SlideShare a Scribd company logo
1 of 21
Monitoring the quality of
data in the clinical use of
pathogen genomes
Dr Tom Conway
IBM Research Australia
Uses of Microbial Genomes: Public Health
Infected Food Microbiological
Investigation
Cluster
Analysis
Uses of Microbial Genomes: Clinical
Antibiotic
Resistance Test
Detecting
Resistance Genes
Current Practice Genomics Methods
Typical Genomics Workflow
Sample Prep
Sequencing
Sequence Data
Analytics
Reporting InterventionSequence Data
Measuring Sequence Quality
Using a Reference Sequence
alignment
Reference
Sequences
that failed to
align to
reference
x
x
x
x x o
x o
xo
x
x
Sequence fragment
Sequence Data as Words
1: imped, and shivered, and glafed, and growled; and
2: wind was rushing was the sea; and that the smwll
3: nd broad impression of thk identity of things seem
(from Great Expectations with apologies to Charles Dickens)
Sequence Data as Words
GTGGGTTTTTATCGGCTGGCACATGTGTTGGG
GTGGGT TTTATC GCTGGC CATGTG
TGGGTT TTATCG CTGGCA ATGTGT
GGGTTT TATCGG TGGCAC TGTGTT
GGTTTT ATCGGC GGCACA GTGTTG
GTTTTT TCGGCT GCACAT TGTTGG
TTTTTA CGGCTG CACATG GTTGGG
TTTTAT GGCTGG ACATGT
Accumulating Fragments: 10,000
#differentwords
word frequency
Accumulating Fragments: 20,000
#differentwords
word frequency
Accumulating Fragments: 50,000
#differentwords
word frequency
Accumulating Fragments: 100,000
#differentwords
word frequency
Accumulating Fragments: 200,000
#differentwords
word frequency
Accumulating Fragments: 500,000
#differentwords
word frequency
Accumulating Fragments: 1,000,000
#differentwords
word frequency
Accumulating Fragments: 1,000,000
#differentwords
word frequency
Differentiating True and False Words
#differentwords
word frequency
Estimated Genome Size
Isolate Number
EstimatedGenomeSize(Mbp)
Isolate Number
TrueWordFraction
True Word Fraction
Why This is Valuable
Quantifiable Robust
Efficient
Species
Independent
Actionable
Interpretable
The Team
Tom
Conway
Jeremy
Wazny
Justin
Bedo
Mahtab
Mirmomeni
Ben
Goudey
Kelly
Wyres
Natalie
Gunn
Hannah
Huckstep

More Related Content

What's hot

Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...Golden Helix Inc
 
Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)Tania Acuna
 
The Genomics Revolution: The Good, The Bad, and The Ugly
The Genomics Revolution: The Good, The Bad, and The UglyThe Genomics Revolution: The Good, The Bad, and The Ugly
The Genomics Revolution: The Good, The Bad, and The UglyEmiliano De Cristofaro
 
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)Emiliano De Cristofaro
 
Monarch Initiative Poster - Rare Disease Symposium 2015
Monarch Initiative Poster - Rare Disease Symposium 2015Monarch Initiative Poster - Rare Disease Symposium 2015
Monarch Initiative Poster - Rare Disease Symposium 2015Nicole Vasilevsky
 
How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationJoaquin Dopazo
 
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...FOODCROPS
 
Comprehensive Exam Slides 11/13/2013
Comprehensive Exam Slides 11/13/2013Comprehensive Exam Slides 11/13/2013
Comprehensive Exam Slides 11/13/2013Qingpeng "Q.P." Zhang
 
Multigenic (mechanistic) biomarkers
Multigenic (mechanistic) biomarkersMultigenic (mechanistic) biomarkers
Multigenic (mechanistic) biomarkersJoaquin Dopazo
 
Single-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and ChallengesSingle-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and Challengesinside-BigData.com
 
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypesFocusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypesRoxana Hickey
 
Global surveillance One World – One Health
Global surveillance  One World – One HealthGlobal surveillance  One World – One Health
Global surveillance One World – One HealthExternalEvents
 
Bioinformatics in dermato-oncology
Bioinformatics in dermato-oncologyBioinformatics in dermato-oncology
Bioinformatics in dermato-oncologyJoaquin Dopazo
 
The server of the Spanish Population Variability
The server of the Spanish Population VariabilityThe server of the Spanish Population Variability
The server of the Spanish Population VariabilityJoaquin Dopazo
 
