Den Viren ein Schnippchen schlagen:Wie unser immunsensorisches System Erreger beseitigtProf. Dr. med. Gunther Hartmann    ...
Die Angst vor Viren
Viren tricksen uns immer wieder aus!
Virus: unsichtbar, unberechenbar, tödlich
Das Ziel der Viren: die Zellen                                            Zelle                                 Zellkern
Die Zelle umprogrammiert: Virusproduktion             Aber:             T-Zellen brauchen eine Woche!
Finsteres Mittelalter am Rhein:Das Epizentrum des Abwehrkampfes!
BurgenSoweit das Auge reicht!
Flagge zeigen
Eindringlinge mit fremder Flagge bekämpfen
Wenn alles gut geht dann verliert der Eindringling!                                     A British contribution
Welche Flagge zeigen Viren?
Self made: Virus entsteht aus "selbst"                                  Respiratory Syncytial Virus                       ...
Protein             Nukleinsäure                     ATP                      4 Nukleotide20 Aminosäuren                 A...
Bildung von RNADNA                     RNA
Der genetische Code
Protein      Nukleinsäure  Protein            DNA         RNA
Nukleinsäure und Protein in gesunder Zelle                                         Zelle                                  ...
Virale Proteine und Nukleinsäuren in der ZelleVirus                                                   Zelle               ...
Adaptive Immunantwort gegen Virus-Proteine erst nach einer Woche                             T-Zelle            Virus     ...
Die Flagge der Viren:Virale Nukleinsäure in der Zelle                             !      !                                ...
Nüsslein-Volhard                                                                    TübingenToll-ähnliche Rezeptoren: Toll...
Bedeutung für Autoimmunität:Virus-ähnliche Erkennung von eigener Nukleinsäure                                         Auto...
Zytosolische Erkennung von viralen Nukleinsäuren: RIG-I and MDA-5, and AIM2                                         Virus ...
Zytosolische Erkennung von viraler Einzelstrang-RNA?                                Virus                                 ...
Was könnte bei Einzelstrang-RNA als Unterscheidungsmerkmal dienen?            Virus                                       ...
Veränderungen der RNA vor Verlassen des Zellkerns                 Im Zellkern                   Außerhalb des Zellkerns   ...
Keine RNA mit Triphosphat-Gruppe außerhalb des Zellkerns                 Im Zellkern                                      ...
Keine RNA mit Triphosphat-Gruppe außerhalb des Zellkerns                 Im Zellkern                                      ...
Geschnittene RNA besitzt keine Triphosphat-Gruppe!  Primäre transkribierte RNA                                     Geschni...
Boten-RNA erhält eine Guanosin-Kappe auf das Triphosphat!      Primäre transkribierte RNA                                 ...
Wege der Erkennung von viralen Nukleinsäure im Zellinneren!Triphosphat-RNA ist der Ligand für RIG-IHornung...and Hartmann ...
Flagge zeigen: Virus oder Bakterium                                                                            Antibakteri...
Unser Beitrag: Identifizierung und Charakterisierung vonNukleinsäure-Liganden                                     1. TLR9:...
Pharmakologie: from Bench to Bedside                        Biologicals          Proteine         (Viren)     Nukleinsäure...
Unser Beitrag: Identifizierung und Charakterisierung vonNukleinsäure-Liganden                                     1. TLR9:...
RIG-I: Erkennung von Einzelstrang-RNA Viren         5‘                                   3‘       3P- AACACACACACACACACACA...
Retinoic acid inducible gene I (RIG-I)                                Helikase ATPaseKristallisierung                     ...
Strukturelle und funktionelle Charakterisierung der Bindungstasche                                                        ...
Aktive N1-Methylierung verhindert Erkennung von selbst-RNA                         MTr-1   MTr-2
Aktive N1-Methylierung verhindert Erkennung von selbst-RNA                         MTr-1   MTr-2
Viren methylieren an N1 um eine Erkennung aktiv zu umgehen  • Das m7G-Cap allein hat kaum einen Einfluss auf RIG-I  • Einz...
RIG-I Ligand: effektive Tumortherapie                         RIG-I ligand
Institute of Clinical Chemistry and Clinical Pharmacology                                                            Bonn ...
2012   Immune sensing: pattern recognition receptors:
Textbook: Sensing of non-self by pattern                 recognition receptors initiates a tailored                       ...
New challenge: Immune function of “non-immune“ cellsnaive CD8 T-cell                   Tolerization                       ...
Systemic interplay : e.g. antiviral defense                        neurons        hepatocytes         macrophages         ...
Unsere Sinnesorgane                      The immune sensory system:                      our sense for health
Bonn Cluster of ExcellenceNew opportunities in Bonn: Excellence Cluster ImmunoSensation3 Chairs in Immunology4 Permanent P...
GDNÄ 2012: Prof. Gunther Hartmann - Wie unser immunsensorisches System Erreger beseitigt.
GDNÄ 2012: Prof. Gunther Hartmann - Wie unser immunsensorisches System Erreger beseitigt.
GDNÄ 2012: Prof. Gunther Hartmann - Wie unser immunsensorisches System Erreger beseitigt.
Nächste SlideShare
Wird geladen in …5

