) and CYP2E1 (Table
1). The PCR program was set for initial
denaturation at 95°C for 15 minutes,
denaturation at 94°C for 30 seconds,
annealing at 58°C for 30 seconds (for both
internal control and CYP2E1) and extension at
72°C for 30 seconds. The cycle from
denaturation to extension was repeated 40
times and quantification was performed at the
end of each extension step, on green
fluorescence. Melt curve analysis was
Table 1 Primer sequences and expected sizes for CYP2E1 and internal standard β-Actin
CDNA Forward primer sequence Reverse primer sequence RT-PCR product size
(bp)
β-Actin 5’-CCTGCTTGCTGATCCACA 5’CTGACCGAGCGTGGCTAC 500
CYP2E1 5’-CTCCTCGTCATATCCATCTG 5’-GCAGCCAATCAGAAATGTGG 470
GAPDH 5′-
TGATGACATCAAGAAGGTGGTGAAG
5′-TCCTTGGAGGCCATGTGGGCCAT 250

3. performed at the end of each run (for internal
standard and CYP2E1), on melt A. Green, in
50°C-99°C temperature range to determine
the specificity of the final products.
RT PCR
Multiplex RT-PCR was performed for the
simultaneous amplification of internal standard
GAPDH (as internal standard) and CYP2E1. It
employs different primer pairs in the same
amplification reaction so each time, more than
one gene could be amplified. The cDNAs of
GAPDH and CYP2E1, obtained by reverse
transcription was amplified using primer pairs.
GAPDH was used as internal standard in RT-
PCR experiments since the PCR products
obtained by RT-PCR of CYP2E1 and β-Actin
were similar in size and hard to distinguish on
agarose gel electrophoresis (Table 1).
Two microliter of cDNA mixture was amplified
in a 50µL of PCR reaction mixture containing 1
x reaction buffer, 1.5 mM MgCl2, 0.1 mM dNTP
(each), 1.0 mM of each primer and 5.0 Unit
Taq Polymerase. The PCR program was set
for initial denaturation at 94°C for 3 minutes,
denaturation at 94°C for 30 seconds,
annealing at 60°C for 30 seconds, extension at
72°C for 45 seconds and final extension at
72°C for 3 minutes. After the reaction was
completed, PCR products were mixed with 6x
loading dye and run on 1% agarose gel. After
agarose gel electrophoresis, intensities of
bands were measured with Image J
software(20). The intensities of the bands were
converted into peak by the software and
antioxidant enzyme gene expressions were
calculated from the area under these peaks.
Statistical analysis
Differences in measure parameters between
normal, diabetic and antioxidant supplemented
animals were assessed by the Student t-test
with the help of MS Excel 2008 software. Data
were expressed as mean +/- standard
deviation values. The relationships between
the oxidative parameters characterizing
diabetic and control rat liver status were
analyzed and a probability of 0.05 and 0.005
was set as the level of statistical significance.
Results
Real time PCR was performed for the
amplification of CYP2E1 and β-Actin. A
standard curve has been prepared for both the
gene of interest and the internal control. The
standard curves are shown in Figure 1. The
results of CYP2E1 expression levels with
respect to β-Actin expression, carried out in
real time PCR, is shown in Figure 2. CYP2E1
expression was significantly higher in
untreated diabetic animals compared to
diabetic animals treated with Vitamin C,
combination of LA and Vitamin C, resveratrol
(P<0.05). Expression was significantly higher
in animals treated with LA compared to
diabetic animals treated with Vitamin C,
combination and resveratrol (p<0.005).
Fig. 1 a) Standard curve obtained in real time PCR
by using known concentrations of β-Actin. (R-value:
0.9957, R2-value: 0.99143 with slope correction).
b) Standard curve obtained in real time PCR by
using known concentrations of CYP2E1. (R-value:
0.99585, R2-value: 0.99173 with slope correction).
Fig. 2 CYP2E1 expression in control, diabetic, LA,
Vitamin C, combination (Vit C & LA) and resveratrol
supplemented animals in real time PCR. a
represents significance at P<0.05 and aa represents
significance at P<0.005 as compared with control
groups. b represents significance at P<0.05 and bb
represents significance at P<0.005 as compared
with diabetic groups.
aa, b a, b
a, b
0
2
4
6
8
10
12
14
16
D K DLA KLA DVC KVC DC KC DR KR
Cyp2e1/B‐Ac,n Expression
a)
b)

4. Results of multiplex amplification of GAPDH
and CYP2E1 mRNAs in whole groups is
shown in Figure 3. Figure 4 represents the
ratios of the densities of CYP2E1 and GAPDH
genes after densitometric analysis of the
respective bands with Image J software.
