SlideShare a Scribd company logo
1 of 18
Download to read offline
www.iita.org I www.cgiar.org
Next Generation Sequencing (NGS) Approach to Investigate
Role of Small RNAs in Cassava Defense Mechanism to
Cassava Mosaic Disease (CMD)
Olagunju T.1,2 and Gisel A.1
1International Institute of Tropical Agriculture, IITA, Ibadan, Nigeria.
2University of Ibadan, Ibadan, Nigeria.
21st IARSAF Symposium, IITA Ibadan, April 2018
www.iita.org I www.cgiar.org
INTRODUCTION
• Cassava crop important for food security
• SSA produces around 9.2 tons/ha | world average 12.3
tons/ha
• A number of factors responsible for this including pests
and diseases such as CBSD and CMD (Hillocks et al.,
2015; Mohammed et al., 2016).
• Tackling this menace entails deep understanding of host-
virus interaction for enhanced breeding.
www.iita.org I www.cgiar.org
INTRODUCTION CONTD.
• When infected by virus, plants put up a defense!
• One of such defense mechanisms involves production of
small RNAs
• Small RNAs act to post-transcriptionally regulate target
genes
Figure 1: Mechanism of gene silencing by small RNAs
www.iita.org I www.cgiar.org
INTRODUCTION CONTD.
• NGS technologies with high parallelization of sample
sequencing have made it easier to understand genomic
bases of diseases
Sequencing
PCR
Library
preparation
Figure 2: Steps in NGS sequencing
Source: https://www.slideshare.net/ueb52/introduction-to-next-generation-sequencing-v2
www.iita.org I www.cgiar.org
OBJECTIVES
• In this work, we aim to study the defense mechanism of Cassava
when infected with CMV using a computational technique based on
NGS high throughput sequencing data
1. Identify the small RNAs that are produced upon CMV infection
2. Predict the gene targets of these small RNAs
3. Compare the expression profiles of the susceptible clones with
respect to the resistant clones to CMD
www.iita.org I www.cgiar.org
MATERIALS AND METHODS
• Four genotypes of two resistant and two susceptible
Cassava plants to CMD in three replicates
TMEB117 TMS4(2)425
Figure 3: Cassava genotypes used for the study
www.iita.org I www.cgiar.org
MATERIALS AND METHODS
• Four genotypes of two resistant and two susceptible
Cassava plants to CMD in three replicates
TMEB117 TMS4(2)425 TMS961089A TMS011412
Figure 3: Cassava genotypes used for the study
www.iita.org I www.cgiar.org
MATERIALS AND METHODS
• Four genotypes of two resistant and two susceptible
Cassava plants to CMD in three replicates
• RNA extracted from leaf samples for sequencing
TMEB117 TMS4(2)425 TMS961089A TMS011412
Figure 3: Cassava genotypes used for the study
www.iita.org I www.cgiar.org
MATERIALS AND METHODS CONTD.
Computational pipeline for the analysis
Sequence Quality control
Expression
Analysis
Experimental
verification
Regulatory
network analysis
Target Prediction
Figure 4: Pipeline for the computational analysis
P-value <= 0.05
www.iita.org I www.cgiar.org
RESULTS
Host and virus mapping
0
50000
100000
150000
200000
250000
300000
350000
Total reads
Genome-aligned reads
Virus-aligned reads
Figure 5: Mapping profile of the Cassava genotypes to the host genome and virus repository
www.iita.org I www.cgiar.org
RESULTS contd.
Table1: List of some small RNAs and the targets
Exp ID source Chromosome Sequence sample1 sample2 sample3 target chromosome MFE p-value
target
feature target gene
AB A1-13163_21_x103 Chromosome01 TACACCACCGGACCAATAGAA 103 10 158 Scaffold01258-32208-33206 -35.9 0.049197 gene Manes.S079000
AB A1-749563_21_x463 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
AB A1-2429018_20_x910 Chromosome08 AGGCGTTGGTGAAAAGGTAA 910 18 2780 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700
AD A1-507298_21_x1040 Chromosome15 TTCTCAACTTCAGGATCTGGA 4957 1464 11841 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300
AD A2-1428860_21_x21 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
AD A3-975428_21_x13 Chromosome02 TTGGGCTTGATCCTGTTGCTC 22 30 13 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100
CB C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
CB C2-212596_20_x66 Chromosome08 AGGCGTTGGTGAAAAGGTAA 124 66 74 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700
CB C4-1449608_21_x13 Chromosome01 CGAACAAGTTGAGCGGAGTGG 33 23 13 Chromosome10-16304233-16305231 -37.9 0.027946 no annotation
CD C1-101279_21_x5253 Chromosome15 TTCTCAACTTCAGGATCTGGA 5253 2488 2660 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300
CD C1-1071842_21_x3 Chromosome02 TTGGGCTTGATCCTGTTGCTC 315 93 260 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100
CD C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
www.iita.org I www.cgiar.org
RESULTS contd.
• Comparing TMEB117 with both resistant lines
Genotype TMS961089A TMS011412
Common 163
Peculiar 55 15
Total 218 178
1516355
TMS961089A TMS011412
Figure 6: Comparison of TMEB117 with the two resistant genotypes to CMD
www.iita.org I www.cgiar.org
RESULTS contd.
• Comparing TMS4(2)425 with both resistant lines
Genotype TMS961089A TMS011412
Common 158
Peculiar 57 19
Total 215 177
1915857
TMS961089A TMS011412
Figure 7: Comparison of TMS4(2)425 with the two resistant genotypes to CMD
www.iita.org I www.cgiar.org
RESULTS contd.
• Comparing TMEB117 with TMS4(2)425
Genotype TMEB117 TMS4(2)425
Common 212
Peculiar 18 22
Total 230 234
2221218
TMEB117 TMS4(2)425
Figure 8: Comparison of the two susceptible genotypes to CMD
www.iita.org I www.cgiar.org
RESULTS contd.
Preliminary findings
• Small RNAs produced upon CMV infection have been identified in the genotypes
of Cassava that are susceptible to CMD
• The targets of the identified small RNAs have been predicted
• Non-mapping of the identified small RNAs to miRBase is an interesting
development – this suggests novelty
www.iita.org I www.cgiar.org
RESULTS contd.
Preliminary findings
• Small RNAs produced upon CMV infection have been identified in the genotypes
of Cassava that are susceptible to CMD
• The targets of the identified small RNAs have been predicted
• Non-mapping of the identified small RNAs to miRBase is an interesting
development – this suggests novelty
Future directions
• Analysis of the gene regulatory network mediated by these miRNAs
• Laboratory verification of these targets using RT-PCR
www.iita.org I www.cgiar.org
• Thank you for listening
www.iita.org I www.cgiar.org
Acknowledgements
Andreas Gisel (PhD)
Angela Makolo (PhD)

