SlideShare a Scribd company logo
Sarah Mason
2nd February 2016
Implementing Non-Invasive Prenatal Diagnosis (NIPD) of
monogenic diseases in a National Health Service Laboratory
Fiona McKay
Principal Clinical Scientist, NE Thames Regional Genetics Service
8th June 2017
Invasive vs non-invasive
CVS:
 normally between 11-14 weeks gestation
 Small increased risk of miscarriage
 Small risk of infection
 Repeat sampling if insufficient material obtained
Amniocentesis
 normally 15-20 weeks gestation
 small increased risk of miscarriage
 Small risk of infection
 cffDNA
 no increased risk of miscarriage
 easier sample collection
 earlier diagnoses (from 7 weeks)
AMNIOCENTESIS
CVS
Cell-free fetal DNA (cffDNA)
 Originates from placenta (trophoblast)
 represents whole fetal genome
 Detectable from 4 weeks
 % increases with gestation
 10-20% of total cfDNA
 Cleared from circulation within 30mins of delivery
 Shorter than maternal cfDNA
 maternal cfDNA 166bp
 cffDNA 143bp
Cell free DNA
Cell-free fetal DNA - problems
 Relative abundance of maternal cfDNA
 Emanates from the placenta - risk of mosaicism?
 Limitations for use in multiple pregnancies
 When used in early pregnancy, issues associated with ‘vanishing twin’
Non-invasive prenatal … definitions
• NIPD: DIAGNOSIS - Does NOT require invasive test for confirmation
• Single gene disorders
• Sex determination
• RHD
• NIPT or NIPS: TESTING or SCREENING
• Aneuploidy
Requires invasive testing for confirmation
Background
In the UK there are ~20,000 molecular prenatal tests per annum
85% because of a high risk for Down’s syndrome
Over 3000 prenatal diagnoses are for a risk of a monogenic disorder, 70% after invasive
testing.
2015-2016:
NIPT for aneuploidy included for the first
time 1138 reports (NHS only)
2006-2007:
NIPD for fetal sex determination was
included in our national audit for the
first time: 60 tests (1 lab)
In 2015-16: 447 tests (5 labs)
2013-2014: NIPD for monogenic disease (TD)
included in Top Prenatal Reports Category
ACGS Audit 2013-2014
NIPD in use in the UK from 2003
Current practice
Fetal sex determination - genes on the Y-chromosome
RHD in Rhesus negative mothers at high risk of HDN (not at GOSH)
 Women at risk of carrying a fetus with single gene disorder
 Scan abnormalities
 Known genetic history in family
Paternally inherited dominant disorders
De-novo gene changes (e.g. Achondroplasia)
Paternal mutation exclusion for recessive conditions where parents are
carriers of different mutations
Non-invasive prenatal diagnosis (NIPD):
Detection of cell-free fetal DNA (cffDNA) in maternal plasma to offer a safe
alternative to invasive testing.
Our ISO15189 accredited NHS Regional Genetics Laboratory offers a clinical NIPD
service using targeted NGS panels (Illumina MiSeq) to detect the presence of a
paternal or de novo allele:
 FGFR3-related skeletal dysplasia including achondroplasia and
thanatophoric dysplasia
 FGFR2-related craniosynostosis syndromes e.g. Apert & Crouzon
 10 common cystic fibrosis mutations
30% of all our molecular prenatal diagnosis since 2015 have been non-invasive
7883
NIPD for FGFR3-related skeletal dysplasias
Achondroplasia
 Most common viable skeletal dysplasia
 Most present de novo, in late pregnancy
 98% cases due to single mutation in FGFR3
Thanatophoric dysplasia (TD)
 Most common lethal skeletal dysplasia
 At least 13 mutations in FGFR3
N
ACH
TD
Next generation sequencing (MiSeq Illumina)
 30 FGFR3 mutations
 (+Severe Achondroplasia with Developmental Delay and Acanthosis
Nigricans (SADDAN), hypochondroplasia, craniosynostosis)
 6 amplicon panel
 Sequence 1000’s of reads
 Can determine number of reads of wild type allele and number of reads of
mutant allele
NIPD for FGFR3-related skeletal dysplasias
 Validation
 40 achondroplasia – 39/40 correct (rare mutation not on panel)
 38 TD - all correct
 Several different mutations detected
Next generation sequencing - MiSeq
NIPD FGFR3 gene panel approved by UKGTN in 2013
cfDNA cfDNA mat gDNA
Type2wt 244325 248812 135147
c.1948A>C 139 215 115
c.1948A>G 16768 16937 25
c.1949A>T 204 23 109
c.1949A>C 284 160 168
c.1950G>C 27 33 7
c.1950G>T 107 39 38
Benefits of NIPD for FGFR3-related skeletal dysplasias
Achondroplasia
 Confirmation of sonographic diagnosis without risk of preterm labour
 Safe exclusion of Down’s syndrome and other more severe dysplasias
 Allows for accurate parental counselling and preparation for delivery
Thanatophoric dysplasia
 May be detected early. NIPD allows risk free early definitive diagnosis
 Excludes differential diagnoses which may carry high recurrence risk
 Allows for a surgical termination if requested
 Provides accurate diagnosis in twins without putting the normal twin at risk
For both, NIPD allows safe exclusion of a recurrence early in future pregnancies
Apert syndrome
 Autosomal Dominant, 2 common mutations in the FGFR2 gene
 NIPD aids sonographic diagnosis from 12 weeks
 Allows for exclusion of recurrence in subsequent pregnancies from 9 weeks
 Definitive, safe diagnosis in twins
 12 diagnostic NIPD NGS tests performed
MiSeq NGS results showing large number of wildtype counts in
maternal plasma and genomic DNA, but only mutant counts in the
two plasma samples analysed
NIPD for Apert syndrome approved by UKGTN in 2014
NIPD for Cystic Fibrosis – paternal exclusion
 Autosomal recessive - paternal mutation exclusion
 5 CFTR amplicons for MiSeq (Illumina)
 Only applicable to couples
 1) who are known carriers of different CF mutations AND
 2) the paternal mutation is one of the 10 mutations listed below
 10 mutations including neonatal screening common mutations (bold)
 c.1521_1523delCTT p.(Phe508del)
 c.489+1G>T
 c.1624G>T p.(Gly542*)
 c.1652G>A p.(Gly551Asp)
 c.3846G>A p.(Trp1282*)
 c.1657C>T p.(Arg553*)
 c.1519_1521delATC p.(Ile507del)
 c.1679G>C p.(Arg560Thr)
 c.1646G>A p.(Ser549Asn)
 c.1647T>G p.(Ser549Arg)
 13 diagnostic NIPD NGS tests performed
NIPD for Cystic Fibrosis approved by UKGTN in 2014
FALSE NEGATIVE NIPD CASE
• CF NIPD referral for pat mutation exclusion
• Paternal mutation c.3909C>G – detected in
paternal gDNA using assay
• Not detected in cfDNA in 2 separate
samplings, presence of cfDNA confirmed
• Baby affected with CF
• Mutation withdrawn from panel
Aim: To increase availability of NIPD
Bespoke NIPD:
Target Population
Couples with a pregnancy at risk of a genetic condition where a de novo or
paternal mutation is known.
Relative Haplotype Dosage Analysis:
Target Population
Couples with a pregnancy at high risk of inheriting a
recessive genetic condition irrespective of genotype.
Aim: To increase availability of NIPD
Inclusion criteria:
1-3 base pair mutation
Control gDNA
De Novo / Paternal Dominant
For recessive conditions, parents must
carry different mutations
Target Population
Couples with a pregnancy at risk of a genetic condition where the mutation is
known and invasive prenatal diagnosis would otherwise be the only option
Exclusion criteria:
Pseudogene
Polymorphisms
Bespoke NIPD
Assay development for each couple:
Ideally, pre-pregnancy
gDNA from affected proband or carrier parent
Primer design, SNP check & order
NGS confirmation of mutation detection
Report within 8 weeks to offer NIPD
cffDNA testing in pregnancy:
Minimum 9 weeks gestation
May require 2 samples one week apart at early gestation
FRAS1 exon 66
hg19_dna range=chr4:79437011-79437070
ctccctccctggcagAGGCAGGGTTCCTGGATGATGTGGTCTATGATAGCACTGCCCTGGGGCCTGGCTACGATCGCCC
CTTCCAGTTTGACCCCAGCGTGCGAGAGCCGAAGACCATCCAGCTCTACAAACACCTGAACCTGAAGAGCTGCGTGTGG
ACCTTTGATGCTTATTATGACATGACTGAGCTGATTGACGTCTGTGGGGGCTCTGTAACCGCTGACTTCCAGgtaggtg
ccccggggcttgtctgaggactctgc
Bespoke Amplicon Based Design
C primer
Re familial mutation
G exon
Sample index - 6bp
Illumina sequence adaptor (MiSeq)
60bp
Bioinformatic Analysis
Automated scripting to count wild type and
mutant sequences
Monitoring sample indexes
for potential contamination
Poor quality data is filtered outID6 ID7 ID8
cffDNA (1) cffDNA (2) Mat gDNA
FRAS1 wt 319077 141751 440538
FRAS1 c.10261C>T 34498 12055 292
ZFX 36743 44017 350940
ZXY 6 0 2
Bioinformatic Analysis
Confirmation of Fetal DNA
ZFX/Y and HLA assays are run in parallel to confirm presence of cffDNA in the
same plasma extract undergoing mutation test:
• Calculate fetal fraction
• Important in mutation negative cases
• Uninformative (HLA/ZFY) mutation negative cases: can’t confirm fetal DNA present
ID01 ID08 ID02
cfDNA cfDNA gDNA
HLABexon3-VAR01 0 1 2
HLABexon3-VAR02 3509 2734 2805
HLABexon3-VAR03 1 9 0
HLABexon3-VAR04 9 26 11
HLABexon3-VAR05 4108 3582 2876
HLABexon3-VAR06 3 0 0
HLABexon3-VAR07 336 656 0
HLABexon3-VAR08 0 0 0
ZFX 27046 48258 55986
ZFY 764 1456 6
Apert wt 97397 163414 97801
Apert c.755C>G 15 15 13
Apert c.758C>G 16 26 8
Apert
c.755_756delCGinsTT 0 2 0
FETAL
FRACTION ID01
VARIANT Counts
Maternal allele 1: VAR#2 3509
