Diese Präsentation wurde erfolgreich gemeldet.
Wir verwenden Ihre LinkedIn Profilangaben und Informationen zu Ihren Aktivitäten, um Anzeigen zu personalisieren und Ihnen relevantere Inhalte anzuzeigen. Sie können Ihre Anzeigeneinstellungen jederzeit ändern.
Machine Learning in
Bioinformatics
Dmytro Fishman (dmytro@ut.ee)
BIIT
Dmytro Fishman
E-mail: dmytro@ut.ee
Oct 21 - 23, Tartu
Machine Learning in
Bioinformatics
Machine Learning in
Bioinformatics
https://siteman.wustl.edu/glossary/cdr0000046470/
Central dogma
Microlevel
http://learn.genetics.utah.edu/content/cells/scale/
What these books
contain?
This is a single
human genome
~4GB
Big Data
ML in Bioinformatics (part III)
2016
Labs that produce data
Research groups that can
analyse data
What is Bioinformatics?
“Bioinformatics is an interdisciplinary field
that develops methods and software tools for
extracti...
What is Bioinformatics?
“Bioinformatics is
• an interdisciplinary field
• develops methods and software tools
• for extract...
What is Bioinformatics?
Presenting this knowledge to non-experts
“Bioinformatics is
• an interdisciplinary field
• develops...
Bioinformatics
Computer
Science
Biology
Statistics
Bioinformatics
Computer
Science
Biology
Statistics
Bioinformatics
Computer
Science
Biology
Statistics
P-hacking
Machine Learning in
Bioinformatics
Feature#2
Feature #1
Feature#2
Feature #1
Feature#2
Feature #1
Feature#2
Feature #1
Healthy
Sick
Feature#2
Feature #1
Healthy
Sick
Feature#2
Feature #1
Feature#2
Feature #1
Healthy
Sick
Feature#2
Feature #1
Feature#2
Feature #1
Healthy
Sick
Feature#2
Feature #1
Anything
in common?
Feature#2
Feature #1
Healthy
Sick
Feature#2
Feature #1
Females
Males
Feature#2
Feature #1
Healthy
Sick
Feature#2
Feature #1
Females
Males
Supervised
Learning
Unsupervised
Learning
Linear Classifiers Decision Trees
Feature #1
> 20 <= 20
Feature #2
> 1000 <= 1000
1
Neural Networks
Input
Hidden
Layer
0
k-...
Machine Learning in
Bioinformatics
Anna, 32, Female, DT2,…
Metadata
Anna, 32, Female, DT2,…
Medical Signal
Metadata
Anna, 32, Female, DT2,…
Medical Signal
Metadata
Medical Imaging
Anna, 32, Female, DT2,…
Medical Signal
Metadata
Medical Imaging
Anna, 32, Female, DT2,…
Medical Signal
Metadata
Medical Imaging
Clinical Data
Anna, 32, Female, DT2,…
ACCTTGCTTACC…
Medical Signal
Metadata
Medical Imaging
Clinical Data
Genetical Information
Anna, 32, Female, DT2,…
ACCTTGCTTACC…
Medical Signal
Metadata
Medical Imaging
Clinical Data
Genetical Information
Metabolite #1
Metabolite #2
Metabolite #3
First individual
Metabolite #1
Metabolite #2
Metabolite #3
First individual
M1
M2
M3
Metabolite #1
Metabolite #2
Metabolite #3
First individual
M1
M2
M3
Metabolite #1
Metabolite #2
Metabolite #3
Second individual
M1
M2
M3
Metabolite #1
Metabolite #2
Metabolite #3
Individual #N
M1
M2
M3
Metabolite #1
Metabolite #2
Metabolite #3