More Related Content

What's hot

B2.6 genetic engineering
B2.6 genetic engineeringB2.6 genetic engineering
B2.6 genetic engineering
Miss Lavin
 

What's hot (20)

Reprogramming the genome with CRISPR
Reprogramming the genome with CRISPRReprogramming the genome with CRISPR
Reprogramming the genome with CRISPR
 
Crispr cas:an advance and efficient tool for genome modification
Crispr cas:an advance and efficient tool for genome modificationCrispr cas:an advance and efficient tool for genome modification
Crispr cas:an advance and efficient tool for genome modification
 
CRISPR Gene Editing Congress, 25-27 February 2015 in Boston, MA
CRISPR Gene Editing Congress, 25-27 February 2015 in Boston, MACRISPR Gene Editing Congress, 25-27 February 2015 in Boston, MA
CRISPR Gene Editing Congress, 25-27 February 2015 in Boston, MA
 
Our Genome-Edited Future: the Promise and the Challenge
Our Genome-Edited Future: the Promise and the ChallengeOur Genome-Edited Future: the Promise and the Challenge
Our Genome-Edited Future: the Promise and the Challenge
 
RT-PCR and DNA microarray measurement of mRNA cell proliferation
RT-PCR and DNA microarray measurement of mRNA cell proliferationRT-PCR and DNA microarray measurement of mRNA cell proliferation
RT-PCR and DNA microarray measurement of mRNA cell proliferation
 
Crispr
CrisprCrispr
Crispr
 
Use of Methylation Markers for Age Estimation of an unknown Individual based ...
Use of Methylation Markers for Age Estimation of an unknown Individual based ...Use of Methylation Markers for Age Estimation of an unknown Individual based ...
Use of Methylation Markers for Age Estimation of an unknown Individual based ...
 
