Looking at the kind of modifications that can be made in mammalian cells, and how at Horizon moving to a haploid model system has significantly improved efficiency of both editing and validation
Lessons learned from high throughput CRISPR targeting in human cell linesChris Thorne
In just a short period of time CRISPR-Cas9 technology has revolutionized the field of genome editing, and taken the scientific community by storm. Already our understanding of how best to apply this technology has advanced significantly and almost every week new publications appear showcasing its application in basic and translational research.
While CRISPR-Cas9 is applicable across many different cell types, we have found it particularly suited for genome editing in near-haploid human cell lines. This has allowed us to establish a robust pipeline for the inactivation of non-essential genes at unprecedented scale and efficiency.
We have now knocked out over 1500 human genes and have generated a resource that is, to the best of our knowledge, the largest collection of human knockout cell lines available, covering comprehensive subsets of genes clustered by biological pathway (e.g. the autophagy pathway, the JAK/STAT pathway) or by phylogenetic relationship (e.g. kinases, bromodomain-containing proteins).
In this talk we will discuss how, through more than 1500 genome editing experiments, we have started to unravel some of the general principles governing the use of CRISPR-Cas9 in mammalian cells. For example, we have analyzed the impact of variation in the guide RNA sequence on Cas9 cleavage efficiency and characterized the mutational signature arising from CRISPR-Cas9 cleavage.
We will also highlight (with examples) how these learnings are now being applied to introduce other genomic modifications in a high throughput manner, including chromosomal deletions, translocations, point mutations and endogenous gene tags.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9
This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
GENESIS™: Comprehensive genome editing - Translating genetic information into personalised medicines.
Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined. Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project
Lessons learned from high throughput CRISPR targeting in human cell linesChris Thorne
In just a short period of time CRISPR-Cas9 technology has revolutionized the field of genome editing, and taken the scientific community by storm. Already our understanding of how best to apply this technology has advanced significantly and almost every week new publications appear showcasing its application in basic and translational research.
While CRISPR-Cas9 is applicable across many different cell types, we have found it particularly suited for genome editing in near-haploid human cell lines. This has allowed us to establish a robust pipeline for the inactivation of non-essential genes at unprecedented scale and efficiency.
We have now knocked out over 1500 human genes and have generated a resource that is, to the best of our knowledge, the largest collection of human knockout cell lines available, covering comprehensive subsets of genes clustered by biological pathway (e.g. the autophagy pathway, the JAK/STAT pathway) or by phylogenetic relationship (e.g. kinases, bromodomain-containing proteins).
In this talk we will discuss how, through more than 1500 genome editing experiments, we have started to unravel some of the general principles governing the use of CRISPR-Cas9 in mammalian cells. For example, we have analyzed the impact of variation in the guide RNA sequence on Cas9 cleavage efficiency and characterized the mutational signature arising from CRISPR-Cas9 cleavage.
We will also highlight (with examples) how these learnings are now being applied to introduce other genomic modifications in a high throughput manner, including chromosomal deletions, translocations, point mutations and endogenous gene tags.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9
This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
GENESIS™: Comprehensive genome editing - Translating genetic information into personalised medicines.
Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined. Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project
The CRISPR/Cas9 system has emerged as one of the leading tools for modifying genomes of organisms ranging from E. coli to humans. Additionally, the simple gene targeting mechanism of CRISPR technology has been modified and adapted to other applications that include gene regulation, detection of intercellular trafficking, and pathogen detection. With a wealth of methods for introducing Cas9 and gRNAs into cells, it can be challenging to decide where to start. In this presentation, Dr Adam Clore describes the CRISPR mechanism and some of the most prominent uses for CRISPR, along with methods where IDT technologies can assist scientists in designing, testing, and executing a variety of CRISPR-mediated experiments. For more informaton, visit: http://www.idtdna.com/crispr
Introduction and key considerations around gene-editing using CRISPR and rAAV.