Maternal allele 2: VAR#5 4108
TOTAL maternal
counts: 7617
VARIANT Counts
Fetal HLA variant: VAR#7 336
Fetal Fraction: 8.45
Bespoke NIPD tests
Confirmed inheritance of paternal FGFR2 mutation (Crouzon syndrome)
Pre-pregnancy work-up
Bespoke NIPD test in subsequent pregnancy – fetus predicted to be AFFECTED
Bespoke NIPD tests
Exclusion of recurrence of de novo SMARCB1 mutation
Pre-pregnancy work-up
Bespoke NIPD test in subsequent pregnancy – fetus predicted to be UNAFFECTED
Audit of bespoke service - delivery
Phenotype Gene Mutation
Tuberous sclerosis TSC2 c.133_134delCT
c.2713C>T
c.4351dupC
c.4645T>A
Neurofibromatosis
type 1
NF1 c.4823T>C
c.4330A>G
c.5170C>T
Rhabdoid Tumour
Predisposition Syndrome
SMARCB1 c.157C>T
c.118C>T
Epileptic encephalopathy,
early infantile
SCN8A
KCNQ2
c.669G>T
c.431G>A
Skeletal Dysplasia
(AR)
FGFR3
TCF12
SLC26A2
c.779C>G
c.1916del
c.296T>C
Fraser syndrome (AR) FRAS1 c.10261C>T
c.10261C>T
c.10261C>T
Late infantile neuronal
ceroid lipofuscinosis
TPP1 c.509-1G>C
Noonan syndrome PTPN11 c.178G>A
Porencephaly COL4A1 c.324+1G>A
Marfan syndrome FBN1 c.8268G>A
Polycystic kidney disease
(AR)
PKHD1 c.1486C>T
Phenotype Gene Mutation
Intellectual disability ARID1B
KDM5B
BCAP31
CASK
c.6129del
c.3343C>T
c.2359T>C
c.678+1G>A
c.37G>T
Congenital Nephrotic
Syndrome
WT1 c.1301G>A
Cornelia De Lange syndrome NIPBL c.4160dupA
Osteogenesis imperfecta COL1A1
COL1A2
c.543+4A>T
c.543+4A>T
c.1875+1G>A
c.1801G>A
c.1801G>A
c.1801G>A
c.1801G>A
Renal tubular dysgenesis
(AR)
ACE c.96del
Epidermolytic Palmoplantar
Keratoderma
KRT9 c.482A>G
c.482A>G
Hereditary spastic paraplegia SPAST c.1361A>G
Familial dilated
cardiomyopathy
ACTC1 c.664G>A
Alexander disease GFAP c.235C>A
42 bespoke tests offered:
9/42 mutation positive
Audit of bespoke service - requests
Designs Requested Gene Mutation
Zellweger PEX6 c.1314_1321del
Intellectual disability KATA6A c.4213G>T
Smith-Lemli-Optiz (AR) DHCR7 c.964-1G>C
TPM1-related cardiomyopathy TPM1 c.742A>G
Neurofibromatosis type 2 NF2 c.523_524del
Alpers syndrome POLG c.2542G>A
Laron syndrome GHR c.922G>A
Spondyloepiphyseal dysplasia
congenita
COL2A1 c.2104G>A
Osteogenesis imperfecta COL1A2 c.965G>A
Osteogenesis imperfecta COL1A1 c.544-1G>A / c.941G>A
Ornithine Transcarbamylase
Deficiency
OTC c.521C>T
Congenital glaucoma FOXC1 c.392C>A
Neurofibromatosis type 1 NF1 c.6007-2A>G
NIPD not possible
NIPD for recurrence
NIPD to exclude recurrence of an apparently de novo mutation
 All pregnancies tested on this basis detected no mutation
 Is there any point in testing low risk pregnancies?
Benefits
 Safe non-invasive test for low risk pregnancies
 Welcomed by patients, many of whom prefer to accept the low risk of
recurrence rather than undergo invasive testing
 In some mosaic cases, NGS analysis has indicated recurrence risk may be
higher
 For recessive conditions, exclusion of the paternal allele reduces the rate of
invasive testing as only pregnancies where the paternal allele is inherited
require invasive test
Number of Invasive and Non-Invasive Prenatal Diagnosis tests carried out per year
Prenatal service delivery – where are we now?
Single gene tests: TOTAL: 383 Fails: 6 (1.5%) Inconclusive: 4 (1.0%)
0
10
20
30
40
50
60
70
80
90
2008-9 2009-10 2010-11 2011-12 2012-13 2013-14 2014-15 2015-16 2016-17
SD Invasive
SD NIPD
0
10
20
30
40
50
60
70
80
90
2008-9 2009-10 2010-11 2011-12 2012-13 2013-14 2014-15 2015-16 2016-17
SD Invasive
SD NIPD
Bespoke
0
10
20
30
40
50
60
70
80
90
2008-9 2009-10 2010-11 2011-12 2012-13 2013-14 2014-15 2015-16 2016-17
SD Invasive
SD NIPD
Bespoke
CF Exclusion
CF RHDO
How is bespoke NIPD being offered?
Not all NHS trusts are funding the same level of NIPD
 cost for bespoke work-up (as assay likely only to be used by that family)
 additional cost for NIPD
Three funding scenarios:
 Trust pays for work-up and NIPD
 Parents pay for work-up & trust pays for NIPD
(Some trusts won’t pay for recurrence testing)
 Parents pay for work-up & NIPD
MOST COMMON
Challenge
fetal DNA present amongst high background of maternal DNA
detect slight increase in mutant reads
NIPD for autosomal recessive conditions
cffDNA fraction directly affects
expected extent of allelic imbalance
Concentration of cffDNA varies with
gestation & between pregnancies
Relative mutation dosage-RMD
Measuring fetal fraction:
Y-chr markers
size differential
heterozygous SNPs
NIPD by relative haplotype dosage analysis
Maternal
Paternal Proband
Haplotype analysis
Lo et al 2010 Sci Trans Med; New et al 2014 J Clin End
Metab
Link SNPs flanking CYP21A2 to mutant allele
(Hap 1 = mutant allele)
Agilent Sureselect Custom Enrichment Assay
~6500 SNPs (7Mb flanking CYP21A2)
Principles of linkage analysis
SNPs flanking CYP21A2 are genotyped in
maternal and paternal DNA
Next generation sequencing of
SNPs in cell-free DNA
Assess all informative SNPs
along chromosome to
determine inheritance of
paternal haplotype
SNP informative if;
Homozygous in Mother
Heterozygous in Father
Hap 1 / Hap 2
Maternal
Paternal
Parental
genotypes
Paternal Hap 1
transmitted if ‘C’
allele NOT
detected
Or
A A A C
Fetal genotypes
A A A C
Maternal
plasma
Paternal Hap 2
transmitted if ‘C’
allele IS detected
Paternal haplotype transmission
Linkage analysis
Advantages
• Useful when there is a pseudogene/high homology with another gene
• Useful for diagnostic service as can have single NIPD assay for all families with
mutations in the same gene, regardless of mutation
Challenges
• Sufficient DNA for library preparation
• robust assay with variable cfDNA
• PCR – duplicates
• Labour intensive, time consuming assay
Adapted from Lo et al 2010, Sci. Transl. Med. 2, 61ra91
Relative Haplotype Dosage Analysis (RHDO)
 Involves analysis of multiple SNPs which flank the disease gene / locus of interest
 If the phase of the mutation carried by both parents is known then RHDO can assess
whether the maternal mutant or wild-type allele has been transmitted to the fetus
 Provides definite diagnosis for recessive conditions
NIPD for Cystic Fibrosis by RHDO – in service from 3rd
October 2016
NIPD for Spinal Muscular Atrophy (SMA) and Congenital
Adrenal Hyperplasia (CAH) by RHDO – under development
170394 2017-05-13
Fetal fraction
Fetal fraction Qualified SNPs Disqualified SNPs
Type 1 SNPs 0.11 20 0
Type 3AD SNPs 0.103 18 0
Type 3BC SNPs 0.0815 2 51
Maternal haplotype
Homozygous.for.HapI Heterozygous Homozygous.for.HapII Conclusion
Type_4a 0 3 0 Discordant to Proband
Type_4a_rev 0 3 0 Discordant to Proband
Type_4b 0 0 6 Discordant to Proband
Type_4b_rev 0 0 6 Discordant to Proband
Paternal haplotype
Qualified.SNPs Disqualified.SNPs Conclusion
Type 3AD SNPs 18 0Discordant to Proband
Type 3BC SNPs 2 51NA
Proband Affected
Maternal haplotype Discordant to Proband
Paternal haplotype Discordant to Proband
cffDNA result Predict UNAFFECTED
Relative Haplotype Dosage Analysis (RHDO)
RHDO – Cystic Fibrosis Service
Case Gestation Fetal Fraction Outcome
1 10+3 8% Paternal high risk
Maternal high risk
2 11 4.8% Paternal high risk
Maternal low risk
3 9+1 15.4% Paternal low risk
Maternal low risk
4 12+2 14.6% Paternal low risk
Maternal high risk
5 9+4 11% Paternal high risk
Maternal high risk
6 9+0 6.4% Paternal high risk
Maternal low risk
7 9+0 11.6% Paternal low risk
Maternal low risk
Case study G129789
• Maternal mutation c.1521_1523delCTT p.(Phe508del)
• Paternal mutation c.489+1G>T
• Affected son
• 2015 – NIPD paternal mutation exclusion
• no mutation detected, invasive not required
• 2017 – NIPD RHDO
• paternal high risk, maternal low risk alleles detected
• Invasive not required (would have been required if only paternal mutation
exclusion had been available)
2015 2017
Conclusions
Technical challenges
• Delivering an accredited NIPD service for paternal exclusion is relatively
straightforward.
• Expanding the service to make NIPD available for rare conditions time consuming
and costly.
• High NGS sensitivity reveals mosaicism. Essential to test maternal samples in
parallel by NGS. Particular importance for panel based NGS to detect common
mutations.
Patient Perspective
• Uptake is high; patients have welcomed the availability of our bespoke NIPD
service
• Funding / Commissioning in our NHS service is an issue for this costly test. Equity
of access.
• High rate of testing for information only.
Acknowledgments
NETRGL
Lyn Chitty
Lucy Jenkins
Sarah Mason
Sandra Moore
Natalie Chandler
Helena Ahlfors
Funding
NETRGL
RAPID NIHR PGfAR
GOSH CC Charity
GOSH BRC
This work described here was partially funded by the National Institute for Health Research (NIHR) under its Programme
Grants for Applied Research Programme (RP-PG-0707-10107 – “RAPID”) and the GOSH BRC. The views expressed are
those of the author and not necessarily those of the NHS, the NIHR or the Department of Health.
Research Team
Samantha Edwards
Melissa Hill
Suzanne Drury
Jane Hayward