CRISPER-Cas9
 CRISPER-Cas9 CRISPER-Cas9
CRISPER-Cas9
 
B2.6 genetic engineering
B2.6 genetic engineeringB2.6 genetic engineering
B2.6 genetic engineering
 
CRISPR-Revolutionary Genome editing tools for Plants.....
CRISPR-Revolutionary Genome editing tools for Plants.....CRISPR-Revolutionary Genome editing tools for Plants.....
CRISPR-Revolutionary Genome editing tools for Plants.....
 
HIV RT Inhibitions in vitro and or or in vivo: materials and methods
HIV RT Inhibitions in vitro and or or in vivo: materials and methods HIV RT Inhibitions in vitro and or or in vivo: materials and methods
HIV RT Inhibitions in vitro and or or in vivo: materials and methods
 
Genome Editing in Poultry - Mark Tizard
 Genome Editing in Poultry - Mark Tizard Genome Editing in Poultry - Mark Tizard
Genome Editing in Poultry - Mark Tizard
 
Crispr future prospects in public health
Crispr  future prospects in public healthCrispr  future prospects in public health
Crispr future prospects in public health
 
Editing our genes
Editing our genesEditing our genes
Editing our genes
 
Crispr
CrisprCrispr
Crispr
 
Genome Editing Comes of Age
Genome Editing Comes of AgeGenome Editing Comes of Age
Genome Editing Comes of Age
 
Global developments of genome editing in agriculture
Global developments of genome editing in agricultureGlobal developments of genome editing in agriculture
Global developments of genome editing in agriculture
 
The CRISPR/Cas9 Toolbox
The CRISPR/Cas9 ToolboxThe CRISPR/Cas9 Toolbox
The CRISPR/Cas9 Toolbox
 
De novo RNA-seq for the study of ODAP synthesis pathway in Lathyrus sativus
De novo RNA-seq for the study of ODAP synthesis pathway in Lathyrus sativus De novo RNA-seq for the study of ODAP synthesis pathway in Lathyrus sativus
De novo RNA-seq for the study of ODAP synthesis pathway in Lathyrus sativus
 
Who owns CRISPR? - An update on the Interference.
Who owns CRISPR? - An update on the Interference.Who owns CRISPR? - An update on the Interference.
Who owns CRISPR? - An update on the Interference.
 

Similar to Next Generation Sequencing (NGS) Approach to Investigate Role of Small RNAs in Cassava Defense Mechanism to Cassava Mosaic Disease (CMD)

Ross Excel 15 Final
Ross Excel 15 FinalRoss Excel 15 Final
Ross Excel 15 Final
Brandon Ross
 
Principle, Procedure and applications of Digital PCR.pptx
Principle, Procedure  and applications of Digital PCR.pptxPrinciple, Procedure  and applications of Digital PCR.pptx
Principle, Procedure and applications of Digital PCR.pptx
Vikramadityaupmanyu
 

Similar to Next Generation Sequencing (NGS) Approach to Investigate Role of Small RNAs in Cassava Defense Mechanism to Cassava Mosaic Disease (CMD) (20)

Identification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hivIdentification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hiv
 
Ross Excel 15 Final
Ross Excel 15 FinalRoss Excel 15 Final
Ross Excel 15 Final
 
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
 
Gene Expression Analysis by Real Time PCR
Gene Expression Analysis by Real Time PCRGene Expression Analysis by Real Time PCR
Gene Expression Analysis by Real Time PCR
 
Bioinformática y supercomputación. Razones para hacerse bioinformático en la UMA
Bioinformática y supercomputación. Razones para hacerse bioinformático en la UMABioinformática y supercomputación. Razones para hacerse bioinformático en la UMA
Bioinformática y supercomputación. Razones para hacerse bioinformático en la UMA
 
IRJET- Silencing of hnRNP A1 and hnRNP A2/B1 Downregulates the Expression of ...
IRJET- Silencing of hnRNP A1 and hnRNP A2/B1 Downregulates the Expression of ...IRJET- Silencing of hnRNP A1 and hnRNP A2/B1 Downregulates the Expression of ...
IRJET- Silencing of hnRNP A1 and hnRNP A2/B1 Downregulates the Expression of ...
 