With an overview of our knock-out library using the haploid cell line HAP1
Have you considered that protein over-expression or inefficient mRNA knockdown may be masking physiological effects in your assays? Increasingly scientists are moving to endogenous gene-editing to characterise the function of their genes of interest.
Dr Chris Thorne from Cambridge Biotech Horizon Discovery discusses the ground breaking gene-editing technology CRISPR. The simplicity of experimental design has led to rapid adoption of the technology across the scientific community. However, challenges remain.
This Slidedeck focuses specifically on implementing CRISPR experiments, and explore a number of key considerations crucial to maximising chances of targeting success, whether your goal is to generate a knock-out or a knock-in. Chris also takes a look at some of the alternative uses of CRISPR, including sgRNA genome wide synthetic lethality screens.
The slides aim to support those researchers either planning to or already using CRISPR gene-editing in their lab. Horizon Discovery have also recently launched a program aimed specifically at academic cell biologists to promote the adoption of CRISPR by offering FREE CRISPR Reagents for knock-out cell line generation - more information available here. http://www.horizondiscovery.com/what-we-do/discovery-toolbox/genassist-crispr--raav-genome-editing-tools
Recent advances in CRISPR-CAS9 technology: an alternative to transgenic breedingJyoti Prakash Sahoo
These are the part of the Bacterial immune system which detects and recognize the foreign DNA and cleaves it.
THE CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) loci
Cas (CRISPR- associated) proteins can target and cleave invading DNA in a sequence – specific manner.
CRISPR array is composed of a series of repeats interspaced by spacer sequences acquired from invading genomes.
GRC Workshop at Churchill College on Sep 21, 2014. This is Paul Kitt's talk describing the NCBI approach to annotation the full human reference assembly.
CRISPR system is very simple, consisted of a Cas9 protein and a single guided RNA. With the guidance of sgRNA, Cas9 could cause a double stranded breaks in the target site.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
Targeted Breeding Applications of CRISPR-CasKate Barlow
Doane Chilcoat, Director, Applied Technology Systems, DuPont Pioneer
CRISPR-Cas as an advanced plant breeding tool is a more efficient way to improve plants and help farmers produce more and better food, with fewer resources. The superior properties of CRISPR-Cas allows DuPont Pioneer scientists to develop innovative and sustainable seed products for growers similar to those realized through conventional plant breeding, but with even greater efficiency, accuracy and quality. Pioneer is leading the application of this tool to develop customized agriculture solutions. In this talk, potential product targets of this promising technology will be discussed. Approaches to fostering social license and developing an open innovation model for CRISPR-Cas will also be reviewed.
The CRISPR/Cas9 system has emerged as one of the leading tools for modifying genomes of organisms ranging from E. coli to humans. Additionally, the simple gene targeting mechanism of CRISPR technology has been modified and adapted to other applications that include gene regulation, detection of intercellular trafficking, and pathogen detection. With a wealth of methods for introducing Cas9 and gRNAs into cells, it can be challenging to decide where to start. In this presentation, Dr Adam Clore describes the CRISPR mechanism and some of the most prominent uses for CRISPR, along with methods where IDT technologies can assist scientists in designing, testing, and executing a variety of CRISPR-mediated experiments. For more informaton, visit: http://www.idtdna.com/crispr
Introduction and key considerations around gene-editing using CRISPR and rAAV.
With an overview of our knock-out library using the haploid cell line HAP1
Have you considered that protein over-expression or inefficient mRNA knockdown may be masking physiological effects in your assays? Increasingly scientists are moving to endogenous gene-editing to characterise the function of their genes of interest.
Dr Chris Thorne from Cambridge Biotech Horizon Discovery discusses the ground breaking gene-editing technology CRISPR. The simplicity of experimental design has led to rapid adoption of the technology across the scientific community. However, challenges remain.
This Slidedeck focuses specifically on implementing CRISPR experiments, and explore a number of key considerations crucial to maximising chances of targeting success, whether your goal is to generate a knock-out or a knock-in. Chris also takes a look at some of the alternative uses of CRISPR, including sgRNA genome wide synthetic lethality screens.