More Related Content

What's hot

Invicta robertsonian poster eshre 2014
Invicta robertsonian poster eshre 2014Invicta robertsonian poster eshre 2014
Invicta robertsonian poster eshre 2014
INVICTA GENETICS
 
Preimplantation genetic screening & diagnosis brochures
Preimplantation genetic screening & diagnosis brochuresPreimplantation genetic screening & diagnosis brochures
Preimplantation genetic screening & diagnosis brochures
medgenome claria
 
Preimplantation genetic diagnosis (pgd) PGD
Preimplantation genetic diagnosis (pgd) PGDPreimplantation genetic diagnosis (pgd) PGD
Preimplantation genetic diagnosis (pgd) PGD
dr. gokul reshmi mariappan
 
iMGE Test™
iMGE Test™iMGE Test™
iMGE Test™
INVICTA GENETICS
 
Pre implantation genetic diagnosis (pgd)
Pre implantation genetic diagnosis (pgd)Pre implantation genetic diagnosis (pgd)
Pre implantation genetic diagnosis (pgd)BALASUBRAMANIAM IYER
 
Invicta eshre-poster-frequency of aneuploidy
Invicta eshre-poster-frequency of aneuploidyInvicta eshre-poster-frequency of aneuploidy
Invicta eshre-poster-frequency of aneuploidy
INVICTA GENETICS
 
Art%3 a10.1007%2fs10815 014-0355-4 (1)
Art%3 a10.1007%2fs10815 014-0355-4 (1)Art%3 a10.1007%2fs10815 014-0355-4 (1)
Art%3 a10.1007%2fs10815 014-0355-4 (1)鋒博 蔡
 
PGS-NGS 360°™
PGS-NGS 360°™PGS-NGS 360°™
PGS-NGS 360°™
INVICTA GENETICS
 
PGD-ONE™
PGD-ONE™PGD-ONE™
PGD-ONE™
INVICTA GENETICS
 
NIPT Market & Tech Analysis Report 2015 - Li MA
NIPT Market & Tech Analysis Report 2015 - Li MANIPT Market & Tech Analysis Report 2015 - Li MA
NIPT Market & Tech Analysis Report 2015 - Li MA
Li (Philip) Ma
 
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
Metwalley Metwalley
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)鋒博 蔡
 
Preimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-ViafetPreimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-Viafet
Metwalley Metwalley
 
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disordersPreimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
Maryam Rafati
 
Genetics preimplantation
Genetics preimplantationGenetics preimplantation
Genetics preimplantationt7260678
 

What's hot (16)

Invicta robertsonian poster eshre 2014
Invicta robertsonian poster eshre 2014Invicta robertsonian poster eshre 2014
Invicta robertsonian poster eshre 2014
 