Next generation sequencing by Muhammad Abbas
Next generation sequencing by Muhammad AbbasNext generation sequencing by Muhammad Abbas
Next generation sequencing by Muhammad Abbas
 
Microarray full detail
Microarray full detailMicroarray full detail
Microarray full detail
 
Emergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciencesEmergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciences
 
seed DNA extraction.pdf
seed DNA extraction.pdfseed DNA extraction.pdf
seed DNA extraction.pdf
 
M Sc Project
M Sc ProjectM Sc Project
M Sc Project
 
High Quality DNA Isolation Suitable for Ultra Rapid Sequencing
High Quality DNA Isolation Suitable for Ultra Rapid SequencingHigh Quality DNA Isolation Suitable for Ultra Rapid Sequencing
High Quality DNA Isolation Suitable for Ultra Rapid Sequencing
 
RapportHicham
RapportHichamRapportHicham
RapportHicham
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2
 
Generations of sequencing technologies.
Generations of sequencing technologies. Generations of sequencing technologies.
Generations of sequencing technologies.
 
RNA-guided genome editing tool CRISPR-Cas9:Its Applications and Achievements ...
RNA-guided genome editing tool CRISPR-Cas9:Its Applications and Achievements ...RNA-guided genome editing tool CRISPR-Cas9:Its Applications and Achievements ...
RNA-guided genome editing tool CRISPR-Cas9:Its Applications and Achievements ...
 
Gene disc® rapid microbiology system
Gene disc® rapid microbiology systemGene disc® rapid microbiology system
Gene disc® rapid microbiology system
 
Mirnapcrarray
MirnapcrarrayMirnapcrarray
Mirnapcrarray
 
Principle, Procedure and applications of Digital PCR.pptx
Principle, Procedure  and applications of Digital PCR.pptxPrinciple, Procedure  and applications of Digital PCR.pptx
Principle, Procedure and applications of Digital PCR.pptx
 
Microarray biotechnologg ppy dna microarrays
Microarray biotechnologg ppy dna microarraysMicroarray biotechnologg ppy dna microarrays
Microarray biotechnologg ppy dna microarrays
 

More from International Institute of Tropical Agriculture

More from International Institute of Tropical Agriculture (20)

Make your research visible and create more impact using DataCite DOIs
Make your research visible and  create more impact using  DataCite DOIsMake your research visible and  create more impact using  DataCite DOIs
Make your research visible and create more impact using DataCite DOIs
 
Induction of early flowering in cassava through light supplementation and CM...
Induction of early flowering in cassava  through light supplementation and CM...Induction of early flowering in cassava  through light supplementation and CM...
Induction of early flowering in cassava through light supplementation and CM...
 
Producing yam mother plants to collect vines for propagation
Producing yam mother plants to collect  vines for propagationProducing yam mother plants to collect  vines for propagation
Producing yam mother plants to collect vines for propagation
 
Effects of moult and breeding on the body condition of some forest birds in s...
Effects of moult and breeding on the body condition of some forest birds in s...Effects of moult and breeding on the body condition of some forest birds in s...
Effects of moult and breeding on the body condition of some forest birds in s...
 