According to the results of RT-PCR CYP2E1
expression in untreated diabetic animals was
increased significantly compared to diabetic
animals treated with Vitamin C and
combination (P<0.005) as well as diabetic
animals treated with LA (P<0.05). CYP2E1
expression was significantly higher in diabetic
animals treated with LA compared to diabetic
animals treated with Vitamin C and
combination (P<0.005). CYP2E1 expression
was significantly lower in diabetic animals
treated with LA compared to diabetic animals
treated with resveratrol (P<0.005). Expression
was significantly lower in diabetic animals
treated with Vitamin C compared to diabetic
animals treated with resveratrol. Expression of
CYP2E1 was significantly lower in diabetic
animals treated with a combination of LA and
Vitamin C compared to diabetic animals
treated with resveratrol.
Fig. 3 Agarose gel electrophoresis of multiplex RT-
PCR amplification of GAPDH and CYP2E1 mRNA.
In the figures, upper bands correspond to 470 bp
CYP2E1 and lower bands correspond to 250 bp
GAPDH
The melt curves obtained from the melt curve
analysis of CYP2E1 and β-Actin real time PCR
products are shown in Figure 5. The real time
amplification curves for CYP2E1 and β-Actin
PCR products are shown in Figure 6.
Fig. 4 Results of densitometric analysis of CYP2E1
expression in control, diabetic, LA, Vitamin C,
combination (vit C & LA) and resveratrol
supplemented animals. a represents significance at
P<0.05 and aa represents significance at P<0.005
as compared with control groups. b represents
significance at P<0.05 and bb represents
significance at P<0.005 as compared with diabetic
groups.
Fig. 5 a) melt curve for CYP2E1 obtained on A.
Green in temperature range 50°C-99°C. The
highest peak corresponds to CYP2E1.
b) melt curve for β-Actin obtained on A. Green in
temperature range 50°C-99°C. The highest peak
corresponds to β-Actin
a
b
aa,bb
bb
aa
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
D K DLA KLA DVC KVC DC KC DR KR
Cyp2e1/GAPDH
a)
b)

5. Fig. 6 a) real time amplification for CYP2E1 in
diabetic, control, diabetic + LA, control + LA,
diabetic + Vitamin C, control + Vitamin C animals b)
real time amplification for CYP2E1 in control +
combination, diabetic + resveratrol, control +
resveratrol animals c) real time amplification for β-
Actin in diabetic + combination, control +
combination, diabetic + LA, control + LA, diabetic +
Vitamin C, control + Vitamin C animals d) real time
amplification for β-Actin in diabetic, control, diabetic
+ combination, diabetic + resveratrol, control +
resveratrol animals
Discussion
Th e o u tc o m e o f t h i s s tu d y c l e a r l y
demonstrates that diabetes-induced oxidative
stress in diabetic rat livers brings about over-
expression of CYP2E1. CYP2E1 has been
previously shown to be transcriptionally
activated, in rat liver tissue, in the presence of
ethanol in an adaptive manner for responding
to high and/or low levels of ethanol, as a result
of ethanol-induced oxidative stress(21).
Insulin has been shown, by different studies, to
have a regulatory effect on CYP2E1 mRNA
levels. In primary cultured rat hepatocytes,
reducing the insulin concentration (or removing
insulin completely) results in an increase in
CYP2E1 mRNA and protein levels(29).
Ethanol-induced oxidative stress increases
CYP2E1 protein levels but not CYP2E1 mRNA
levels, suggesting a post-translational
mechanism of regulation on CYP2E1. On the
other hand, decreasing insulin concentration
causes an increase in both mRNA and protein
levels of CYP2E1(30).
The diabetes-induced over-expression of
CYP2E1 has been attempted to be normalized
in this study by administering the diabetic
animals with α-Lipoic acid (LA), Vitamin C, a
combination of LA and Vitamin C as well as
Resveratrol. The findings suggest that Vitamin
C administration has the most significant effect
on reducing the over-expression of CYP2E1.
Vitamin C has been shown to decrease
diabetes-induced lipid peroxidation and have a
protective effect on antioxidant enzymes(22,23).
The reducing effect of Vitamin C on lipid
peroxidation could reduce the diabetes-
induced oxidative stress in rat liver cells, thus
decrease the over-expression effect on
CYP2E1. LA administration of diabetic animals
did not cause a significant decrease in
CYP2E1 expression. LA, in its reduced form,
acts as a chain-breaking antioxidant and has
been shown to increase the effects of other
antioxidants like Vitamin C(14). In this study,
even though the administration of diabetic rats
with a combination of LA and Vitamin C
caused a significant reduction in CYP2E1
expression, the observed reduction was less
than that observed in sole Vitamin C
administration of the diabetic animals. The
effect of administration with the combination
was observed to be more significant than that
observed in sole LA administration which may
a)
b)
c)
d)

6. point to LA decreasing the activity of Vitamin C
in diabetes-induced over-expression of
CYP2E1. In future studies, repeated
experiments, with varying LA/Vitamin C ratios
administered to diabetic animals can reveal
the exact effect of LA on Vitamin C’s effect on
diabetes-induced CYP2E1 expression.