Preimplantation genetic screening & diagnosis brochures
Preimplantation genetic screening & diagnosis brochuresPreimplantation genetic screening & diagnosis brochures
Preimplantation genetic screening & diagnosis brochures
 
Knl wells
Knl wellsKnl wells
Knl wells
 
Preimplantation genetic diagnosis (pgd) PGD
Preimplantation genetic diagnosis (pgd) PGDPreimplantation genetic diagnosis (pgd) PGD
Preimplantation genetic diagnosis (pgd) PGD
 
iMGE Test™
iMGE Test™iMGE Test™
iMGE Test™
 
Pre implantation genetic diagnosis (pgd)
Pre implantation genetic diagnosis (pgd)Pre implantation genetic diagnosis (pgd)
Pre implantation genetic diagnosis (pgd)
 
Invicta eshre-poster-frequency of aneuploidy
Invicta eshre-poster-frequency of aneuploidyInvicta eshre-poster-frequency of aneuploidy
Invicta eshre-poster-frequency of aneuploidy
 
Art%3 a10.1007%2fs10815 014-0355-4 (1)
Art%3 a10.1007%2fs10815 014-0355-4 (1)Art%3 a10.1007%2fs10815 014-0355-4 (1)
Art%3 a10.1007%2fs10815 014-0355-4 (1)
 
PGS-NGS 360°™
PGS-NGS 360°™PGS-NGS 360°™
PGS-NGS 360°™
 
PGD-ONE™
PGD-ONE™PGD-ONE™
PGD-ONE™
 
NIPT Market & Tech Analysis Report 2015 - Li MA
NIPT Market & Tech Analysis Report 2015 - Li MANIPT Market & Tech Analysis Report 2015 - Li MA
NIPT Market & Tech Analysis Report 2015 - Li MA
 
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)
 
Preimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-ViafetPreimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-Viafet
 
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disordersPreimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
 
Genetics preimplantation
Genetics preimplantationGenetics preimplantation
Genetics preimplantation
 

Similar to Fiona McKay-Diagnóstico prenatal no invasivo y diagnóstico genético reproductivo

NIPT inservice talk May 2015
NIPT inservice talk May 2015NIPT inservice talk May 2015
NIPT inservice talk May 2015Kathryn Murray
 
Cell free fetal dna testing for prenatal diagnosis
Cell free fetal dna testing for prenatal diagnosisCell free fetal dna testing for prenatal diagnosis
Cell free fetal dna testing for prenatal diagnosis
Skander Ben Abdelkrim
 
PGD-ONE FM™
PGD-ONE FM™PGD-ONE FM™
PGD-ONE FM™
INVICTA GENETICS
 
International Journal of Reproductive Medicine & Gynecology
International Journal of Reproductive Medicine & GynecologyInternational Journal of Reproductive Medicine & Gynecology
International Journal of Reproductive Medicine & Gynecology
SciRes Literature LLC. | Open Access Journals
 
20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...
20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...
20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...
Roberto Scarafia
 
2018: How Genomics can improve reproduction
2018: How Genomics can improve reproduction2018: How Genomics can improve reproduction
2018: How Genomics can improve reproduction
Hesham Al-Inany
 
20160219 - F. Grati - Toma - Maternal Malignancies
20160219 - F. Grati - Toma - Maternal Malignancies20160219 - F. Grati - Toma - Maternal Malignancies
20160219 - F. Grati - Toma - Maternal Malignancies
Roberto Scarafia
 
Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion
Maryam Rafati
 
Cf dna for fetal aneuploidy risk assessment toma sept 2015 usb
Cf dna for fetal aneuploidy risk assessment toma sept 2015 usbCf dna for fetal aneuploidy risk assessment toma sept 2015 usb
Cf dna for fetal aneuploidy risk assessment toma sept 2015 usb
ToMa Advanced Biomedical Assays Spa
 
Cell-free DNA test oltre le comuni aneuploidie
Cell-free DNA test oltre le comuni aneuploidieCell-free DNA test oltre le comuni aneuploidie
Cell-free DNA test oltre le comuni aneuploidie
Roberto Scarafia
 
Art%3 a10.1007%2fs10815 014-0355-4
Art%3 a10.1007%2fs10815 014-0355-4Art%3 a10.1007%2fs10815 014-0355-4
Art%3 a10.1007%2fs10815 014-0355-4鋒博 蔡
 
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandunganPrenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Hendrik Sutopo
 
Prenatal diagnosis test
Prenatal diagnosis testPrenatal diagnosis test
Prenatal diagnosis test
qussai abbas
 
20160218 hisham toma services
20160218 hisham toma services20160218 hisham toma services
20160218 hisham toma services
ToMa Advanced Biomedical Assays Spa
 
PGD TRS™. Pre-implantation diagnosis for translocations.
PGD TRS™. Pre-implantation diagnosis for translocations.PGD TRS™. Pre-implantation diagnosis for translocations.
PGD TRS™. Pre-implantation diagnosis for translocations.
INVICTA GENETICS
 
Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...
Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...
Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...
Fundación Ramón Areces
 
Twin zygosity nipt
Twin zygosity niptTwin zygosity nipt
Twin zygosity nipt鋒博 蔡
 

Similar to Fiona McKay-Diagnóstico prenatal no invasivo y diagnóstico genético reproductivo (20)

NIPT inservice talk May 2015
NIPT inservice talk May 2015NIPT inservice talk May 2015
NIPT inservice talk May 2015
 
Cell free fetal dna testing for prenatal diagnosis
Cell free fetal dna testing for prenatal diagnosisCell free fetal dna testing for prenatal diagnosis
Cell free fetal dna testing for prenatal diagnosis
 
PGD-ONE FM™
PGD-ONE FM™PGD-ONE FM™
PGD-ONE FM™
 
International Journal of Reproductive Medicine & Gynecology
International Journal of Reproductive Medicine & GynecologyInternational Journal of Reproductive Medicine & Gynecology
International Journal of Reproductive Medicine & Gynecology
 
20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...
20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...
20160918 - F. Prefumo - Ecografia, screening biochimico, NIPT e diagnosi pren...
 
2018: How Genomics can improve reproduction
2018: How Genomics can improve reproduction2018: How Genomics can improve reproduction
2018: How Genomics can improve reproduction
 
20160219 - F. Grati - Toma - Maternal Malignancies
20160219 - F. Grati - Toma - Maternal Malignancies20160219 - F. Grati - Toma - Maternal Malignancies
20160219 - F. Grati - Toma - Maternal Malignancies
 
Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion
 
Cf dna for fetal aneuploidy risk assessment toma sept 2015 usb
Cf dna for fetal aneuploidy risk assessment toma sept 2015 usbCf dna for fetal aneuploidy risk assessment toma sept 2015 usb
Cf dna for fetal aneuploidy risk assessment toma sept 2015 usb
 
Cell-free DNA test oltre le comuni aneuploidie
Cell-free DNA test oltre le comuni aneuploidieCell-free DNA test oltre le comuni aneuploidie
Cell-free DNA test oltre le comuni aneuploidie
 
Art%3 a10.1007%2fs10815 014-0355-4
Art%3 a10.1007%2fs10815 014-0355-4Art%3 a10.1007%2fs10815 014-0355-4
Art%3 a10.1007%2fs10815 014-0355-4
 
UOG Journal Club: Maternal blood cell-free DNA testing in early screening for...
UOG Journal Club: Maternal blood cell-free DNA testing in early screening for...UOG Journal Club: Maternal blood cell-free DNA testing in early screening for...
UOG Journal Club: Maternal blood cell-free DNA testing in early screening for...
 
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandunganPrenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
 
Prenatal diagnosis test
Prenatal diagnosis testPrenatal diagnosis test
Prenatal diagnosis test
 
Qpcr
QpcrQpcr
Qpcr
 
Qpcr
QpcrQpcr
Qpcr
 
20160218 hisham toma services
20160218 hisham toma services20160218 hisham toma services
20160218 hisham toma services
 
PGD TRS™. Pre-implantation diagnosis for translocations.
PGD TRS™. Pre-implantation diagnosis for translocations.PGD TRS™. Pre-implantation diagnosis for translocations.
PGD TRS™. Pre-implantation diagnosis for translocations.
 
Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...
Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...
Stephanie Allen-Diagnóstico prenatal no invasivo y diagnóstico genético repro...
 
Twin zygosity nipt
Twin zygosity niptTwin zygosity nipt
Twin zygosity nipt
 

More from Fundación Ramón Areces

Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Fundación Ramón Areces
 
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...
Fundación Ramón Areces
 
Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London. Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London.
Fundación Ramón Areces
 
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Fundación Ramón Areces
 
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Fundación Ramón Areces
 
Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI). Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Fundación Ramón Areces
 
Martín Uribe - Universidad de Columbia.
Martín Uribe - Universidad de Columbia.Martín Uribe - Universidad de Columbia.
Martín Uribe - Universidad de Columbia.
Fundación Ramón Areces
 
Thomas S. Robertson - The Wharton School.
Thomas S. Robertson - The Wharton School. Thomas S. Robertson - The Wharton School.
Thomas S. Robertson - The Wharton School.
Fundación Ramón Areces
 
Diana Robertson - The Wharton School.
Diana Robertson - The Wharton School. Diana Robertson - The Wharton School.
Diana Robertson - The Wharton School.
Fundación Ramón Areces
 
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...
Fundación Ramón Areces
 
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...
Fundación Ramón Areces
 
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Fundación Ramón Areces
 
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research. Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Fundación Ramón Areces
 
Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster. Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster.
Fundación Ramón Areces
 
Mercedes Ayuso - Universitat de Barcelona.
Mercedes Ayuso -  Universitat de Barcelona. Mercedes Ayuso -  Universitat de Barcelona.
Mercedes Ayuso - Universitat de Barcelona.
Fundación Ramón Areces
 
Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics. Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Fundación Ramón Areces
 
Julia Campa - The Open University.
Julia Campa - The Open University. Julia Campa - The Open University.
Julia Campa - The Open University.
Fundación Ramón Areces
 
Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico. Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico.
Fundación Ramón Areces
 
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Fundación Ramón Areces
 
Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven. Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven.
Fundación Ramón Areces
 

More from Fundación Ramón Areces (20)

Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
 
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...
 
Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London. Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London.
 
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
 
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
 
Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI). Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
 
Martín Uribe - Universidad de Columbia.
Martín Uribe - Universidad de Columbia.Martín Uribe - Universidad de Columbia.
Martín Uribe - Universidad de Columbia.
 
Thomas S. Robertson - The Wharton School.
Thomas S. Robertson - The Wharton School. Thomas S. Robertson - The Wharton School.
Thomas S. Robertson - The Wharton School.
 
Diana Robertson - The Wharton School.
Diana Robertson - The Wharton School. Diana Robertson - The Wharton School.
Diana Robertson - The Wharton School.
 
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...
 
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...
 
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
 
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research. Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
 
Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster. Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster.
 
Mercedes Ayuso - Universitat de Barcelona.
Mercedes Ayuso -  Universitat de Barcelona. Mercedes Ayuso -  Universitat de Barcelona.
Mercedes Ayuso - Universitat de Barcelona.
 
Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics. Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics.
 
Julia Campa - The Open University.
Julia Campa - The Open University. Julia Campa - The Open University.
Julia Campa - The Open University.
 
Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico. Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico.
 
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
 
Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven. Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven.
 

Recently uploaded

Prix Galien International 2024 Forum Program
Prix Galien International 2024 Forum ProgramPrix Galien International 2024 Forum Program
Prix Galien International 2024 Forum Program
Levi Shapiro
 
Charaka Samhita Sutra sthana Chapter 15 Upakalpaniyaadhyaya
Charaka Samhita Sutra sthana Chapter 15 UpakalpaniyaadhyayaCharaka Samhita Sutra sthana Chapter 15 Upakalpaniyaadhyaya
Charaka Samhita Sutra sthana Chapter 15 Upakalpaniyaadhyaya
Dr KHALID B.M
 
How to Give Better Lectures: Some Tips for Doctors
How to Give Better Lectures: Some Tips for DoctorsHow to Give Better Lectures: Some Tips for Doctors
How to Give Better Lectures: Some Tips for Doctors
LanceCatedral
 
24 Upakrama.pptx class ppt useful in all
24 Upakrama.pptx class ppt useful in all24 Upakrama.pptx class ppt useful in all
24 Upakrama.pptx class ppt useful in all
DrSathishMS1
 
KDIGO 2024 guidelines for diabetologists
KDIGO 2024 guidelines for diabetologistsKDIGO 2024 guidelines for diabetologists
KDIGO 2024 guidelines for diabetologists
د.محمود نجيب
 
New Drug Discovery and Development .....
New Drug Discovery and Development .....New Drug Discovery and Development .....
New Drug Discovery and Development .....
NEHA GUPTA
 
NVBDCP.pptx Nation vector borne disease control program
NVBDCP.pptx Nation vector borne disease control programNVBDCP.pptx Nation vector borne disease control program
NVBDCP.pptx Nation vector borne disease control program
Sapna Thakur
 
263778731218 Abortion Clinic /Pills In Harare ,
263778731218 Abortion Clinic /Pills In Harare ,263778731218 Abortion Clinic /Pills In Harare ,
263778731218 Abortion Clinic /Pills In Harare ,
sisternakatoto
 
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...
VarunMahajani
 
Superficial & Deep Fascia of the NECK.pptx
Superficial & Deep Fascia of the NECK.pptxSuperficial & Deep Fascia of the NECK.pptx
Superficial & Deep Fascia of the NECK.pptx
Dr. Rabia Inam Gandapore
 
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...
GL Anaacs
 
Physiology of Special Chemical Sensation of Taste
Physiology of Special Chemical Sensation of TastePhysiology of Special Chemical Sensation of Taste
Physiology of Special Chemical Sensation of Taste
MedicoseAcademics
 
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdf
ARTIFICIAL INTELLIGENCE IN  HEALTHCARE.pdfARTIFICIAL INTELLIGENCE IN  HEALTHCARE.pdf
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdf
Anujkumaranit
 
POST OPERATIVE OLIGURIA and its management
POST OPERATIVE OLIGURIA and its managementPOST OPERATIVE OLIGURIA and its management
POST OPERATIVE OLIGURIA and its management
touseefaziz1
 
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journey
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness JourneyTom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journey
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journey
greendigital
 
For Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #Girls
For Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #GirlsFor Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #Girls
For Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #Girls
Savita Shen $i11
 
Evaluation of antidepressant activity of clitoris ternatea in animals
Evaluation of antidepressant activity of clitoris ternatea in animalsEvaluation of antidepressant activity of clitoris ternatea in animals
Evaluation of antidepressant activity of clitoris ternatea in animals
Shweta
 
Triangles of Neck and Clinical Correlation by Dr. RIG.pptx
Triangles of Neck and Clinical Correlation by Dr. RIG.pptxTriangles of Neck and Clinical Correlation by Dr. RIG.pptx
Triangles of Neck and Clinical Correlation by Dr. RIG.pptx
Dr. Rabia Inam Gandapore
 
Non-respiratory Functions of the Lungs.pdf
Non-respiratory Functions of the Lungs.pdfNon-respiratory Functions of the Lungs.pdf
Non-respiratory Functions of the Lungs.pdf
MedicoseAcademics
 
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...
i3 Health
 

Recently uploaded (20)

Prix Galien International 2024 Forum Program
Prix Galien International 2024 Forum ProgramPrix Galien International 2024 Forum Program
Prix Galien International 2024 Forum Program
 
Charaka Samhita Sutra sthana Chapter 15 Upakalpaniyaadhyaya
Charaka Samhita Sutra sthana Chapter 15 UpakalpaniyaadhyayaCharaka Samhita Sutra sthana Chapter 15 Upakalpaniyaadhyaya
Charaka Samhita Sutra sthana Chapter 15 Upakalpaniyaadhyaya
 
How to Give Better Lectures: Some Tips for Doctors
How to Give Better Lectures: Some Tips for DoctorsHow to Give Better Lectures: Some Tips for Doctors
How to Give Better Lectures: Some Tips for Doctors
 
24 Upakrama.pptx class ppt useful in all
24 Upakrama.pptx class ppt useful in all24 Upakrama.pptx class ppt useful in all
24 Upakrama.pptx class ppt useful in all
 
KDIGO 2024 guidelines for diabetologists
KDIGO 2024 guidelines for diabetologistsKDIGO 2024 guidelines for diabetologists
KDIGO 2024 guidelines for diabetologists
 
New Drug Discovery and Development .....
New Drug Discovery and Development .....New Drug Discovery and Development .....
New Drug Discovery and Development .....
 