ZFN-Science-Rats
ZFN-Science-RatsZFN-Science-Rats
ZFN-Science-RatsGreg Davis
 
PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6Rita Auro
 
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...QIAGEN
 
Microbial Metagenomics and Human Health
Microbial Metagenomics and Human HealthMicrobial Metagenomics and Human Health
Microbial Metagenomics and Human HealthLarry Smarr
 

What's hot (20)

Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
 
Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)
 
The Genomics Revolution: The Good, The Bad, and The Ugly
The Genomics Revolution: The Good, The Bad, and The UglyThe Genomics Revolution: The Good, The Bad, and The Ugly
The Genomics Revolution: The Good, The Bad, and The Ugly
 
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
 
Monarch Initiative Poster - Rare Disease Symposium 2015
Monarch Initiative Poster - Rare Disease Symposium 2015Monarch Initiative Poster - Rare Disease Symposium 2015
Monarch Initiative Poster - Rare Disease Symposium 2015
 
How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical information
 
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
 
Comprehensive Exam Slides 11/13/2013
Comprehensive Exam Slides 11/13/2013Comprehensive Exam Slides 11/13/2013
Comprehensive Exam Slides 11/13/2013
 
Multigenic (mechanistic) biomarkers
Multigenic (mechanistic) biomarkersMultigenic (mechanistic) biomarkers
Multigenic (mechanistic) biomarkers
 
Single-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and ChallengesSingle-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and Challenges
 
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypesFocusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
 
Global surveillance One World – One Health
Global surveillance  One World – One HealthGlobal surveillance  One World – One Health
Global surveillance One World – One Health
 
Bioinformatics in dermato-oncology
Bioinformatics in dermato-oncologyBioinformatics in dermato-oncology
Bioinformatics in dermato-oncology
 
Resume
ResumeResume
Resume
 
The server of the Spanish Population Variability
The server of the Spanish Population VariabilityThe server of the Spanish Population Variability
The server of the Spanish Population Variability
 
ZFN-Science-Rats
ZFN-Science-RatsZFN-Science-Rats
ZFN-Science-Rats
 
PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6
 
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
 
Metagenomics
MetagenomicsMetagenomics
Metagenomics
 
Microbial Metagenomics and Human Health
Microbial Metagenomics and Human HealthMicrobial Metagenomics and Human Health
Microbial Metagenomics and Human Health
 

Similar to Monitoring data quality in clinical pathogen genomes

Transcriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDFTranscriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDFJanaya Shelly
 
Genomics2 Phenomics Complete
Genomics2 Phenomics CompleteGenomics2 Phenomics Complete
Genomics2 Phenomics CompleteInterpretOmics
 
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...Cirdan
 
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike SnyderPersonalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike SnyderThe Hive
 
Big data biology for pythonistas: getting in on the genomics revolution
Big data biology for pythonistas: getting in on the genomics revolutionBig data biology for pythonistas: getting in on the genomics revolution
Big data biology for pythonistas: getting in on the genomics revolutionDarya Vanichkina
 
Gardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in MedicineGardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in MedicineAmanda Natalizio
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Joaquin Dopazo
 
1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdf1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdfdeepakangel
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleLaurence Dawkins-Hall
 
Teresa Coque Hospital Universitario Ramón y Cajal.
Teresa Coque  Hospital Universitario Ramón y Cajal. Teresa Coque  Hospital Universitario Ramón y Cajal.
Teresa Coque Hospital Universitario Ramón y Cajal. Fundación Ramón Areces
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Ian Foster
 
Moving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel DudleyMoving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel DudleyCityAge
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsIncedo
 

Similar to Monitoring data quality in clinical pathogen genomes (20)

Transcriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDFTranscriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDF
 
Dna microarray mehran- u of toronto
Dna microarray  mehran- u of torontoDna microarray  mehran- u of toronto
Dna microarray mehran- u of toronto
 
Genomics2 Phenomics Complete
Genomics2 Phenomics CompleteGenomics2 Phenomics Complete
Genomics2 Phenomics Complete
 
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
 
ACC Cancer Cell May 2016
ACC Cancer Cell May 2016ACC Cancer Cell May 2016
ACC Cancer Cell May 2016
 
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike SnyderPersonalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
 
Big data biology for pythonistas: getting in on the genomics revolution
Big data biology for pythonistas: getting in on the genomics revolutionBig data biology for pythonistas: getting in on the genomics revolution
Big data biology for pythonistas: getting in on the genomics revolution
 
Gardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in MedicineGardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in Medicine
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...
 