GDNÄ 2012: Prof. Gunther Hartmann - Wie unser immunsensorisches System Erreger beseitigt.

860 Aufrufe

Veröffentlicht am

Veröffentlicht in: Bildung
  • Als Erste(r) kommentieren

  • Gehören Sie zu den Ersten, denen das gefällt!

GDNÄ 2012: Prof. Gunther Hartmann - Wie unser immunsensorisches System Erreger beseitigt.

  1. 1. Den Viren ein Schnippchen schlagen:Wie unser immunsensorisches System Erreger beseitigtProf. Dr. med. Gunther Hartmann Bonn Cluster of Excellence
  2. 2. Die Angst vor Viren
  3. 3. Viren tricksen uns immer wieder aus!
  4. 4. Virus: unsichtbar, unberechenbar, tödlich
  5. 5. Das Ziel der Viren: die Zellen Zelle Zellkern
  6. 6. Die Zelle umprogrammiert: Virusproduktion Aber: T-Zellen brauchen eine Woche!
  7. 7. Finsteres Mittelalter am Rhein:Das Epizentrum des Abwehrkampfes!
  8. 8. BurgenSoweit das Auge reicht!
  9. 9. Flagge zeigen
  10. 10. Eindringlinge mit fremder Flagge bekämpfen
  11. 11. Wenn alles gut geht dann verliert der Eindringling! A British contribution
  12. 12. Welche Flagge zeigen Viren?
  13. 13. Self made: Virus entsteht aus "selbst" Respiratory Syncytial Virus EpithelzelleFremderkennung?
  14. 14. NukleinsäureProtein
  15. 15. Protein Nukleinsäure ATP 4 Nukleotide20 Aminosäuren A T Proteine DNA RNA
  16. 16. Bildung von RNADNA RNA
  17. 17. Der genetische Code
  18. 18. Protein Nukleinsäure Protein DNA RNA
  19. 19. Nukleinsäure und Protein in gesunder Zelle Zelle Zellkern RNA DNA
  20. 20. Virale Proteine und Nukleinsäuren in der ZelleVirus Zelle Zellkern RNA DNA
  21. 21. Adaptive Immunantwort gegen Virus-Proteine erst nach einer Woche T-Zelle Virus Antikörper Zelle Zellkern RNA DNA
  22. 22. Die Flagge der Viren:Virale Nukleinsäure in der Zelle ! ! Zelle ! Zellkern RNA DNA Ungewöhnliche Orte für Nukleinsäuren: Alarm!
  23. 23. Nüsslein-Volhard TübingenToll-ähnliche Rezeptoren: Toll-like receptors, TLR Nobelpreis 1995Erkennung von viraler Nukleinsäure im Endosom Entdeckung des Toll-Gens Endosom DNA long dsRNA CpG short dsRNA ssRNA ssRNA TLR3 TLR9 TLR7 TLR8
  24. 24. Bedeutung für Autoimmunität:Virus-ähnliche Erkennung von eigener Nukleinsäure Autoantikörper-Protein-Nukleinsäure-Komplex DNA long dsRNA CpG short dsRNA ssRNA ssRNA TLR3 TLR9 TLR7 TLR8
  25. 25. Zytosolische Erkennung von viralen Nukleinsäuren: RIG-I and MDA-5, and AIM2 Virus MDA-5 AIM2 RIG-I ?
  26. 26. Zytosolische Erkennung von viraler Einzelstrang-RNA? Virus ?
  27. 27. Was könnte bei Einzelstrang-RNA als Unterscheidungsmerkmal dienen? Virus Zelle Zellkern RNA DNA