NVBDCP.pptx Nation vector borne disease control program
NVBDCP.pptx Nation vector borne disease control programNVBDCP.pptx Nation vector borne disease control program
NVBDCP.pptx Nation vector borne disease control program
 
263778731218 Abortion Clinic /Pills In Harare ,
263778731218 Abortion Clinic /Pills In Harare ,263778731218 Abortion Clinic /Pills In Harare ,
263778731218 Abortion Clinic /Pills In Harare ,
 
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...
 
Superficial & Deep Fascia of the NECK.pptx
Superficial & Deep Fascia of the NECK.pptxSuperficial & Deep Fascia of the NECK.pptx
Superficial & Deep Fascia of the NECK.pptx
 
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...
 
Physiology of Special Chemical Sensation of Taste
Physiology of Special Chemical Sensation of TastePhysiology of Special Chemical Sensation of Taste
Physiology of Special Chemical Sensation of Taste
 
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdf
ARTIFICIAL INTELLIGENCE IN  HEALTHCARE.pdfARTIFICIAL INTELLIGENCE IN  HEALTHCARE.pdf
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdf
 
POST OPERATIVE OLIGURIA and its management
POST OPERATIVE OLIGURIA and its managementPOST OPERATIVE OLIGURIA and its management
POST OPERATIVE OLIGURIA and its management
 
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journey
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness JourneyTom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journey
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journey
 
For Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #Girls
For Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #GirlsFor Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #Girls
For Better Surat #ℂall #Girl Service ❤85270-49040❤ Surat #ℂall #Girls
 
Evaluation of antidepressant activity of clitoris ternatea in animals
Evaluation of antidepressant activity of clitoris ternatea in animalsEvaluation of antidepressant activity of clitoris ternatea in animals
Evaluation of antidepressant activity of clitoris ternatea in animals
 
Triangles of Neck and Clinical Correlation by Dr. RIG.pptx
Triangles of Neck and Clinical Correlation by Dr. RIG.pptxTriangles of Neck and Clinical Correlation by Dr. RIG.pptx
Triangles of Neck and Clinical Correlation by Dr. RIG.pptx
 
Non-respiratory Functions of the Lungs.pdf
Non-respiratory Functions of the Lungs.pdfNon-respiratory Functions of the Lungs.pdf
Non-respiratory Functions of the Lungs.pdf
 
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...
 