M1
M2
M3
Patients Healthy
Individual #N
Metabolite #1
Metabolite #2
Metabolite #3
M1
M2
M3
Patients Healthy
Individual #N
Metabolite #1
Metabolite #2
Metabolite #3
M1
M2
M3
Patients Healthy
P(disease) =
0.6*M1 + 0*M2 - 0.7*M3
Individual #N
Metabolite #1
Metabolite #2
Metabolite #3
M1
M2
M3
Patients Healthy
P(disease) =
0.6*M1 + 0*M2 - 0.7*M3
Individual #N
Dima
Anna, 32, Female, DT2,…
ACCTTGCTTACC…
Medical Signal
Metadata
Medical Imaging
Clinical Data
Genetical Information
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
…AACCTTTACATTAAACTGGGACCCGG… Individual #1
…AACCTTTACATTATACTGGGAGCCGG… Individual #2
…CTAAACCACATTATACTGGGACCCGG… Individ...
Anna, 32, Female, DT2,…
ACCTTGCTTACC…
Medical Signal
Metadata
Medical Imaging
Clinical Data
Genetical Information
Neuroimaging
Neuroimaging EEG Signal
Neuroimaging EEG Signal
Fourier
Transform
Data
Neuroimaging EEG Signal
Data
Neuroimaging EEG Signal
Data Machine Learning
Neuroimaging EEG Signal
Data Machine Learning
P( ) = .92
Neuroimaging EEG Signal
Data Machine Learning
P( ) = .92
Flying
Neuroimaging EEG Signal
Data Machine Learning
P( ) = .92
Soft Introduction to Brain-Computer Interfaces
by Ilya Kuzovkin (...
Cardiogram
Data Machine Learning
P( ) = .92
Cardiograph
Anna, 32, Female, DT2,…
ACCTTGCTTACC…
Medical Signal
Metadata
Medical Imaging
Clinical Data
Genetical Information
AD NDC
Alzheimer’s Disease
Disease Stage Prediction
Diabetic Retinopathy
AD NDC
Alzheimer’s Disease
Disease Stage Prediction
Diabetic Retinopathy Alzheimer’s Disease
Heart Volume
Prediction
Heart Failure
AD NDC
Disease Stage Prediction
Diabetic Retinopathy
Mitotic Cells
Count
Breast Cancer
Alzheimer’s Disease
Heart Volume
Predictio...
AD NDC
Alzheimer’s Disease
Disease Stage Prediction
Diabetic Retinopathy
Heart Volume
Prediction
Heart Failure
Mitotic Cel...
AD NDC
Alzheimer’s Disease
Disease Stage Prediction
Diabetic Retinopathy
Heart Volume
Prediction
Heart Failure
Mitotic Cel...
AD NDC
Alzheimer’s Disease
Disease Stage Prediction
Diabetic Retinopathy
Heart Volume
Prediction
Heart Failure
Mitotic Cel...
Anna, 32, Female, DT2,…
ACCTTGCTTACC…
Medical Signal
Metadata
Medical Imaging
Clinical Data
Genetical Information
National Health System
peterson@nhs.eu
Log In
Having trouble logging in?
Anna, 32, Female
see full profile
see all recent scans
see all genetic risks
Susceptible to DT2
09 10 11 12 0102 0304
norm...
Anna, 32, Female, DT2,…
ACCTTGCTTACC…
Data Integration for
better decision making
is the key challenge
Quiz
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
G...
Genes
are
us…
and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY—
EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
5...
MEETUP
BIIT
dmytro@ut.ee
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Machine Learning in Bioinformatics
Nächste SlideShare
Wird geladen in …5
×