The slides aim to support those researchers either planning to or already using CRISPR gene-editing in their lab. Horizon Discovery have also recently launched a program aimed specifically at academic cell biologists to promote the adoption of CRISPR by offering FREE CRISPR Reagents for knock-out cell line generation - more information available here. http://www.horizondiscovery.com/what-we-do/discovery-toolbox/genassist-crispr--raav-genome-editing-tools
Recent advances in CRISPR-CAS9 technology: an alternative to transgenic breedingJyoti Prakash Sahoo
These are the part of the Bacterial immune system which detects and recognize the foreign DNA and cleaves it.
THE CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) loci
Cas (CRISPR- associated) proteins can target and cleave invading DNA in a sequence – specific manner.
CRISPR array is composed of a series of repeats interspaced by spacer sequences acquired from invading genomes.
GRC Workshop at Churchill College on Sep 21, 2014. This is Paul Kitt's talk describing the NCBI approach to annotation the full human reference assembly.
CRISPR system is very simple, consisted of a Cas9 protein and a single guided RNA. With the guidance of sgRNA, Cas9 could cause a double stranded breaks in the target site.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
Targeted Breeding Applications of CRISPR-CasKate Barlow
Doane Chilcoat, Director, Applied Technology Systems, DuPont Pioneer
CRISPR-Cas as an advanced plant breeding tool is a more efficient way to improve plants and help farmers produce more and better food, with fewer resources. The superior properties of CRISPR-Cas allows DuPont Pioneer scientists to develop innovative and sustainable seed products for growers similar to those realized through conventional plant breeding, but with even greater efficiency, accuracy and quality. Pioneer is leading the application of this tool to develop customized agriculture solutions. In this talk, potential product targets of this promising technology will be discussed. Approaches to fostering social license and developing an open innovation model for CRISPR-Cas will also be reviewed.
Genomic engineering in cell lines is a versatile tool for studying gene function, designing diseases models, biopharmaceutical research, drug discovery and many other applications. CRISPR (Clustered Regulatory Interspaced Short Palindromic Repeats)/Cas9 systems is a newly developed yet the most popular method for genome editing. It has been widely used in current biology, functional genome screening, cell-based human hereditary disease modeling, epigenomic studies and visualization of cellular processes.
The simplicity and high-efficiency of CRISPR/Cas9 system make it a preferable genomic knockout method to the traditional ZFN and TALEN system.
https://www.creative-biogene.com/Services/Stable-cell-line-generation/Custom-Genome-Editing-Cell-Lines.html
Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...Thermo Fisher Scientific
Reprogramming permits the derivation of hiPSCs from diseased patients, and allows us to model diseases in vitro. Furthermore, with the advent of CRISPR mediated genome editing, we can now mimic disease mutations in control hiPSC lines to study the biological effect of just those mutations. hiPSCs can then be differentiated into specified cell types such as neurons which can be used to develop assays for drug safety screening or can be used to model disease phenotypes in a dish to discover new drugs.
Speaker: Benedict C. S. Cross, PhD, Team leader (Discovery Screening), Horizon Discovery
CRISPR–Cas9 mediated genome editing provides a highly efficient way to probe gene function. Using this technology, thousands of genes can be knocked out and their function assessed in a single experiment. We have conducted over 150 of these complex and powerful screens and will use our experience to guide you through the process of screen design, performance and analysis.
We'll be discussing:
• How to use CRISPR screening for target ID and validation, understanding drug MOA and patient stratification
• The screen design, quality control and how to evaluate success of your screening program
• Horizon’s latest developments to the platform
• Horizon’s novel approaches to target validation screening
Applied StemCell Inc’s MAPK genomic DNA (gDNA) reference standards represent biologically-relevant controls that can be directly incorporated into your sample processing workflows in order to optimize your protocols, evaluate assay sensitivity and specificity, and analyze the impact of workflow changes on downstream analysis. They represent ideal materials for both assay development and routine monitoring of assay performance.