1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdf1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdf
 
The Human Genome Project
The Human Genome Project The Human Genome Project
The Human Genome Project
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattle
 
Teresa Coque Hospital Universitario Ramón y Cajal.
Teresa Coque  Hospital Universitario Ramón y Cajal. Teresa Coque  Hospital Universitario Ramón y Cajal.
Teresa Coque Hospital Universitario Ramón y Cajal.
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009
 
Madrid icgc pcawg_2016_slideshare
Madrid icgc pcawg_2016_slideshareMadrid icgc pcawg_2016_slideshare
Madrid icgc pcawg_2016_slideshare
 
Plos
PlosPlos
Plos
 
Moving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel DudleyMoving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
JALANov2000
JALANov2000JALANov2000
JALANov2000
 
4. HGP.pptx
4. HGP.pptx4. HGP.pptx
4. HGP.pptx
 

More from Health Informatics New Zealand

The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...Health Informatics New Zealand
 
Shaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voiceShaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voiceHealth Informatics New Zealand
 
Laptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health serviceLaptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health serviceHealth Informatics New Zealand
 
Safe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thingSafe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thingHealth Informatics New Zealand
 
Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...Health Informatics New Zealand
 
Using the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsisUsing the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsisHealth Informatics New Zealand
 
Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?Health Informatics New Zealand
 
Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...Health Informatics New Zealand
 
Overview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information SystemOverview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information SystemHealth Informatics New Zealand
 
Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...Health Informatics New Zealand
 
Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...Health Informatics New Zealand
 
"Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of..."Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of...Health Informatics New Zealand
 
The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?Health Informatics New Zealand
 

More from Health Informatics New Zealand (20)

The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...
 
Shaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voiceShaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voice
 
Surveillance of social media: Big data analytics
Surveillance of social media: Big data analyticsSurveillance of social media: Big data analytics
Surveillance of social media: Big data analytics
 
The Power of Surface Modelling
The Power of Surface ModellingThe Power of Surface Modelling
The Power of Surface Modelling
 
Laptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health serviceLaptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health service
 
Making surgical practice improvement easy
Making surgical practice improvement easyMaking surgical practice improvement easy
Making surgical practice improvement easy
 
Safe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thingSafe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thing
 
Beyond EMR - so you've got an EMR - what next?
Beyond EMR - so you've got an EMR - what next?Beyond EMR - so you've got an EMR - what next?
Beyond EMR - so you've got an EMR - what next?
 
Empowered Health
Empowered HealthEmpowered Health
Empowered Health
 
Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...
 
Using the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsisUsing the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsis
 
Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?
 
Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...
 
Overview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information SystemOverview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information System
 
Nhitb wednesday 9am plenary (sadhana first)
Nhitb wednesday 9am plenary (sadhana first)Nhitb wednesday 9am plenary (sadhana first)
Nhitb wednesday 9am plenary (sadhana first)
 
Oncology treatment patterns in the South Island
Oncology treatment patterns in the South IslandOncology treatment patterns in the South Island
Oncology treatment patterns in the South Island
 
Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...
 
Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...
 
"Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of..."Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of...
 
The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?
 

Recently uploaded

2024 HCAT Healthcare Technology Insights
2024 HCAT Healthcare Technology Insights2024 HCAT Healthcare Technology Insights
2024 HCAT Healthcare Technology InsightsHealth Catalyst
 
Russian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOW
Russian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOWRussian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOW
Russian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOWsangeevkumar5478
 
Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...
Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...
Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...narwatsonia7
 
Pregnancy and Breastfeeding Dental Considerations.pptx
Pregnancy and Breastfeeding Dental Considerations.pptxPregnancy and Breastfeeding Dental Considerations.pptx
Pregnancy and Breastfeeding Dental Considerations.pptxcrosalofton
 
Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 ) unlimited hard...
Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 )  unlimited hard...Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 )  unlimited hard...
Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 ) unlimited hard...ggsonu500
 
Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...
Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...
Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...narwatsonia7
 
MVP Health Care City of Schenectady Presentation
MVP Health Care City of Schenectady PresentationMVP Health Care City of Schenectady Presentation
MVP Health Care City of Schenectady PresentationMVP Health Care
 
2025 Inpatient Prospective Payment System (IPPS) Proposed Rule
2025 Inpatient Prospective Payment System (IPPS) Proposed Rule2025 Inpatient Prospective Payment System (IPPS) Proposed Rule
2025 Inpatient Prospective Payment System (IPPS) Proposed RuleShelby Lewis
 