Conserving Nigeria’s rarest endemic bird: Ibadan Malimbe, Malimbusibadanensis
Conserving Nigeria’s rarest endemic bird: Ibadan Malimbe, MalimbusibadanensisConserving Nigeria’s rarest endemic bird: Ibadan Malimbe, Malimbusibadanensis
Conserving Nigeria’s rarest endemic bird: Ibadan Malimbe, Malimbusibadanensis
 
Cassava brown streak epidemiology in Eastern Democratic Republic of the Congo
Cassava brown streak epidemiology in Eastern Democratic  Republic of the CongoCassava brown streak epidemiology in Eastern Democratic  Republic of the Congo
Cassava brown streak epidemiology in Eastern Democratic Republic of the Congo
 
Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...
Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...
Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...
 
9 osunbade identification of end users preferences of a cassava product
9 osunbade identification of end users preferences of a cassava product9 osunbade identification of end users preferences of a cassava product
9 osunbade identification of end users preferences of a cassava product
 
7 helen ufondu perception of yam landraces quality among value chain actors i...
7 helen ufondu perception of yam landraces quality among value chain actors i...7 helen ufondu perception of yam landraces quality among value chain actors i...
7 helen ufondu perception of yam landraces quality among value chain actors i...
 
8 kazeem quality attributes and consumer acceptability of cookies flavoured
8 kazeem quality attributes and consumer acceptability of cookies flavoured8 kazeem quality attributes and consumer acceptability of cookies flavoured
8 kazeem quality attributes and consumer acceptability of cookies flavoured
 
6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...
6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...
6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...
 
5 seun olowote effect of drying method on caroteniod content of yellow maize
5 seun olowote effect of drying method on caroteniod content of yellow maize5 seun olowote effect of drying method on caroteniod content of yellow maize
5 seun olowote effect of drying method on caroteniod content of yellow maize
 
4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...
4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...
4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...
 
2 akin olagunju does crop diversification influenc e food and nutrition secur...
2 akin olagunju does crop diversification influenc e food and nutrition secur...2 akin olagunju does crop diversification influenc e food and nutrition secur...
2 akin olagunju does crop diversification influenc e food and nutrition secur...
 
3 akinsola carotenoid apparent retention in ogi flour made from different pro...
3 akinsola carotenoid apparent retention in ogi flour made from different pro...3 akinsola carotenoid apparent retention in ogi flour made from different pro...
3 akinsola carotenoid apparent retention in ogi flour made from different pro...
 
1 pearl amadi assessing the level of consumption of pro vitamin a cassava pr...
1 pearl amadi assessing the level of consumption of pro  vitamin a cassava pr...1 pearl amadi assessing the level of consumption of pro  vitamin a cassava pr...
1 pearl amadi assessing the level of consumption of pro vitamin a cassava pr...
 
Prof janice olawoye
Prof janice olawoyeProf janice olawoye
Prof janice olawoye
 
Inqaba biotech presentation
Inqaba biotech presentationInqaba biotech presentation
Inqaba biotech presentation
 
Iarsaf symposium adaptation to climate change
Iarsaf symposium adaptation to climate changeIarsaf symposium adaptation to climate change
Iarsaf symposium adaptation to climate change
 
Bimaf iita iarsaf presentation-ibadan 21.05.19
Bimaf  iita iarsaf presentation-ibadan 21.05.19Bimaf  iita iarsaf presentation-ibadan 21.05.19
Bimaf iita iarsaf presentation-ibadan 21.05.19
 

Recently uploaded

Russian Escorts in Abu Dhabi 0508644382 Abu Dhabi Escorts
Russian Escorts in Abu Dhabi 0508644382 Abu Dhabi EscortsRussian Escorts in Abu Dhabi 0508644382 Abu Dhabi Escorts
Russian Escorts in Abu Dhabi 0508644382 Abu Dhabi Escorts
Monica Sydney
 
Unique Value Prop slide deck________.pdf
Unique Value Prop slide deck________.pdfUnique Value Prop slide deck________.pdf
Unique Value Prop slide deck________.pdf
ScottMeyers35
 
Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...
Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...
Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...
HyderabadDolls
 
Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899
Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899
Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899
Cara Menggugurkan Kandungan 087776558899
 

Recently uploaded (20)

Lorain Road Business District Revitalization Plan Final Presentation
Lorain Road Business District Revitalization Plan Final PresentationLorain Road Business District Revitalization Plan Final Presentation
Lorain Road Business District Revitalization Plan Final Presentation
 
Delivery in 20 Mins Call Girls Malappuram { 9332606886 } VVIP NISHA Call Girl...
Delivery in 20 Mins Call Girls Malappuram { 9332606886 } VVIP NISHA Call Girl...Delivery in 20 Mins Call Girls Malappuram { 9332606886 } VVIP NISHA Call Girl...
Delivery in 20 Mins Call Girls Malappuram { 9332606886 } VVIP NISHA Call Girl...
 