Resveratrol has been shown to enhance the
expression of nitric oxide (NO) in endothelial
cells(24). NO actively reduces the oxidative
stress in the cells. So, administration of the
diabetic animals with resveratrol is expected to
decrease the over-expression of CYP2E1
hypothetically. The experimental outcome has
been somehow contradictory on this. While the
expression has been significantly high in the
control groups that were administered with
resveratrol, the real-time PCR data suggests a
significant decrease in CYP2E1 expression in
diabetic rats administered with resveratrol. On
the other hand, RT-PCR data suggests no
such decrease and a contradictory increase in
the expression. The inconsistent results
obtained from real time PCT and RT-PCR
experiments have made it hard to detect the
exact effect of resveratrol administration in
diabetic animals. The contradiction has most
probably been observed due to the usage of
different housekeeping genes as internal
controls for the two set of experiments. β-Actin
expression might have been affected by the
administration of resveratrol in diabetic rats
which would have caused the peculiar
outcome that was obtained in real time PCR
experiments. Repeated experiments may help
resolve the paradox introduced by the
outcome of this study. The joint effect of LA
and Vitamin C has been shown to trigger NO
production in the endothelial cells(25) as well as
resveratrol. In the case of both combination
administration and resveratrol administration,
the expected hypothetical decrease was not
observed in diabetic rats. NO has been shown
to act against arachidonic acid and CYP2E1
dependent toxicity(26). However, the antioxidant
properties of NO are not retained in any
condition. At hight levels, NO acts as a radical,
a pro-oxidant, rather than an antioxidant
depending on the availability of reactive
species(27). NO acts as a pro-oxidant in the
presence of superoxide which has been shown
to be produced as a result of CYP2E1 over-
expression(11,12). The pro-oxidant activity of NO
in the presence of superoxide could be the
reason for not having observed the
hypothetical effects of combination and
resveratrol administration of diabetic rats.
More detailed and more specific experiments
can be designed to attain the effect of
resveratrol and LA + Vitamin C administration
on the nitric oxide pathway and to determine
t h e a p p r o p r i a t e c o n c e n t r a t i o n f o r
administration so as not to induce pro-oxidant
activity of NO but to induce antioxidant activity
of NO.
An alternative objective for a future study can
be to optimize the concentration of Vitamin C
administration for diabetic animals in order to
normalize the CYP2E1 expression in diabetic
liver tissue.
References
(1) Baynes J: Role of oxidative stress in development of
complications in diabetes. Diabetes 40:405– 412, 1991
(2) Vincent AM, Brownlee M, Russell JW: Oxidative
stress and programmed cell death in diabetic neuropathy.
Ann N Y Acad Sci 959:368 –383, 2002
(3) Desco MC, Asensi M, Marquez R, Martinez-Valls J,
Vento M, Pollardo FV, Sastre J, Vina J: Xanthine oxidase
is involved in free radical production in type-1 diabetes:
protection by allopurinol. Diabetes 51:118 –124, 2002
(4) Hunt JV, Dean RT, Wolff SP: Hydroxyl radical
production and autooxidative glycosylation: glucose
autooxidation as the cause of protein damage in the
experimental glycation model of diabetes mellitus and
ageing. Biochem J 256:205–212, 1988
(5) Wolf SP: Diabetes mellitus and free radicals: free
radicals, transition metals and oxidative stress in the
etiology of diabetes mellitus and complications. Br Med
Bull 49:642– 652, 1993
(6) Santos MS, Santos DL, Palmeira CM, Seica R,
Moreno AJ, Oliviera CR: Brain and liver mitochondria
isolated from diabetic Goto-Kakizaki rats show different
susceptibility to induced oxidative stress. Diabete Metab
Res Rev 17:223–230, 2001
(7) Kannan K, Jain SK: Oxidative stress and apoptosis.
Pathophysiology 7:153–163, 2000
(8) Kroncke KD, Fehsel K, Sommer A, Rodriguez ML,
Kolb-bachofen V: Nitric oxide generation during cellular
metabolization of the diabetogenic N-methyl-n-nitroso-
urea, streptozotocin contribute to islet cell DNA damage.