Machine Learning in Bioinformatics

Bioinformatics is a science of extracting knowledge from biological data, сomplexity and amount of which, has increased significantly over the past decades. To meet the challenges ahead, more sophisticated algorithms and assets should be adopted. Thus, Machine Learning has become an everyday tool in Bioinformatics, that helps to solve important biological riddles. In this report, In this presentation I discussed examples of how using well-known Machine Learning methods, bioinformaticians and computer scientists help doctors and biologists diagnose and treat deadly diseases.

Ähnliche Bücher

Kostenlos mit einer 30-tägigen Testversion von Scribd

Alle anzeigen

Ähnliche Hörbücher

Kostenlos mit einer 30-tägigen Testversion von Scribd

Alle anzeigen
  • Als Erste(r) kommentieren

Machine Learning in Bioinformatics

  1. 1. Machine Learning in Bioinformatics Dmytro Fishman (dmytro@ut.ee) BIIT
  2. 2. Dmytro Fishman E-mail: dmytro@ut.ee Oct 21 - 23, Tartu
  3. 3. Machine Learning in Bioinformatics
  4. 4. Machine Learning in Bioinformatics
  5. 5. https://siteman.wustl.edu/glossary/cdr0000046470/
  6. 6. Central dogma
  7. 7. Microlevel http://learn.genetics.utah.edu/content/cells/scale/
  8. 8. What these books contain?
  9. 9. This is a single human genome ~4GB
  10. 10. Big Data
  11. 11. ML in Bioinformatics (part III) 2016
  12. 12. Labs that produce data Research groups that can analyse data
  13. 13. What is Bioinformatics? “Bioinformatics is an interdisciplinary field that develops methods and software tools for extracting knowledge from biological data.” https://en.wikipedia.org/wiki/Bioinformatics
  14. 14. What is Bioinformatics? “Bioinformatics is • an interdisciplinary field • develops methods and software tools • for extracting knowledge from biological data.”
  15. 15. What is Bioinformatics? Presenting this knowledge to non-experts “Bioinformatics is • an interdisciplinary field • develops methods and software tools • for extracting knowledge from biological data.”
  16. 16. Bioinformatics Computer Science Biology Statistics
  17. 17. Bioinformatics Computer Science Biology Statistics
  18. 18. Bioinformatics Computer Science Biology Statistics P-hacking
  19. 19. Machine Learning in Bioinformatics
  20. 20. Feature#2 Feature #1
  21. 21. Feature#2 Feature #1
  22. 22. Feature#2 Feature #1
  23. 23. Feature#2 Feature #1 Healthy Sick
  24. 24. Feature#2 Feature #1 Healthy Sick Feature#2 Feature #1
  25. 25. Feature#2 Feature #1 Healthy Sick Feature#2 Feature #1
  26. 26. Feature#2 Feature #1 Healthy Sick Feature#2 Feature #1 Anything in common?
  27. 27. Feature#2 Feature #1 Healthy Sick Feature#2 Feature #1 Females Males
  28. 28. Feature#2 Feature #1 Healthy Sick Feature#2 Feature #1 Females Males Supervised Learning Unsupervised Learning
  29. 29. Linear Classifiers Decision Trees Feature #1 > 20 <= 20 Feature #2 > 1000 <= 1000 1 Neural Networks Input Hidden Layer 0 k-Nearest Neighbors Others Self-Organizing Map https://topepo.github.io/caret Many more Feature#2 Feature #1 Output Layer 1 0 1 1
  30. 30. Machine Learning in Bioinformatics
  31. 31. Anna, 32, Female, DT2,… Metadata
  32. 32. Anna, 32, Female, DT2,… Medical Signal Metadata
  33. 33. Anna, 32, Female, DT2,… Medical Signal Metadata Medical Imaging
  34. 34. Anna, 32, Female, DT2,… Medical Signal Metadata Medical Imaging
  35. 35. Anna, 32, Female, DT2,… Medical Signal Metadata Medical Imaging Clinical Data
  36. 36. Anna, 32, Female, DT2,… ACCTTGCTTACC… Medical Signal Metadata Medical Imaging Clinical Data Genetical Information
  37. 37. Anna, 32, Female, DT2,… ACCTTGCTTACC… Medical Signal Metadata Medical Imaging Clinical Data Genetical Information
  38. 38. Metabolite #1 Metabolite #2 Metabolite #3 First individual
  39. 39. Metabolite #1 Metabolite #2 Metabolite #3 First individual M1 M2 M3
  40. 40. Metabolite #1 Metabolite #2 Metabolite #3 First individual M1 M2 M3
  41. 41. Metabolite #1 Metabolite #2 Metabolite #3 Second individual M1 M2 M3
  42. 42. Metabolite #1 Metabolite #2 Metabolite #3 Individual #N M1 M2 M3
  43. 43. Metabolite #1 Metabolite #2 Metabolite #3 M1 M2 M3 Patients Healthy Individual #N
  44. 44. Metabolite #1 Metabolite #2 Metabolite #3 M1 M2 M3 Patients Healthy Individual #N
  45. 45. Metabolite #1 Metabolite #2 Metabolite #3 M1 M2 M3 Patients Healthy P(disease) = 0.6*M1 + 0*M2 - 0.7*M3 Individual #N
  46. 46. Metabolite #1 Metabolite #2 Metabolite #3 M1 M2 M3 Patients Healthy P(disease) = 0.6*M1 + 0*M2 - 0.7*M3 Individual #N
  47. 47. Dima
  48. 48. Anna, 32, Female, DT2,… ACCTTGCTTACC… Medical Signal Metadata Medical Imaging Clinical Data Genetical Information
  49. 49. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N …
  50. 50. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … Human genomes are 99.5% similar