  28. 28. Veränderungen der RNA vor Verlassen des Zellkerns Im Zellkern Außerhalb des Zellkerns Bildung Prozessierung von RNA von RNA
  29. 29. Keine RNA mit Triphosphat-Gruppe außerhalb des Zellkerns Im Zellkern Außerhalb des Zellkerns Bildung Prozessierung von von RNA RNA
  30. 30. Keine RNA mit Triphosphat-Gruppe außerhalb des Zellkerns Im Zellkern Außerhalb des Zellkerns Bildung Prozessierung von von RNA RNA
  31. 31. Geschnittene RNA besitzt keine Triphosphat-Gruppe! Primäre transkribierte RNA Geschnittene RNA 5’ 5’ B O O O B HO O P P PO O O- O O O- O- O- O OH O OH O- P O- B O- P O- B O O O O O OH O OH N O- P O- B O- P O- B O O O O O OH O OH O- P O- B O- P O- B O O O O OH OH 3’ 3’
  32. 32. Boten-RNA erhält eine Guanosin-Kappe auf das Triphosphat! Primäre transkribierte RNA RNA mit einer Guanosin-Kappe 5’ OH HO 5’ O O O B O O O B P P PO O P P PO O CH2 O- O O O O- O O N N O- O- O- O- O- O- O OH O OH N O- P O- B O- P O- B NH2 CH3 O O O O O OH O OH N O- P O- B O- P O- B O O O O O OH O OH O- P O- B O- P O- B O O O O OH OH 3’ 3’
  33. 33. Wege der Erkennung von viralen Nukleinsäure im Zellinneren!Triphosphat-RNA ist der Ligand für RIG-IHornung...and Hartmann Science, 2006 Virus 3p RIG-I MDA-5 AIM2
  34. 34. Flagge zeigen: Virus oder Bakterium Antibakterielle TLR2 TLR4 TLR5 TLR6 Immunantwort CpG TLR3 TLR9 TLR7 TLR8 3p RIG-I MDA-5 AIM2 Antivirale Immunantwort: Interferon-alpha, Zytokine Immunzellaktivierung Genexpressionshemmung Apoptose
  35. 35. Unser Beitrag: Identifizierung und Charakterisierung vonNukleinsäure-Liganden 1. TLR9: CpG DNA Endosome Hartmann G. and Krieg A.M. J Immunol 2000a Hartmann G. et al. J Immunol 2000bTLR3 TLR9 TLR7 TLR8 RIG-I MDA-5 Antivirale Antwort
  36. 36. Pharmakologie: from Bench to Bedside Biologicals Proteine (Viren) Nukleinsäuren Vektoren OligonukleotideCpG-OligonukleotidODN 2006 5’-TCG TCG TTT TGT CGT TTT GTC GTT-3’ODN 7909 Hartmann G. and Krieg A.M. J Immunol 2000a, 164:944(ProMuneR) Hartmann G. et al. J Immunol 2000b, 164:1617 Aktuell 17 klinische Studien bei FDA registriert, davon 2 Phase III Studien
  37. 37. Unser Beitrag: Identifizierung und Charakterisierung vonNukleinsäure-Liganden 1. TLR9: CpG DNA Endosome Hartmann G. and Krieg A.M. J Immunol 2000a Hartmann G. et al. J Immunol 2000bTLR3 2. TLR7/8: Von siRNA zu isRNA TLR9 Hornung...and Hartmann Nat Med, 2005 TLR7 TLR8 RIG-I 3. RIG-I: 3pRNA Hornung...and Hartmann Science, 2006 MDA-5 4. RIG-I: 3pRNA in der Tumortherapie Poeck...and Hartmann Nat Med, 2008 5. RIG-I: Glatte Doppelstrang-RNA-Enden Schlee...and Hartmann Immunity, 2009 Antivirale Antwort 6. RIG-I: Kristallstruktur der Liganden-Bindun Wang...Hartmann and Patel Nat Struct Cell Biol, 2010