The MAPK Genomic DNA Reference Standards are extracted from ASC’s panel of isogenic MAPK mutation cell lines with 50 recurrent pathway-activating mutations in the EGFR, KRAS and BRAF genes, based on data from the Sanger Institute’s COSMIC database.
Key Features of the MAPK Series gDNA Reference Standards:
Most comprehensive MAPK mutation panel on the market
Well-characterized colorectal cancer cells lines: EGFR (RKO), KRAS (RKO), BRAF (HCT116)
Paired, isogenic wild-type cell lines to serve as an ideal control
Footprint-free, homozygous mutations
Reference cell lines are expanded from single-cells, ensuring maximum homogeneity
Available in multiple formats, including slides, scrolls, and full FFPE blocks
Why Use Reference Materials (DNA: Reference standadrds provide a consistent and reliable resource for evaluating and optimizing various stages in your sample processing workflow. Whether you’re starting from DNA extraction, assay design, or library preparation, our reference materials can help you to identify and eliminate sources of variability within your protocols.
@AppliedStemCell offers validated, cellular reference standards for direct incorporation into sample processing workflows or quality control processes.
Highlights:
Overview of molecular reference materials
Workflow and QC for ONCOREF™ cell line generation (#CRISPR)
Advantages of CRISPR-engineered molecular reference standards
Applications of reference materials in assay development
Q & A
#sangersequencing #ngs
NSA Diagnostic Laboratory has been operating since 1958, founded by Prof. Nasseh Amin. NSA is considered as one of the most advanced labs in Egypt. Maintaining personalized services for its stakeholders, as well as the main role of the lab "Diagnosis"
NSA Diagnostic Laboratory operates through two different segments.
Firstly, a group of stand-alone labs located at prime locations all over Egypt, with the latest and up to date equipments.
Secondly, being the backbone of well reputed hospitals and some polyclinics where NSA is the lab that is responsible for all medical testing there, serving all our patients with class A quality.
Our main focus is delivering quality care and with Cost-value return. NSA plays a key role in improving the health of many Egyptians, by providing access to quality service for more than 200,000 patients annually.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
DERIVATION OF MODIFIED BERNOULLI EQUATION WITH VISCOUS EFFECTS AND TERMINAL V...Wasswaderrick3
In this book, we use conservation of energy techniques on a fluid element to derive the Modified Bernoulli equation of flow with viscous or friction effects. We derive the general equation of flow/ velocity and then from this we derive the Pouiselle flow equation, the transition flow equation and the turbulent flow equation. In the situations where there are no viscous effects , the equation reduces to the Bernoulli equation. From experimental results, we are able to include other terms in the Bernoulli equation. We also look at cases where pressure gradients exist. We use the Modified Bernoulli equation to derive equations of flow rate for pipes of different cross sectional areas connected together. We also extend our techniques of energy conservation to a sphere falling in a viscous medium under the effect of gravity. We demonstrate Stokes equation of terminal velocity and turbulent flow equation. We look at a way of calculating the time taken for a body to fall in a viscous medium. We also look at the general equation of terminal velocity.
Nucleophilic Addition of carbonyl compounds.pptxSSR02
Nucleophilic addition is the most important reaction of carbonyls. Not just aldehydes and ketones, but also carboxylic acid derivatives in general.
Carbonyls undergo addition reactions with a large range of nucleophiles.
Comparing the relative basicity of the nucleophile and the product is extremely helpful in determining how reversible the addition reaction is. Reactions with Grignards and hydrides are irreversible. Reactions with weak bases like halides and carboxylates generally don’t happen.
Electronic effects (inductive effects, electron donation) have a large impact on reactivity.
Large groups adjacent to the carbonyl will slow the rate of reaction.
Neutral nucleophiles can also add to carbonyls, although their additions are generally slower and more reversible. Acid catalysis is sometimes employed to increase the rate of addition.
