SlideShare a Scribd company logo
1 of 22
Dmitry Schigel
Virve Viertiö
University of Helsinki
On the wings of bark beetles:
Ips typographus and fungal arrival
to spruce trees in Finland
Outline
• Project: colonization gates
• GBIF.org and databases
• Student projects & Ips story
• Teaching dead wood in 2016
Dmitry Schigel: 2012-2015
Academy of Finland
Colonization gates and establishment
of wood-decaying fungi in European Spruce
In Southern Finland
Metsäkulma, Mäntsälä
Rörstrand, Sipoo
X =
2014 Basel -> GBIF
GBIF.org
Note new e-mail address: dschigel@gbif.org
GBIF BY THE NUMBERS
652,948,064
species occurrence
records
15,882
datasets
804
data-publishing
institutions
• http://www.gbif.org | 01 APR 2016
 O1 spatial and temporal aspects TIME
early colonization events SPACE
 O2 role of Coleoptera as vectors BEETLE
of wood-decaying fungi colonizing living trees
GBIF <- DATA
Colonization gates
Colonization gates: BEETLES & STUDENTS
Maria Faticov, MSc
University of Helsinki
fungivory and host use
Virve Viertiö,
University of Helsinki
MSc project on fungal
dispersal by insects
9
Colonization
of a new
resource
Fungal arrival to trees
• spores and mycelia
• Going thourgh defence
mechanisms of a tree
Animal vectors
Pheromone traps
• emptied once a
week all
summer
• beetles to zip-
lock bags and to
the freezer
• traps washed
with soap water
• catch 2013: total
73 000 beetles
10
Pics: D. Schigel
Air control
• to separate fungi
from the air only vs.
the trap catch
= air + beetles
• Eppendorfs with
fungal spores vs.
greywater from the
beetle washing
11
Pics: Virve Viertiö
>sample1
TTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATACAATTCGGTCGGCGGGAAGGAGGGGGAG
CTGTCGCTGGCCTTGTGGCATGTGCACGCTCTCTTTGGAACGTCGGTCGTCTTTCATATTTTCACCAGTG
CACCCAATGTAGGATGCCTCTCCTCCGGGAGGGGGGACCTATGTCTTTTTCAGACGCCCCCACAGTTTA
>sample2
GAAAGTCTCAGAATGTTTACTATCGTCGAACCATGACTTCCAGGAGACGTGGGTCGGCGAGATAAAAG
TTATCACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATG
TAATGTGAATTGCAGATCTACAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCCTCGGTGTTCCG
>sample3
PCR: Fungal ITS1 and ITS2 regions
primers ITS1F – ITS4
• Two sites
• 8 traps checked
• May to October
• Air samples as controls
• Fungal DNA present
• sorting and counting completed
• DNA extracted
-> PCR, Sequncing
Virve Viertiö
MSc student
MSc
project
14
• Using DNA, tens of fungal species / OTUs were detected in
every beetle and air sample
• Molecular identification and statistical analysis ongoing
• Which species of wood decomposing fungi will form a
community here in 10, 20, 50 years?
University of Helsinki
Finland
Moscow State University
Russia
Swedish University
of Agricultural Sciences
2016: Nordic – Russian Boreal Biodiversity
and Data Education Network
Education and outreach
• Polypores of the Białowieża forest Oct 2013
• Biodiversity in dead wood, Helsinki Nov 2013
• Next-gen seq sample prep course, Uppsala Jun 2014
• Biodiversity informatics and data management Jul 2014
• Polypore course, Russia Aug 2014
• Polypore course, Finland: ForBio Sep 2014
• Dead wood meeting, Lammi: SIU May 2015
* * *
• Dead wood meeting & course Lammi, FIN Aug 2016
• Polypores as indicator species Lammi, FIN Sep 2016
• Biodiversity data skills Tartu, EST Nov 2016
FUNGAL ECOLOGY MATHEMATICAL BIOLOGY GROUP
http://blogs.helsinki.fi/deadwoodmeeting
registration until 20 May, may close earlier
SX invertebrate teacher,
Conditions:
teaching for a cup of rice
(& travel, & accomodation)
Photo: Dmitry Schigel,
Virve Viertiö
Thank you!