Biol Chem 376:179 –185, 1995
(9) O’Brien BA, Harmon BV, Cameron DP, Allan DJ:
Beta-cell apoptosis is responsible for the development of
IDDM in the multiple low-dose streptozotocin models. J
Pathol 178:176 –181, 1996
(10) Baynes JW, Thorpe SR: Role of oxidative stress in
diabetic complications: a new perspective on an old
paradigm. Diabetes 48:1–9, 1999
(11) Mari M, Cederbaum AI: Induction of catalase, alpha
and microsomal glutathione S-transferase in CYP 2E1
overexpressing HepG2 cells and protection against
short-term oxidative stress. Hepatology 33:652– 661,
2001
(12) Lieber CS: Cytochrome P-450 2E1: its physiological
and pathological role. Physiol Rev 77:517–544, 1997

7. (13) Maritim AC, Sanders RA, Watkins JB: Effects of
alpha-lipoic acid on biomarkers of oxidative stress in
streptozotocin-induced diabetic rats. J Nutr Biochem
14(5):288-294, 2003
(14) Padayatty SJ, Daruwala R, Wang YY et al: Vitamin
C: from molecular actions to optimum intake. In:
Cadenas E, Packer L (eds) Handbook of antioxidants
(oxidative stress and disease) CRC, Marcel Dekker Inc.,
New York, Basel, Taylor & Francis Group, LLC, 2nd ed.
(chapter 7), 2002
(15) Frankel EN, Kanner J, German JB, Parks E, and
Kinsella JE Inhibition of oxidation of human low density
lipoprotein by phenolic substances in red wine. Lancet
341: 454 – 457, 1993.
(16) Frankel EN, Waterhouse AL, and Kinsella JE:
Inhibition of human LDL oxidation by resveratrol. Lancet
341: 1103–1104, 1993.
(17) Su HC, Hung LM, Chen JK: Resveratrol, a red wine
antioxidant, possesses an insulin-like effect on
streptozotocin-induced diabetic rats. Am J Physiol
Endocrinol Metab 290:E1339-E1346, 2006
(18) Giles AR: Guidelines for the use of animals in
biomedical research. Thromb Haemost 58:1078-1084,
1987
(19) Chomczynski P, Sacchi N: Singe-step method of
RNA isolation by acid guanidium thocyanate-phenol-
chloroform extraction. Anal Biochem 162:156-159, 1987
(20) Rasband WS: Image J. US National Institute of
Health, Bethesda. http://rsb.info.nih.gov/ij/, 2007
(21) Lieber CS: Microsomal Ethanol Oxidizing System
(MEOS) The First 30 Years (1968-1998)-A Review.
Alcoholism: Clinical and Experimental Research 23(6):
991-1007, 1999
(22) Young IS, Torney JJ, Trimble ER: The effect of
ascorbate supplementation on oxidative stress in the
streptozotocin diabetic rat. Free Radic Biol Med 13(1):
41-46, 1992
(23) Garg MC, Bansal DD: Protective antioxidant effect of
Vitamins C and E in streptozotcin induced diabetic rats.
Indian J Exp Biol 38(2):101-104, 2000
(24) Thomas W, Göran D, Ternes T, Anderson H, Huige
L, Witte K, Föstermann U: Resveratrol, a polyphenolic
phytoalexin present in red wine, enhances expression
and activity of endothelial nitric oxide synthase.
Circulation 106(13):1652-1658, 2002
(25) Visioli F, Smith A, Zhang W, Keaney JF, Hagen T,
Frei B: Lipoic acid and Vitamin C potentiate nitric oxide
synthesis in human aortic enothelial cells independently
of cellular glutathione status. Redox Repor 7(4):223-227,
2002
(26) Wu D, Cederbaum A: Nitric oxide donors prevent
while the nitric oxide synthase inhibitor L-NAME
increases arachidonic acid plus CYP2E1-dependent
toxicity. Toxicol Appl Pharmacol. 216(2):282-92,
2006
(27) Rubbo H, Radi R, Trujillo M, Telleri R, Kalyanaraman
B, Barnes S, Kirk M, Freeman BA Nitric oxide regulation
of superoxide and peroxynitrite-dependent lipid
peroxidation. Formation of novel nitrogen-containing
oxidized lipid derivatives. J Biol Chem 269:26066-26075,
1994
(28) Macdonald RJ, Swift GH, Przyblya A: Isolation of
RNA using guanidinium salts. Methods Enzymol
152:219-230, 1987
(29) Woodcroft KJ, Novak RF: Insulin effects on
CYP2E1, 2B, 3A and 4A expressions in primary cultured
rat hepatocytes. Chem Biol Interact. 107(1-2):75-91,
1997
(30) Johansson I, Ekstrom G, Scholte B, Puzycki D,
Jornvall H and Ingelman-Sundberg M: Ethanol-, fasting-,
and acetone-inducible cytochromes P450 in rat liver:
Regulation and characteristics of enzymes belonging to
the IIB and IIE gene subfamilies. Biochemistry 27:1925–
1934, 1988