BREEDING METHODS FOR DISEASE RESISTANCE.pptxRASHMI M G
Plant breeding for disease resistance is a strategy to reduce crop losses caused by disease. Plants have an innate immune system that allows them to recognize pathogens and provide resistance. However, breeding for long-lasting resistance often involves combining multiple resistance genes
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...Travis Hills MN
Travis Hills of Minnesota developed a method to convert waste into high-value dry fertilizer, significantly enriching soil quality. By providing farmers with a valuable resource derived from waste, Travis Hills helps enhance farm profitability while promoting environmental stewardship. Travis Hills' sustainable practices lead to cost savings and increased revenue for farmers by improving resource efficiency and reducing waste.
Phenomics assisted breeding in crop improvementIshaGoswami9
As the population is increasing and will reach about 9 billion upto 2050. Also due to climate change, it is difficult to meet the food requirement of such a large population. Facing the challenges presented by resource shortages, climate
change, and increasing global population, crop yield and quality need to be improved in a sustainable way over the coming decades. Genetic improvement by breeding is the best way to increase crop productivity. With the rapid progression of functional
genomics, an increasing number of crop genomes have been sequenced and dozens of genes influencing key agronomic traits have been identified. However, current genome sequence information has not been adequately exploited for understanding
the complex characteristics of multiple gene, owing to a lack of crop phenotypic data. Efficient, automatic, and accurate technologies and platforms that can capture phenotypic data that can
be linked to genomics information for crop improvement at all growth stages have become as important as genotyping. Thus,
high-throughput phenotyping has become the major bottleneck restricting crop breeding. Plant phenomics has been defined as the high-throughput, accurate acquisition and analysis of multi-dimensional phenotypes
during crop growing stages at the organism level, including the cell, tissue, organ, individual plant, plot, and field levels. With the rapid development of novel sensors, imaging technology,
and analysis methods, numerous infrastructure platforms have been developed for phenotyping.
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...University of Maribor
Slides from:
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Track: Artificial Intelligence
https://www.etran.rs/2024/en/home-english/
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
ANAMOLOUS SECONDARY GROWTH IN DICOT ROOTS.pptxRASHMI M G
Abnormal or anomalous secondary growth in plants. It defines secondary growth as an increase in plant girth due to vascular cambium or cork cambium. Anomalous secondary growth does not follow the normal pattern of a single vascular cambium producing xylem internally and phloem externally.
3. 3
The Opportunity: Genome Editing
Genome editing is the most robust and biologically relevant method for
studying how genes and mutations function in driving disease
4. 4
CRISPR mediated genome editing
Exon 1 Exon 2 Exon 3
Exon Exon 2 Exon 31
CRISPR-induced
DNA double-strand break
Non-homologous
end joining
Exon 1
Homology-directed repair
Exon 2
Exon 2Exon 2Exon 1
Frameshift mutation
Exon 1
Most frequently CRISPR-Cas9 is used to make either knockouts (via NHEJ
mediated gene disruption) or knockins (via HDR)
5. 5
Cell Line
Gene Target
Guide Choice
Guide Position
Donor Design
Screening
Validation
The Key Considerations For CRISPR Gene Editing
Is it suitable?
Is it essential/expressed/amplified?
Specificity vs Efficiency
Will depend on modification
Donor design to maximise efficiency
How many clones to find a positive?
Is my engineering as expected?
6. 6
The Challenge? Polyploid cells…
e.g. Disruption of the MAPK3 gene in the A375 cell line (copy number = 3)
1
2
3
Validation of frameshift disruptions in polyploid cells is a significant bottleneck
7. 7
Kotecki et al. (1999) in Exp Cell Res
Carette et al. (2009) in Science
KBM-7 is a human cell line that is haploid for all
chromosomes but chromosome 8.
Thijn Brummelkamp
NKI/CeMM
The Solution? Haploid cells...