Scaling up coastal adaptation in Maldives through the NAP process
Scaling up coastal adaptation in Maldives through the NAP processScaling up coastal adaptation in Maldives through the NAP process
Scaling up coastal adaptation in Maldives through the NAP process
 
Just Call VIP Call Girls In Bangalore Kr Puram ☎️ 6378878445 Independent Fem...
Just Call VIP Call Girls In  Bangalore Kr Puram ☎️ 6378878445 Independent Fem...Just Call VIP Call Girls In  Bangalore Kr Puram ☎️ 6378878445 Independent Fem...
Just Call VIP Call Girls In Bangalore Kr Puram ☎️ 6378878445 Independent Fem...
 
Russian Escorts in Abu Dhabi 0508644382 Abu Dhabi Escorts
Russian Escorts in Abu Dhabi 0508644382 Abu Dhabi EscortsRussian Escorts in Abu Dhabi 0508644382 Abu Dhabi Escorts
Russian Escorts in Abu Dhabi 0508644382 Abu Dhabi Escorts
 
Contributi dei parlamentari del PD - Contributi L. 3/2019
Contributi dei parlamentari del PD - Contributi L. 3/2019Contributi dei parlamentari del PD - Contributi L. 3/2019
Contributi dei parlamentari del PD - Contributi L. 3/2019
 
2024 UN Civil Society Conference in Support of the Summit of the Future.
2024 UN Civil Society Conference in Support of the Summit of the Future.2024 UN Civil Society Conference in Support of the Summit of the Future.
2024 UN Civil Society Conference in Support of the Summit of the Future.
 
Call Girls Koregaon Park - 8250092165 Our call girls are sure to provide you ...
Call Girls Koregaon Park - 8250092165 Our call girls are sure to provide you ...Call Girls Koregaon Park - 8250092165 Our call girls are sure to provide you ...
Call Girls Koregaon Park - 8250092165 Our call girls are sure to provide you ...
 
Kolkata Call Girls Halisahar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl ...
Kolkata Call Girls Halisahar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl ...Kolkata Call Girls Halisahar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl ...
Kolkata Call Girls Halisahar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl ...
 
tOld settlement register shouldnotaffect BTR
tOld settlement register shouldnotaffect BTRtOld settlement register shouldnotaffect BTR
tOld settlement register shouldnotaffect BTR
 
The NAP process & South-South peer learning
The NAP process & South-South peer learningThe NAP process & South-South peer learning
The NAP process & South-South peer learning
 
Unique Value Prop slide deck________.pdf
Unique Value Prop slide deck________.pdfUnique Value Prop slide deck________.pdf
Unique Value Prop slide deck________.pdf
 
NGO working for orphan children’s education
NGO working for orphan children’s educationNGO working for orphan children’s education
NGO working for orphan children’s education
 
Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...
Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...
Nagerbazar @ Independent Call Girls Kolkata - 450+ Call Girl Cash Payment 800...
 
Election 2024 Presiding Duty Keypoints_01.pdf
Election 2024 Presiding Duty Keypoints_01.pdfElection 2024 Presiding Duty Keypoints_01.pdf
Election 2024 Presiding Duty Keypoints_01.pdf
 
Vivek @ Cheap Call Girls In Kamla Nagar | Book 8448380779 Extreme Call Girls ...
Vivek @ Cheap Call Girls In Kamla Nagar | Book 8448380779 Extreme Call Girls ...Vivek @ Cheap Call Girls In Kamla Nagar | Book 8448380779 Extreme Call Girls ...
Vivek @ Cheap Call Girls In Kamla Nagar | Book 8448380779 Extreme Call Girls ...
 