Fiona McKay-Diagnóstico prenatal no invasivo y diagnóstico genético reproductivo

  • 1. Sarah Mason 2nd February 2016 Implementing Non-Invasive Prenatal Diagnosis (NIPD) of monogenic diseases in a National Health Service Laboratory Fiona McKay Principal Clinical Scientist, NE Thames Regional Genetics Service 8th June 2017
  • 2. Invasive vs non-invasive CVS:  normally between 11-14 weeks gestation  Small increased risk of miscarriage  Small risk of infection  Repeat sampling if insufficient material obtained Amniocentesis  normally 15-20 weeks gestation  small increased risk of miscarriage  Small risk of infection  cffDNA  no increased risk of miscarriage  easier sample collection  earlier diagnoses (from 7 weeks) AMNIOCENTESIS CVS
  • 3. Cell-free fetal DNA (cffDNA)  Originates from placenta (trophoblast)  represents whole fetal genome  Detectable from 4 weeks  % increases with gestation  10-20% of total cfDNA  Cleared from circulation within 30mins of delivery  Shorter than maternal cfDNA  maternal cfDNA 166bp  cffDNA 143bp Cell free DNA
  • 4. Cell-free fetal DNA - problems  Relative abundance of maternal cfDNA  Emanates from the placenta - risk of mosaicism?  Limitations for use in multiple pregnancies  When used in early pregnancy, issues associated with ‘vanishing twin’
  • 5. Non-invasive prenatal … definitions • NIPD: DIAGNOSIS - Does NOT require invasive test for confirmation • Single gene disorders • Sex determination • RHD • NIPT or NIPS: TESTING or SCREENING • Aneuploidy Requires invasive testing for confirmation
  • 6. Background In the UK there are ~20,000 molecular prenatal tests per annum 85% because of a high risk for Down’s syndrome Over 3000 prenatal diagnoses are for a risk of a monogenic disorder, 70% after invasive testing. 2015-2016: NIPT for aneuploidy included for the first time 1138 reports (NHS only) 2006-2007: NIPD for fetal sex determination was included in our national audit for the first time: 60 tests (1 lab) In 2015-16: 447 tests (5 labs) 2013-2014: NIPD for monogenic disease (TD) included in Top Prenatal Reports Category ACGS Audit 2013-2014
  • 7. NIPD in use in the UK from 2003 Current practice Fetal sex determination - genes on the Y-chromosome RHD in Rhesus negative mothers at high risk of HDN (not at GOSH)  Women at risk of carrying a fetus with single gene disorder  Scan abnormalities  Known genetic history in family Paternally inherited dominant disorders De-novo gene changes (e.g. Achondroplasia) Paternal mutation exclusion for recessive conditions where parents are carriers of different mutations
  • 8. Non-invasive prenatal diagnosis (NIPD): Detection of cell-free fetal DNA (cffDNA) in maternal plasma to offer a safe alternative to invasive testing. Our ISO15189 accredited NHS Regional Genetics Laboratory offers a clinical NIPD service using targeted NGS panels (Illumina MiSeq) to detect the presence of a paternal or de novo allele:  FGFR3-related skeletal dysplasia including achondroplasia and thanatophoric dysplasia  FGFR2-related craniosynostosis syndromes e.g. Apert & Crouzon  10 common cystic fibrosis mutations 30% of all our molecular prenatal diagnosis since 2015 have been non-invasive 7883
  • 9. NIPD for FGFR3-related skeletal dysplasias Achondroplasia  Most common viable skeletal dysplasia  Most present de novo, in late pregnancy  98% cases due to single mutation in FGFR3 Thanatophoric dysplasia (TD)  Most common lethal skeletal dysplasia  At least 13 mutations in FGFR3 N ACH TD
  • 10. Next generation sequencing (MiSeq Illumina)  30 FGFR3 mutations  (+Severe Achondroplasia with Developmental Delay and Acanthosis Nigricans (SADDAN), hypochondroplasia, craniosynostosis)  6 amplicon panel  Sequence 1000’s of reads  Can determine number of reads of wild type allele and number of reads of mutant allele
  • 11. NIPD for FGFR3-related skeletal dysplasias  Validation  40 achondroplasia – 39/40 correct (rare mutation not on panel)  38 TD - all correct  Several different mutations detected Next generation sequencing - MiSeq NIPD FGFR3 gene panel approved by UKGTN in 2013 cfDNA cfDNA mat gDNA Type2wt 244325 248812 135147 c.1948A>C 139 215 115 c.1948A>G 16768 16937 25 c.1949A>T 204 23 109 c.1949A>C 284 160 168 c.1950G>C 27 33 7 c.1950G>T 107 39 38
  • 12. Benefits of NIPD for FGFR3-related skeletal dysplasias Achondroplasia  Confirmation of sonographic diagnosis without risk of preterm labour  Safe exclusion of Down’s syndrome and other more severe dysplasias  Allows for accurate parental counselling and preparation for delivery Thanatophoric dysplasia  May be detected early. NIPD allows risk free early definitive diagnosis  Excludes differential diagnoses which may carry high recurrence risk  Allows for a surgical termination if requested  Provides accurate diagnosis in twins without putting the normal twin at risk For both, NIPD allows safe exclusion of a recurrence early in future pregnancies
  • 13. Apert syndrome  Autosomal Dominant, 2 common mutations in the FGFR2 gene  NIPD aids sonographic diagnosis from 12 weeks  Allows for exclusion of recurrence in subsequent pregnancies from 9 weeks  Definitive, safe diagnosis in twins  12 diagnostic NIPD NGS tests performed MiSeq NGS results showing large number of wildtype counts in maternal plasma and genomic DNA, but only mutant counts in the two plasma samples analysed NIPD for Apert syndrome approved by UKGTN in 2014
  • 14. NIPD for Cystic Fibrosis – paternal exclusion  Autosomal recessive - paternal mutation exclusion  5 CFTR amplicons for MiSeq (Illumina)  Only applicable to couples  1) who are known carriers of different CF mutations AND  2) the paternal mutation is one of the 10 mutations listed below  10 mutations including neonatal screening common mutations (bold)  c.1521_1523delCTT p.(Phe508del)  c.489+1G>T  c.1624G>T p.(Gly542*)  c.1652G>A p.(Gly551Asp)  c.3846G>A p.(Trp1282*)  c.1657C>T p.(Arg553*)  c.1519_1521delATC p.(Ile507del)  c.1679G>C p.(Arg560Thr)  c.1646G>A p.(Ser549Asn)  c.1647T>G p.(Ser549Arg)  13 diagnostic NIPD NGS tests performed NIPD for Cystic Fibrosis approved by UKGTN in 2014 FALSE NEGATIVE NIPD CASE • CF NIPD referral for pat mutation exclusion • Paternal mutation c.3909C>G – detected in paternal gDNA using assay • Not detected in cfDNA in 2 separate samplings, presence of cfDNA confirmed • Baby affected with CF • Mutation withdrawn from panel
  • 15. Aim: To increase availability of NIPD Bespoke NIPD: Target Population Couples with a pregnancy at risk of a genetic condition where a de novo or paternal mutation is known. Relative Haplotype Dosage Analysis: Target Population Couples with a pregnancy at high risk of inheriting a recessive genetic condition irrespective of genotype.
  • 16. Aim: To increase availability of NIPD Inclusion criteria: 1-3 base pair mutation Control gDNA De Novo / Paternal Dominant For recessive conditions, parents must carry different mutations Target Population Couples with a pregnancy at risk of a genetic condition where the mutation is known and invasive prenatal diagnosis would otherwise be the only option Exclusion criteria: Pseudogene Polymorphisms
  • 17. Bespoke NIPD Assay development for each couple: Ideally, pre-pregnancy gDNA from affected proband or carrier parent Primer design, SNP check & order NGS confirmation of mutation detection Report within 8 weeks to offer NIPD cffDNA testing in pregnancy: Minimum 9 weeks gestation May require 2 samples one week apart at early gestation
  • 18. FRAS1 exon 66 hg19_dna range=chr4:79437011-79437070 ctccctccctggcagAGGCAGGGTTCCTGGATGATGTGGTCTATGATAGCACTGCCCTGGGGCCTGGCTACGATCGCCC CTTCCAGTTTGACCCCAGCGTGCGAGAGCCGAAGACCATCCAGCTCTACAAACACCTGAACCTGAAGAGCTGCGTGTGG ACCTTTGATGCTTATTATGACATGACTGAGCTGATTGACGTCTGTGGGGGCTCTGTAACCGCTGACTTCCAGgtaggtg ccccggggcttgtctgaggactctgc Bespoke Amplicon Based Design C primer Re familial mutation G exon Sample index - 6bp Illumina sequence adaptor (MiSeq) 60bp
  • 19. Bioinformatic Analysis Automated scripting to count wild type and mutant sequences Monitoring sample indexes for potential contamination Poor quality data is filtered outID6 ID7 ID8 cffDNA (1) cffDNA (2) Mat gDNA FRAS1 wt 319077 141751 440538 FRAS1 c.10261C>T 34498 12055 292 ZFX 36743 44017 350940 ZXY 6 0 2
  • 20. Bioinformatic Analysis Confirmation of Fetal DNA ZFX/Y and HLA assays are run in parallel to confirm presence of cffDNA in the same plasma extract undergoing mutation test: • Calculate fetal fraction • Important in mutation negative cases • Uninformative (HLA/ZFY) mutation negative cases: can’t confirm fetal DNA present ID01 ID08 ID02 cfDNA cfDNA gDNA HLABexon3-VAR01 0 1 2 HLABexon3-VAR02 3509 2734 2805 HLABexon3-VAR03 1 9 0 HLABexon3-VAR04 9 26 11 HLABexon3-VAR05 4108 3582 2876 HLABexon3-VAR06 3 0 0 HLABexon3-VAR07 336 656 0 HLABexon3-VAR08 0 0 0 ZFX 27046 48258 55986 ZFY 764 1456 6 Apert wt 97397 163414 97801 Apert c.755C>G 15 15 13 Apert c.758C>G 16 26 8 Apert c.755_756delCGinsTT 0 2 0 FETAL FRACTION ID01 VARIANT Counts Maternal allele 1: VAR#2 3509 Maternal allele 2: VAR#5 4108 TOTAL maternal counts: 7617 VARIANT Counts Fetal HLA variant: VAR#7 336 Fetal Fraction: 8.45