8. 8
Genotyping analysis in haploid cells
Exon 1 Exon 2 Exon 3
PCR with
custom primers
Sanger sequencing
of PCR product
Mutation masked
by second copy
Mutation leads
to knockout
Diploid Haploid
Both editing and validation is more efficient in haploid cells
9. 9
(Near-) Haploid Human Cell Lines
KBM-7
Near-haploid (diploid chr8, chr15)
Isolated from CML patient
Myeloid lineage
Suspension cells
HAP1
Near-haploid (chr15)
Derived from KBM-7
Fibroblast like
Adherent cells
eHAP
Fully haploid
Derived from HAP1
Patent EP 13194940.6
10. 10
Haploid
High efficiency
Unambiguous genotyping
Diploid
Defined copy number
Knockouts
Diploid/haploid: >2fold
Defined mutations
Diploid/haploid: >10fold
Knowledge base
RNA sequencing
Predict suitability
as cellular model
Essentiality dataset
Predict success rate
for knockouts
Advantages of haploid cells for genome editing
18. 18
Hap1 Gene Targeting – what we‘ve learned
CRISPR/Cas9 is highly efficient
Mutations cluster at PAM -3
Deletions are favored over insertions
Off-target editing represents a minor issue
19. 19
So what can we do?
Exon 8 Exon 9 NanoLuc polyA
Exon 1 Exon 3
Translocations and Fusions
Gene tagging
Chromosomal deletions
Chr 1 Chr 19
Point mutations
Exon 8 Exon 9
*
24. 24
Deletion of chr15 fragment is detectable by PCR
400 clones screened
5 positive clones identified
~1% targeting efficiency
Essletzbichler et al Genome Research 2014
25. 25
Single cell clones that carry the deletion can be isolated
SKY staining of clone E9
28. 28
PCR screening identifies two clones with CD74-ROS1 fusion
CD74-ROS1
ROS1-CD74
A10
E4
E4
A10
~1% Clones Tested
are positive for
fusion
29. 29
Validation of both DNA and RNA
Analysis of CD74-ROS1 break point in chr6 of genomic DNA
CTTACGCATACTGCTGACAGTTAAATTTAGTTGAAG-GCCTGGGGCCTCAGTTTCTGCATCAGATTCATAGAA
CTTACGCATACTGCTGACAGTTAAATTTAGTTGAAG-GCCTGGGGCCTCAGTTTCTGCATCAGATTCATAGAA
CTTACGCATACTGCTGACAGTTAAATTTAGTTGAAGTGCCTGGGGCCTCAGTTTCTGCATCAGATTCATAGAA
Predicted
1C2
1G13
ROS1 CD74
CCTGAAGTAGAAGGTCAAAGGGCCACCCTCACAGGCTGGATTACTTAATCCCTCTCTGAAATACCCACAAT
CCTGAAGTAGAAGGTCAAAGGGCCACCCTCACAGGCTGGATTACTTAATCCCTCTCTGAAATACCCACAAT
CCTGAAGTAGAAGGTCAAAGGGCCACCCTC------TGGATTACTTAATCCCTCTCTGAAATACCCACAAT
Predicted
1C2
1G13
CD74 ROS1
CD74-ROS1 ROS1-CD74 CD74 ROS1
CD74 exon 6 ROS1 exon 34
Analysis of expression of CD74-ROS1 fusion transcript
30. 30
So where next?
