Diese Präsentation wurde erfolgreich gemeldet.
Wir verwenden Ihre LinkedIn Profilangaben und Informationen zu Ihren Aktivitäten, um Anzeigen zu personalisieren und Ihnen relevantere Inhalte anzuzeigen. Sie können Ihre Anzeigeneinstellungen jederzeit ändern.

The Global Micorbial Identifier (GMI) initiative - and its working groups

1.352 Aufrufe

Veröffentlicht am

http://www.fao.org/about/meetings/wgs-on-food-safety-management/en/

The GMI initiative - and its working groups. Presentation from the Technical Meeting on the impact of Whole Genome Sequencing (WGS) on food safety management -23-25 May 2016, Rome, Italy.

Veröffentlicht in: Bildung
  • Login to see the comments

  • Gehören Sie zu den Ersten, denen das gefällt!

The Global Micorbial Identifier (GMI) initiative - and its working groups

  1. 1. The GMI initiative - and its working groups Michael Fam Chair Professor Food Science and Technology Jørgen Schlundt
  2. 2. Kikd off in brussels 2011 Growing the network First results & pilots Creating feritle ground agtcagtcacagtacaagtcagtcacagtacaagtcagtcacagtaca I --- - Database(s) in the Cloud Diagnosis Whole Genome Sequencing Patient / Food ,Food & Disease Surveillance Global Prevention GMI – The idea
  3. 3. Global Microbial Identifier A global system will enable three major lines of action: • Simple identification of all microorganisms in clinical (or other) settings, enabling reduction of total time (and cost) for characterization down to typical time needed to obtain the original isolate • A total database of unique sequences of all relevant microbiological strains globally, enabling real-time global surveillance of disease developments • A backbone of Microbial DNA sequences to be used for deep sequencing analyses from different sources (gut, sewage, environment, food?)
  4. 4. Virus – Bacteria – Parasites Same - Same www.globalmicrobialidentifier.org
  5. 5. GMI Steering Committee Eric Brown, Food and Drug Administration (FDA), USA Vincenco Caporale, World Organization of Animal Health (OIE) Amy Cawthorne, World Health Organization (WHO), Switzerland Paul Cook, Food Standards Agency (FSA), UK David Heymann, Health Protection Agency, UK Marion Koopmans, Erasmus Medical Centre, Netherlands David J. Lipman, Nat. Center for Biol. Information (NCBI), USA Pathom Sawanpanyalert, Ministry of Public Health, Thailand Jørgen Schlundt, Nanyang Technological University, Singapore Masami T. Takeuchi, Food and Agriculture Organization (FAO) Jianguo XU, National Institute for CDC, China
  6. 6. GMI - according to the Charter GMI consists of The Platform (organizing body, including e.g. the Steering Committee and the Working Groups) and The Community Network (all individuals and organizations that subscribe to the GMI Website by filling in a profile) The Work Groups Four WGs – originally five Structuring of GMI must aim to continue to minimize bureaucracy whilst maximizing the flexibility that has characterized GMI thus far.
  7. 7. WG1: Political challenges, outreach and building a global network Chair: Jorgen Schlundt, Co-chair: Pathom Sawanpanyalert Developing a long-term plan to shape political level involvement in GMI development at the global, regional and national level. Attempting to establish a functional link to political level decision makers in several countries or regional, international organizations. Initiate a coherent system for international discussion of relevant themes, e.g. › global health diplomacy, › coordination between different sectors, › sensitivity of metadata, › open access database of genome sequences, › sharing of strains over borders, › intellectual property rights (IPR), and › funding.
  8. 8. WG2: Repository and storage of sequence and meta-data Chair: Bill Klimke, Co-chair: Guy Coachrane Developing a format to capture ”Minimum Data for Matching (MDM)”, consisting of reads and minimum metadata. The MDM may or may not be accompanied by assemblies and/or annotation and/or additional metadata. Ideally, any MDM provided for purposes of searching the GMI databases should immediately also become a deposit available for searching by later submitters. The search and analytical layers may be provided by INSDC members or by other parties (International Nucleotide Sequence Database Collaboration) Aiming for a centrally controlled searching and reporting protocol that official sites adhere to and to whom relevant agencies submit
  9. 9. WG3: Analytical approaches Chair: Marion Koopmans, Co-chair: Marc Allard Providing guidance for the development of analytical tools for the optimal functioning of the GMI platform. Develop a global platform (database, linked databases) that facilitates the application of NGS in research, clinical and public health settings worldwide Define requirements for GMI functioning from the perspective of end-users (clinical, public health, food safety, research) in terms of applications (identification, outbreak detection etc.) and priority targets/diseases Map current analytical options and solutions against the needs of GMI end-users, to identify possible R&D and implementation gaps and to identify projects that may fill those gaps
  10. 10. WG4: Ring trials and quality assurance Chair: Rene Hendriksen, Co-chairs: James Pettengill, Errol Strain Aiming for all laboratories globally to conduct NGS on bacteria and virus to the highest degree of quality Establishing a proficiency testing (PT) WGS infrastructure for GMI and other partners to ensure high quality and reliable data. Roll out of PT focusing on testing the quality of sequencing bacterial DNA as well as cluster analysis on sets of genomes Initiate virus pilot PT scheme initially focusing on identification of virus in matrices from metagenomics sequencing data
  11. 11. WG5: Pilot Projects Steering Committee decided “to retire working group 5 and discuss a new communication outreach effort at the GMI9 meeting.” WG 1-4 are suggested to initiate such discussions in the Break-out sessions

×