  51. 51. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … Mutations
  52. 52. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … Deletions
  53. 53. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … Insertions
  54. 54. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … Compute pairwise distance
  55. 55. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … Compute pairwise distance #1 #2 … #N #1 0 29 … 34 #2 29 0 … 56 … … … … … #N 34 56 … 0 Distance Matrix
  56. 56. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … #1 #2 … #N #1 0 29 … 34 #2 29 0 … 56 … … … … … #N 34 56 … 0 Distance Matrix
  57. 57. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … #1 #2 … #N #1 0 29 … 34 #2 29 0 … 56 … … … … … #N 34 56 … 0 Distance Matrix PCA
  58. 58. …AACCTTTACATTAAACTGGGACCCGG… Individual #1 …AACCTTTACATTATACTGGGAGCCGG… Individual #2 …CTAAACCACATTATACTGGGACCCGG… Individual #N … #1 #2 … #N #1 0 29 … 34 #2 29 0 … 56 … … … … … #N 34 56 … 0 Distance Matrix PCA Principal component analysis of the combined autosomal genotypic data of individuals from Russia and seven European countries (Finnland, Estonia, Latvia, Poland, Czech Republic, Germany [5] and Italia [22]). Khrunin et al.
  59. 59. Anna, 32, Female, DT2,… ACCTTGCTTACC… Medical Signal Metadata Medical Imaging Clinical Data Genetical Information
  60. 60. Neuroimaging
  61. 61. Neuroimaging EEG Signal
  62. 62. Neuroimaging EEG Signal Fourier Transform Data
  63. 63. Neuroimaging EEG Signal Data
  64. 64. Neuroimaging EEG Signal Data Machine Learning
  65. 65. Neuroimaging EEG Signal Data Machine Learning P( ) = .92
  66. 66. Neuroimaging EEG Signal Data Machine Learning P( ) = .92 Flying
  67. 67. Neuroimaging EEG Signal Data Machine Learning P( ) = .92 Soft Introduction to Brain-Computer Interfaces by Ilya Kuzovkin (www.ikuz.eu) Flying
  68. 68. Cardiogram Data Machine Learning P( ) = .92 Cardiograph
  69. 69. Anna, 32, Female, DT2,… ACCTTGCTTACC… Medical Signal Metadata Medical Imaging Clinical Data Genetical Information
  70. 70. AD NDC Alzheimer’s Disease
  71. 71. Disease Stage Prediction Diabetic Retinopathy AD NDC Alzheimer’s Disease
  72. 72. Disease Stage Prediction Diabetic Retinopathy Alzheimer’s Disease Heart Volume Prediction Heart Failure AD NDC
  73. 73. Disease Stage Prediction Diabetic Retinopathy Mitotic Cells Count Breast Cancer Alzheimer’s Disease Heart Volume Prediction Heart Failure AD NDC
  74. 74. AD NDC Alzheimer’s Disease Disease Stage Prediction Diabetic Retinopathy Heart Volume Prediction Heart Failure Mitotic Cells Count Breast Cancer Stained Cells Count Cancer
  75. 75. AD NDC Alzheimer’s Disease Disease Stage Prediction Diabetic Retinopathy Heart Volume Prediction Heart Failure Mitotic Cells Count Breast Cancer Stained Cells Count Cancer Protein Classification
  76. 76. AD NDC Alzheimer’s Disease Disease Stage Prediction Diabetic Retinopathy Heart Volume Prediction Heart Failure Mitotic Cells Count Breast Cancer Stained Cells Count Cancer Protein Classification Accurate classification of protein subcellular localization from high throughput microscopy images using deep learning. Pärnamaa et al.
  77. 77. Anna, 32, Female, DT2,… ACCTTGCTTACC… Medical Signal Metadata Medical Imaging Clinical Data Genetical Information
  78. 78. National Health System peterson@nhs.eu Log In Having trouble logging in?
  79. 79. Anna, 32, Female see full profile see all recent scans see all genetic risks Susceptible to DT2 09 10 11 12 0102 0304 normal Sugar 2010 2011 2011 see other tests results Enter symptoms here… 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 2008 2010 2012 2014 2016 Birth A37: Whooping cough J21.8: Acute bronchiolitis S82: Fracture of lower leg V22.0: Normal Pregnancy Dr. Peterson related medical reports Logout
  80. 80. Anna, 32, Female, DT2,… ACCTTGCTTACC… Data Integration for better decision making is the key challenge
  81. 81. Quiz
  82. 82. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  83. 83. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  84. 84. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  85. 85. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  86. 86. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  87. 87. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  88. 88. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  89. 89. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  90. 90. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  91. 91. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  92. 92. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  93. 93. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  94. 94. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE
  95. 95. Genes are us… and them.SOURCE:,JAVIER,HERRERO,,EUROPEAN,MOLECULAR,BIOLOGY,LABORATORY— EUROPEAN,BIOINFORMAT,ICS,INSTITUTE 50%
  96. 96. MEETUP
  97. 97. BIIT dmytro@ut.ee

×