More Related Content

Similar to Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

Forest Refine Newsletter No 6
Forest Refine Newsletter No 6Forest Refine Newsletter No 6
Forest Refine Newsletter No 6Kalvis Kons
 
Erscp 2014 ENG
Erscp 2014 ENGErscp 2014 ENG
Erscp 2014 ENGnigradmb
 
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...BOBCATSSS 2017
 
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
 Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-PurovaaraBusiness Finland
 
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministryNordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministryNordForsk
 
Presentation for Cardiff University Library staff
Presentation for Cardiff University Library staffPresentation for Cardiff University Library staff
Presentation for Cardiff University Library staffkratec
 
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...Brussels, Belgium
 
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...Brussels, Belgium
 
QQML 2015 Opening Presentation
QQML 2015 Opening PresentationQQML 2015 Opening Presentation
QQML 2015 Opening PresentationAris Meletiou
 
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural DevelopmentBelgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural DevelopmentSmart Villages
 
Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...Karlsruhe Institute of Technology (KIT)
 
Joint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in FinlandJoint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in FinlandAnna-Kaisa Sjölund
 
ViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERNViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERNVince Smith
 
Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)jmamtora
 
Towards National Open Access Policy in Finland
Towards National Open Access Policy in FinlandTowards National Open Access Policy in Finland
Towards National Open Access Policy in FinlandPekka Olsbo
 
Law Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of EnvironmentLaw Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of EnvironmentKornelija Petr
 

Similar to Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation. (20)

Forest Refine Newsletter No 6
Forest Refine Newsletter No 6Forest Refine Newsletter No 6
Forest Refine Newsletter No 6
 
Sciences Po Grenoble library and Research, France
Sciences Po Grenoble library and Research, FranceSciences Po Grenoble library and Research, France
Sciences Po Grenoble library and Research, France
 
Erscp 2014 ENG
Erscp 2014 ENGErscp 2014 ENG
Erscp 2014 ENG
 
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
 
ETDs in india
ETDs in indiaETDs in india
ETDs in india
 
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
 Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
 
Good Data Battle in Slovenia – ADP experience
Good Data Battle in Slovenia – ADP experienceGood Data Battle in Slovenia – ADP experience
Good Data Battle in Slovenia – ADP experience
 
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministryNordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
 
Call for papers: IASC 2014 3rd European Meeting
Call for papers: IASC 2014 3rd European MeetingCall for papers: IASC 2014 3rd European Meeting
Call for papers: IASC 2014 3rd European Meeting
 
Presentation for Cardiff University Library staff
Presentation for Cardiff University Library staffPresentation for Cardiff University Library staff
Presentation for Cardiff University Library staff
 
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
 
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
 
QQML 2015 Opening Presentation
QQML 2015 Opening PresentationQQML 2015 Opening Presentation
QQML 2015 Opening Presentation
 
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural DevelopmentBelgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
 
Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...
 
Joint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in FinlandJoint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in Finland
 
ViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERNViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERN
 
Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)
 
Towards National Open Access Policy in Finland
Towards National Open Access Policy in FinlandTowards National Open Access Policy in Finland
Towards National Open Access Policy in Finland
 
Law Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of EnvironmentLaw Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of Environment
 

Recently uploaded

All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...Sérgio Sacani
 
Hubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsHubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsSérgio Sacani
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRDelhi Call girls
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxUmerFayaz5
 
VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PPRINCE C P
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsAArockiyaNisha
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfSumit Kumar yadav
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...jana861314
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...RohitNehra6
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfmuntazimhurra
 
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...ssifa0344
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfSumit Kumar yadav
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxgindu3009
 
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptxUnlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptxanandsmhk
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Sérgio Sacani
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPirithiRaju
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisDiwakar Mishra
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bSérgio Sacani
 
DIFFERENCE IN BACK CROSS AND TEST CROSS
DIFFERENCE IN  BACK CROSS AND TEST CROSSDIFFERENCE IN  BACK CROSS AND TEST CROSS
DIFFERENCE IN BACK CROSS AND TEST CROSSLeenakshiTyagi
 
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINChromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINsankalpkumarsahoo174
 

Recently uploaded (20)

All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
 
Hubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsHubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroids
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptx
 
VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C P
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdf
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdf
 
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdf
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
 
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptxUnlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
 
DIFFERENCE IN BACK CROSS AND TEST CROSS
DIFFERENCE IN  BACK CROSS AND TEST CROSSDIFFERENCE IN  BACK CROSS AND TEST CROSS
DIFFERENCE IN BACK CROSS AND TEST CROSS
 
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINChromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
 

Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

Editor's Notes

  1. New email address Traits Citizen science
  2. GBIF logo to add in bottom left
  3. When and how do the wood decomposing fungi arrive to trees? Does the bark beetle Ips typographus vector some wood decomposing fungi to the trees it attacks? Is there a difference in the fungal community carried by the beetle’s 1st and 2nd generation?
  4. We use DNA to detect and to quantify species, testing hypothesis and molecular curiosity, Sonja
  5. New network name
  6. Other events include species identification and sample preparetion skills, data management skills and finally, dead wood symposium
  7. A few snapshots from these courses; important, try to recall the event, the person or the book that made you decide that you would like to be a biologists, or to work with biologists
  8. Screenshots from 2015 Group photo, programme Archive slides!
  9. POSter Almost a society, beetles, fungi, Almost have a journal Almost have a website and social media groups Almost have a conferences Almost have a study programme.