Single Assessment Framework - What We Know So Far
Single Assessment Framework - What We Know So FarSingle Assessment Framework - What We Know So Far
Single Assessment Framework - What We Know So FarCareLineLive
 
independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...
independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...
independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...narwatsonia7
 
Book Call Girls in Hosur - 7001305949 | 24x7 Service Available Near Me
Book Call Girls in Hosur - 7001305949 | 24x7 Service Available Near MeBook Call Girls in Hosur - 7001305949 | 24x7 Service Available Near Me
Book Call Girls in Hosur - 7001305949 | 24x7 Service Available Near Menarwatsonia7
 
Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...
Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...
Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...satishsharma69855
 
Call Girls South Delhi 9999965857 Cheap and Best with original Photos
Call Girls South Delhi 9999965857 Cheap and Best with original PhotosCall Girls South Delhi 9999965857 Cheap and Best with original Photos
Call Girls South Delhi 9999965857 Cheap and Best with original Photosparshadkalavatidevi7
 
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...ggsonu500
 
Russian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service availableRussian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service availablesandeepkumar69420
 
Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...
Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...
Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...scanFOAM
 
Russian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment Booking
Russian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment BookingRussian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment Booking
Russian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service MumbaiCollege Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...ggsonu500
 

Recently uploaded (20)

2024 HCAT Healthcare Technology Insights
2024 HCAT Healthcare Technology Insights2024 HCAT Healthcare Technology Insights
2024 HCAT Healthcare Technology Insights
 
Russian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOW
Russian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOWRussian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOW
Russian Escorts Service Delhi 9711199171 SONI VIP & HOT BOOK NOW
 
Russian Call Girls Jor Bagh 9711199171 discount on your booking
Russian Call Girls Jor Bagh 9711199171 discount on your bookingRussian Call Girls Jor Bagh 9711199171 discount on your booking
Russian Call Girls Jor Bagh 9711199171 discount on your booking
 
Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...
Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...
Housewife Call Girls Nandini Layout - Phone No 7001305949 For Ultimate Sexual...
 
Pregnancy and Breastfeeding Dental Considerations.pptx
Pregnancy and Breastfeeding Dental Considerations.pptxPregnancy and Breastfeeding Dental Considerations.pptx
Pregnancy and Breastfeeding Dental Considerations.pptx
 
Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 ) unlimited hard...
Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 )  unlimited hard...Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 )  unlimited hard...
Gurgaon Sushant Lok Phase 2 Call Girls Service ( 9873940964 ) unlimited hard...
 
Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...
Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...
Hi,Fi Call Girl In Whitefield - [ Cash on Delivery ] Contact 7001305949 Escor...
 
MVP Health Care City of Schenectady Presentation
MVP Health Care City of Schenectady PresentationMVP Health Care City of Schenectady Presentation
MVP Health Care City of Schenectady Presentation
 
2025 Inpatient Prospective Payment System (IPPS) Proposed Rule
2025 Inpatient Prospective Payment System (IPPS) Proposed Rule2025 Inpatient Prospective Payment System (IPPS) Proposed Rule
2025 Inpatient Prospective Payment System (IPPS) Proposed Rule
 
Single Assessment Framework - What We Know So Far
Single Assessment Framework - What We Know So FarSingle Assessment Framework - What We Know So Far
Single Assessment Framework - What We Know So Far
 
independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...
independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...
independent Call Girls Sarjapur Road - 7001305949 with real photos and phone ...
 
Book Call Girls in Hosur - 7001305949 | 24x7 Service Available Near Me
Book Call Girls in Hosur - 7001305949 | 24x7 Service Available Near MeBook Call Girls in Hosur - 7001305949 | 24x7 Service Available Near Me
Book Call Girls in Hosur - 7001305949 | 24x7 Service Available Near Me
 
Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...
Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...
Russian Call Girls Delhi Cantt | 9711199171 | High Profile -New Model -Availa...
 
Call Girls South Delhi 9999965857 Cheap and Best with original Photos
Call Girls South Delhi 9999965857 Cheap and Best with original PhotosCall Girls South Delhi 9999965857 Cheap and Best with original Photos
Call Girls South Delhi 9999965857 Cheap and Best with original Photos
 
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
 
Russian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service availableRussian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service available
 
Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...
Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...
Experience learning - lessons from 25 years of ATACC - Mark Forrest and Halde...
 
Russian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment Booking
Russian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment BookingRussian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment Booking
Russian Call Girls Sadashivanagar | 7001305949 At Low Cost Cash Payment Booking
 
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service MumbaiCollege Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
 
Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 68 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
 

Monitoring data quality in clinical pathogen genomes