  • 21. Bespoke NIPD tests Confirmed inheritance of paternal FGFR2 mutation (Crouzon syndrome) Pre-pregnancy work-up Bespoke NIPD test in subsequent pregnancy – fetus predicted to be AFFECTED
  • 22. Bespoke NIPD tests Exclusion of recurrence of de novo SMARCB1 mutation Pre-pregnancy work-up Bespoke NIPD test in subsequent pregnancy – fetus predicted to be UNAFFECTED
  • 23. Audit of bespoke service - delivery Phenotype Gene Mutation Tuberous sclerosis TSC2 c.133_134delCT c.2713C>T c.4351dupC c.4645T>A Neurofibromatosis type 1 NF1 c.4823T>C c.4330A>G c.5170C>T Rhabdoid Tumour Predisposition Syndrome SMARCB1 c.157C>T c.118C>T Epileptic encephalopathy, early infantile SCN8A KCNQ2 c.669G>T c.431G>A Skeletal Dysplasia (AR) FGFR3 TCF12 SLC26A2 c.779C>G c.1916del c.296T>C Fraser syndrome (AR) FRAS1 c.10261C>T c.10261C>T c.10261C>T Late infantile neuronal ceroid lipofuscinosis TPP1 c.509-1G>C Noonan syndrome PTPN11 c.178G>A Porencephaly COL4A1 c.324+1G>A Marfan syndrome FBN1 c.8268G>A Polycystic kidney disease (AR) PKHD1 c.1486C>T Phenotype Gene Mutation Intellectual disability ARID1B KDM5B BCAP31 CASK c.6129del c.3343C>T c.2359T>C c.678+1G>A c.37G>T Congenital Nephrotic Syndrome WT1 c.1301G>A Cornelia De Lange syndrome NIPBL c.4160dupA Osteogenesis imperfecta COL1A1 COL1A2 c.543+4A>T c.543+4A>T c.1875+1G>A c.1801G>A c.1801G>A c.1801G>A c.1801G>A Renal tubular dysgenesis (AR) ACE c.96del Epidermolytic Palmoplantar Keratoderma KRT9 c.482A>G c.482A>G Hereditary spastic paraplegia SPAST c.1361A>G Familial dilated cardiomyopathy ACTC1 c.664G>A Alexander disease GFAP c.235C>A 42 bespoke tests offered: 9/42 mutation positive
  • 24. Audit of bespoke service - requests Designs Requested Gene Mutation Zellweger PEX6 c.1314_1321del Intellectual disability KATA6A c.4213G>T Smith-Lemli-Optiz (AR) DHCR7 c.964-1G>C TPM1-related cardiomyopathy TPM1 c.742A>G Neurofibromatosis type 2 NF2 c.523_524del Alpers syndrome POLG c.2542G>A Laron syndrome GHR c.922G>A Spondyloepiphyseal dysplasia congenita COL2A1 c.2104G>A Osteogenesis imperfecta COL1A2 c.965G>A Osteogenesis imperfecta COL1A1 c.544-1G>A / c.941G>A Ornithine Transcarbamylase Deficiency OTC c.521C>T Congenital glaucoma FOXC1 c.392C>A Neurofibromatosis type 1 NF1 c.6007-2A>G NIPD not possible
  • 25. NIPD for recurrence NIPD to exclude recurrence of an apparently de novo mutation  All pregnancies tested on this basis detected no mutation  Is there any point in testing low risk pregnancies? Benefits  Safe non-invasive test for low risk pregnancies  Welcomed by patients, many of whom prefer to accept the low risk of recurrence rather than undergo invasive testing  In some mosaic cases, NGS analysis has indicated recurrence risk may be higher  For recessive conditions, exclusion of the paternal allele reduces the rate of invasive testing as only pregnancies where the paternal allele is inherited require invasive test
  • 26. Number of Invasive and Non-Invasive Prenatal Diagnosis tests carried out per year Prenatal service delivery – where are we now? Single gene tests: TOTAL: 383 Fails: 6 (1.5%) Inconclusive: 4 (1.0%) 0 10 20 30 40 50 60 70 80 90 2008-9 2009-10 2010-11 2011-12 2012-13 2013-14 2014-15 2015-16 2016-17 SD Invasive SD NIPD 0 10 20 30 40 50 60 70 80 90 2008-9 2009-10 2010-11 2011-12 2012-13 2013-14 2014-15 2015-16 2016-17 SD Invasive SD NIPD Bespoke 0 10 20 30 40 50 60 70 80 90 2008-9 2009-10 2010-11 2011-12 2012-13 2013-14 2014-15 2015-16 2016-17 SD Invasive SD NIPD Bespoke CF Exclusion CF RHDO
  • 27. How is bespoke NIPD being offered? Not all NHS trusts are funding the same level of NIPD  cost for bespoke work-up (as assay likely only to be used by that family)  additional cost for NIPD Three funding scenarios:  Trust pays for work-up and NIPD  Parents pay for work-up & trust pays for NIPD (Some trusts won’t pay for recurrence testing)  Parents pay for work-up & NIPD MOST COMMON
  • 28. Challenge fetal DNA present amongst high background of maternal DNA detect slight increase in mutant reads NIPD for autosomal recessive conditions cffDNA fraction directly affects expected extent of allelic imbalance Concentration of cffDNA varies with gestation & between pregnancies Relative mutation dosage-RMD Measuring fetal fraction: Y-chr markers size differential heterozygous SNPs
  • 29. NIPD by relative haplotype dosage analysis Maternal Paternal Proband Haplotype analysis Lo et al 2010 Sci Trans Med; New et al 2014 J Clin End Metab Link SNPs flanking CYP21A2 to mutant allele (Hap 1 = mutant allele) Agilent Sureselect Custom Enrichment Assay ~6500 SNPs (7Mb flanking CYP21A2)
  • 30. Principles of linkage analysis SNPs flanking CYP21A2 are genotyped in maternal and paternal DNA Next generation sequencing of SNPs in cell-free DNA Assess all informative SNPs along chromosome to determine inheritance of paternal haplotype SNP informative if; Homozygous in Mother Heterozygous in Father Hap 1 / Hap 2 Maternal Paternal Parental genotypes Paternal Hap 1 transmitted if ‘C’ allele NOT detected Or A A A C Fetal genotypes A A A C Maternal plasma Paternal Hap 2 transmitted if ‘C’ allele IS detected Paternal haplotype transmission
  • 31. Linkage analysis Advantages • Useful when there is a pseudogene/high homology with another gene • Useful for diagnostic service as can have single NIPD assay for all families with mutations in the same gene, regardless of mutation Challenges • Sufficient DNA for library preparation • robust assay with variable cfDNA • PCR – duplicates • Labour intensive, time consuming assay
  • 32. Adapted from Lo et al 2010, Sci. Transl. Med. 2, 61ra91 Relative Haplotype Dosage Analysis (RHDO)  Involves analysis of multiple SNPs which flank the disease gene / locus of interest  If the phase of the mutation carried by both parents is known then RHDO can assess whether the maternal mutant or wild-type allele has been transmitted to the fetus  Provides definite diagnosis for recessive conditions NIPD for Cystic Fibrosis by RHDO – in service from 3rd October 2016 NIPD for Spinal Muscular Atrophy (SMA) and Congenital Adrenal Hyperplasia (CAH) by RHDO – under development
  • 33. 170394 2017-05-13 Fetal fraction Fetal fraction Qualified SNPs Disqualified SNPs Type 1 SNPs 0.11 20 0 Type 3AD SNPs 0.103 18 0 Type 3BC SNPs 0.0815 2 51 Maternal haplotype Homozygous.for.HapI Heterozygous Homozygous.for.HapII Conclusion Type_4a 0 3 0 Discordant to Proband Type_4a_rev 0 3 0 Discordant to Proband Type_4b 0 0 6 Discordant to Proband Type_4b_rev 0 0 6 Discordant to Proband Paternal haplotype Qualified.SNPs Disqualified.SNPs Conclusion Type 3AD SNPs 18 0Discordant to Proband Type 3BC SNPs 2 51NA Proband Affected Maternal haplotype Discordant to Proband Paternal haplotype Discordant to Proband cffDNA result Predict UNAFFECTED Relative Haplotype Dosage Analysis (RHDO)
  • 34. RHDO – Cystic Fibrosis Service Case Gestation Fetal Fraction Outcome 1 10+3 8% Paternal high risk Maternal high risk 2 11 4.8% Paternal high risk Maternal low risk 3 9+1 15.4% Paternal low risk Maternal low risk 4 12+2 14.6% Paternal low risk Maternal high risk 5 9+4 11% Paternal high risk Maternal high risk 6 9+0 6.4% Paternal high risk Maternal low risk 7 9+0 11.6% Paternal low risk Maternal low risk
  • 35. Case study G129789 • Maternal mutation c.1521_1523delCTT p.(Phe508del) • Paternal mutation c.489+1G>T • Affected son • 2015 – NIPD paternal mutation exclusion • no mutation detected, invasive not required • 2017 – NIPD RHDO • paternal high risk, maternal low risk alleles detected • Invasive not required (would have been required if only paternal mutation exclusion had been available) 2015 2017
  • 36. Conclusions Technical challenges • Delivering an accredited NIPD service for paternal exclusion is relatively straightforward. • Expanding the service to make NIPD available for rare conditions time consuming and costly. • High NGS sensitivity reveals mosaicism. Essential to test maternal samples in parallel by NGS. Particular importance for panel based NGS to detect common mutations. Patient Perspective • Uptake is high; patients have welcomed the availability of our bespoke NIPD service • Funding / Commissioning in our NHS service is an issue for this costly test. Equity of access. • High rate of testing for information only.
  • 37. Acknowledgments NETRGL Lyn Chitty Lucy Jenkins Sarah Mason Sandra Moore Natalie Chandler Helena Ahlfors Funding NETRGL RAPID NIHR PGfAR GOSH CC Charity GOSH BRC This work described here was partially funded by the National Institute for Health Research (NIHR) under its Programme Grants for Applied Research Programme (RP-PG-0707-10107 – “RAPID”) and the GOSH BRC. The views expressed are those of the author and not necessarily those of the NHS, the NIHR or the Department of Health. Research Team Samantha Edwards Melissa Hill Suzanne Drury Jane Hayward