  38. 38. RIG-I: Erkennung von Einzelstrang-RNA Viren 5‘ 3‘ 3P- AACACACACACACACACACACUUU UUGUGUGUGUGUGUGUGUGUGAAAAA • 5’-Triphosphat notwendig • Ein kurzer Doppelstrang reicht aus • Glattes 5´-Ende • Panhandle-Struktur in Negativ-Strang-RNA-Viren Schlee...and Hartmann, Immunity, 2009
  39. 39. Retinoic acid inducible gene I (RIG-I) Helikase ATPaseKristallisierung DECH CARD “ Repressor domain“ Signalkaskade zu IFN- Erkennung von Triphosphat- dsRNA Antivirale Antwort
  40. 40. Strukturelle und funktionelle Charakterisierung der Bindungstasche RIG-I RD K851 K849 NH3+ NH3+ P N H847 NH+ P K858 -phosphate NH3+ NH3+ P -phosphate K861 NH3+ F853 K888 -phosphate N -phosphate H830 NH+ -phosphate Terminal bp stacking Internucleotide p K907 SH -phosphate NH3+ C829 Wang, Ludwig, Schuberth, Goldeck, Schlee ... Hartmann, Patel 2010, NSMB
  41. 41. Aktive N1-Methylierung verhindert Erkennung von selbst-RNA MTr-1 MTr-2
  42. 42. Aktive N1-Methylierung verhindert Erkennung von selbst-RNA MTr-1 MTr-2
  43. 43. Viren methylieren an N1 um eine Erkennung aktiv zu umgehen • Das m7G-Cap allein hat kaum einen Einfluss auf RIG-I • Einzelne 2‘O-Methylierung an N1 durch eine spezifische Methyltransferase verhindert RIG-I Aktivierung • Viren ahmen 2‘O-Methylierung an N1 nach um RIG-I Erkennung zu umgehen
  44. 44. RIG-I Ligand: effektive Tumortherapie RIG-I ligand
  45. 45. Institute of Clinical Chemistry and Clinical Pharmacology Bonn Cluster of Excellence
  46. 46. 2012 Immune sensing: pattern recognition receptors:
  47. 47. Textbook: Sensing of non-self by pattern recognition receptors initiates a tailored immune response ... T-cell ... but new challenges need to be addressedDendritic cell
  48. 48. New challenge: Immune function of “non-immune“ cellsnaive CD8 T-cell Tolerization mDC LSECs apoptotic cell Space of Dissé Stellate cell
  49. 49. macrophagesadipocytesmicrogliakeratinocyteshepatocytes
  50. 50. Systemic interplay : e.g. antiviral defense neurons hepatocytes macrophages adipocytes keratinocytes
  51. 51. Unsere Sinnesorgane The immune sensory system: our sense for health
  52. 52. Bonn Cluster of ExcellenceNew opportunities in Bonn: Excellence Cluster ImmunoSensation3 Chairs in Immunology4 Permanent Professors3 Junior Research Groups20 Postdocs30 Graduate Students