Dating Call Girls inBaloda Bazar Bhatapara 9332606886Call Girls Advance Cash...
Dating Call Girls inBaloda Bazar Bhatapara  9332606886Call Girls Advance Cash...Dating Call Girls inBaloda Bazar Bhatapara  9332606886Call Girls Advance Cash...
Dating Call Girls inBaloda Bazar Bhatapara 9332606886Call Girls Advance Cash...
 
Call Girls AS Rao Nagar - 8250092165 Our call girls are sure to provide you w...
Call Girls AS Rao Nagar - 8250092165 Our call girls are sure to provide you w...Call Girls AS Rao Nagar - 8250092165 Our call girls are sure to provide you w...
Call Girls AS Rao Nagar - 8250092165 Our call girls are sure to provide you w...
 
An Atoll Futures Research Institute? Presentation for CANCC
An Atoll Futures Research Institute? Presentation for CANCCAn Atoll Futures Research Institute? Presentation for CANCC
An Atoll Futures Research Institute? Presentation for CANCC
 
Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899
Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899
Cara Gugurkan Pembuahan Secara Alami Dan Cepat ABORSI KANDUNGAN 087776558899
 

Next Generation Sequencing (NGS) Approach to Investigate Role of Small RNAs in Cassava Defense Mechanism to Cassava Mosaic Disease (CMD)

  • 1. www.iita.org I www.cgiar.org Next Generation Sequencing (NGS) Approach to Investigate Role of Small RNAs in Cassava Defense Mechanism to Cassava Mosaic Disease (CMD) Olagunju T.1,2 and Gisel A.1 1International Institute of Tropical Agriculture, IITA, Ibadan, Nigeria. 2University of Ibadan, Ibadan, Nigeria. 21st IARSAF Symposium, IITA Ibadan, April 2018
  • 2. www.iita.org I www.cgiar.org INTRODUCTION • Cassava crop important for food security • SSA produces around 9.2 tons/ha | world average 12.3 tons/ha • A number of factors responsible for this including pests and diseases such as CBSD and CMD (Hillocks et al., 2015; Mohammed et al., 2016). • Tackling this menace entails deep understanding of host- virus interaction for enhanced breeding.
  • 3. www.iita.org I www.cgiar.org INTRODUCTION CONTD. • When infected by virus, plants put up a defense! • One of such defense mechanisms involves production of small RNAs • Small RNAs act to post-transcriptionally regulate target genes Figure 1: Mechanism of gene silencing by small RNAs
  • 4. www.iita.org I www.cgiar.org INTRODUCTION CONTD. • NGS technologies with high parallelization of sample sequencing have made it easier to understand genomic bases of diseases Sequencing PCR Library preparation Figure 2: Steps in NGS sequencing Source: https://www.slideshare.net/ueb52/introduction-to-next-generation-sequencing-v2
  • 5. www.iita.org I www.cgiar.org OBJECTIVES • In this work, we aim to study the defense mechanism of Cassava when infected with CMV using a computational technique based on NGS high throughput sequencing data 1. Identify the small RNAs that are produced upon CMV infection 2. Predict the gene targets of these small RNAs 3. Compare the expression profiles of the susceptible clones with respect to the resistant clones to CMD
  • 6. www.iita.org I www.cgiar.org MATERIALS AND METHODS • Four genotypes of two resistant and two susceptible Cassava plants to CMD in three replicates TMEB117 TMS4(2)425 Figure 3: Cassava genotypes used for the study
  • 7. www.iita.org I www.cgiar.org MATERIALS AND METHODS • Four genotypes of two resistant and two susceptible Cassava plants to CMD in three replicates TMEB117 TMS4(2)425 TMS961089A TMS011412 Figure 3: Cassava genotypes used for the study
  • 8. www.iita.org I www.cgiar.org MATERIALS AND METHODS • Four genotypes of two resistant and two susceptible Cassava plants to CMD in three replicates • RNA extracted from leaf samples for sequencing TMEB117 TMS4(2)425 TMS961089A TMS011412 Figure 3: Cassava genotypes used for the study
  • 9. www.iita.org I www.cgiar.org MATERIALS AND METHODS CONTD. Computational pipeline for the analysis Sequence Quality control Expression Analysis Experimental verification Regulatory network analysis Target Prediction Figure 4: Pipeline for the computational analysis P-value <= 0.05
  • 10. www.iita.org I www.cgiar.org RESULTS Host and virus mapping 0 50000 100000 150000 200000 250000 300000 350000 Total reads Genome-aligned reads Virus-aligned reads Figure 5: Mapping profile of the Cassava genotypes to the host genome and virus repository
  • 11. www.iita.org I www.cgiar.org RESULTS contd. Table1: List of some small RNAs and the targets Exp ID source Chromosome Sequence sample1 sample2 sample3 target chromosome MFE p-value target feature target gene AB A1-13163_21_x103 Chromosome01 TACACCACCGGACCAATAGAA 103 10 158 Scaffold01258-32208-33206 -35.9 0.049197 gene Manes.S079000 AB A1-749563_21_x463 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900 AB A1-2429018_20_x910 Chromosome08 AGGCGTTGGTGAAAAGGTAA 910 18 2780 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700 AD A1-507298_21_x1040 Chromosome15 TTCTCAACTTCAGGATCTGGA 4957 1464 11841 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300 AD A2-1428860_21_x21 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900 AD A3-975428_21_x13 Chromosome02 TTGGGCTTGATCCTGTTGCTC 22 30 13 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100 CB C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900 CB C2-212596_20_x66 Chromosome08 AGGCGTTGGTGAAAAGGTAA 124 66 74 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700 CB C4-1449608_21_x13 Chromosome01 CGAACAAGTTGAGCGGAGTGG 33 23 13 Chromosome10-16304233-16305231 -37.9 0.027946 no annotation CD C1-101279_21_x5253 Chromosome15 TTCTCAACTTCAGGATCTGGA 5253 2488 2660 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300 CD C1-1071842_21_x3 Chromosome02 TTGGGCTTGATCCTGTTGCTC 315 93 260 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100 CD C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
  • 12. www.iita.org I www.cgiar.org RESULTS contd. • Comparing TMEB117 with both resistant lines Genotype TMS961089A TMS011412 Common 163 Peculiar 55 15 Total 218 178 1516355 TMS961089A TMS011412 Figure 6: Comparison of TMEB117 with the two resistant genotypes to CMD
  • 13. www.iita.org I www.cgiar.org RESULTS contd. • Comparing TMS4(2)425 with both resistant lines Genotype TMS961089A TMS011412 Common 158 Peculiar 57 19 Total 215 177 1915857 TMS961089A TMS011412 Figure 7: Comparison of TMS4(2)425 with the two resistant genotypes to CMD
  • 14. www.iita.org I www.cgiar.org RESULTS contd. • Comparing TMEB117 with TMS4(2)425 Genotype TMEB117 TMS4(2)425 Common 212 Peculiar 18 22 Total 230 234 2221218 TMEB117 TMS4(2)425 Figure 8: Comparison of the two susceptible genotypes to CMD
  • 15. www.iita.org I www.cgiar.org RESULTS contd. Preliminary findings • Small RNAs produced upon CMV infection have been identified in the genotypes of Cassava that are susceptible to CMD • The targets of the identified small RNAs have been predicted • Non-mapping of the identified small RNAs to miRBase is an interesting development – this suggests novelty
  • 16. www.iita.org I www.cgiar.org RESULTS contd. Preliminary findings • Small RNAs produced upon CMV infection have been identified in the genotypes of Cassava that are susceptible to CMD • The targets of the identified small RNAs have been predicted • Non-mapping of the identified small RNAs to miRBase is an interesting development – this suggests novelty Future directions • Analysis of the gene regulatory network mediated by these miRNAs • Laboratory verification of these targets using RT-PCR
  • 17. www.iita.org I www.cgiar.org • Thank you for listening
  • 18. www.iita.org I www.cgiar.org Acknowledgements Andreas Gisel (PhD) Angela Makolo (PhD)