Exon 8 Exon 9 NanoLuc polyA
Exon 1 Exon 3
Translocations and Fusions
Gene tagging
Chromosomal deletions
Chr 1 Chr 19
Point mutations
Exon 8 Exon 9
*
31. 31
Gene Tagging - The conventional approach
Gene tagging by homology-directed repair
Exon 7 Exon 8 Exon 9
polyANanoLuc
Exon 7 Exon 8 Exon 9
Homology-directed
repair
polyANanoLuc
Exon 9
Genome
Homology donor
Two major shortcomings:
a. Low overall efficiency
b. Requires the synthesis of gene-specific donor templates
32. 32
Gene tagging by non-homologous end joining
Developed further by Thijn Brummelkamp (NKI) and Daniel Lackner (Horizon)
33. 33
Gene tagging by non-homologous end joining
Based on generic donor cassettes flanked by tia11 guide RNA recognition sites
polyANanoLuc tia11tia11
tia11 gRNAU6
Cas9
34. 34
Gene tagging by non-homologous end joining
Based on generic donor cassettes flanked by tia11 guide RNA recognition sites
Exon 7 Exon 8 Exon 9 polyANanoLuctia11
Exon 7 Exon 8 Exon 9
Generic donor cassettes
Non-homologous end
joining (imprecise)
polyANanoLuc
tia11
35. 35
Genotyping on pools of cells after transfection
gRNA
2655
---
2656
---
2657
2658
---
2659
2660
2661
---
2662
---
---
2663
2665
2664
2666
2667
---
669
---
ID1 MX2 IRF9 STAT1 TAP2 CCL2 IL9
13 out of 14 pools show integration of reporter cassette in right orientation
Exon 9 polyANanoLuc
37. 37
Sequencing of individual clones
>2655-13 AACCCCCGGGGGCCGAGGGCTGCCGGTCTCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>2655-17 AACCCCCGGGGGCCGAGGGCTGCCGGTCTCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>2656-07 CCGGTCCGGGCTCCGCTCAGCACCCTCATCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>2656-10 CCGGTCCGGGCTCCGCTCAGCACCCTCATCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>2656-11 CCGGTCCGGGCTCCGCTCAGCACCCTCATCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>2656-15 CCGGTCCGGGCTCCGCTCAGCACCCTCATCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>669-14 CTGACCCAACCACAAATGCCAGCCTGCTTCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>2659-08 CAGATGGAGCAGGCCTTTGCCCGATACTTCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>2666-10 CAGAAGTGGGTTCAGGATTCCATGGACCTCCAGGGGCAGCGGATCCATGGTCTTCACACTC
>669-24 ACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGCAGCGGATCCATGGTCTTCACACTC
>669-12 ACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGCAGCGGATCCATGGTCTTCACACTC
>2656-24 CGGTCCGGGCTCCGCTCAGCACCCTCAATCCAGGGGCAGCGGATCCATGGTCTTCACACTC
Genomic Sequence Cassette Sequence
Precise cleavage
Ligation
No indels
Imprecise cleavage
Ligation
Indels
Insertion is much more precise than originally predicted
38. 38
Assessing off-target integration of reporter cassette
HAP1 NanoLuc cell lines contain single integration events (as assessed by droplet digital PCR)
Hap1
ID1-NanoLuc
HAP2
DACT1-NanoLuc
HCT116
HK2-NanoLuc
HAP1
wt
NanoLuc copy number:
39. 39
A DACT1-NanoLuc reporter line
DACT1 expression is up-regulated in response to stimulation with Activin A
0
500
1000
1500
2000
0
2000
4000
6000
8000
10000
Relativeluninescence
DACT1-NanoLuc levels
Relativeluninescence
Activin A
(ng/ml)
0 10 10050 0 10 10050
4 h stimulation 24 h stimulation
Daniel Lackner
40. 40
The combination of CRISPR and a
haploid background lends itself to
both simple and complex genomic
modifications
Modification Targeting Efficiency in Hap1
Knockout >40%
Point Mutation ~8%
Chromosomal Deletion ~1%
Chromosomal Translocation ~1%
NHEJ Ligation Gene Tagging Up to 21%
41. 41
So lets wrap up!
Yes, CRISPR-Cas9 genome editing can be…
Easy to design
Efficient
Widely applicable
Flexible
…so how can Horizon help?
But…
× Not every cell line is easy to target
× Not every guide is active
× Genome editing is labour intensive
and will not always be successful
42. 42
Already available…
• Knockouts for >1,500 human genes
• Verified by Sanger sequencing
• Two independent clones per gene available
• Can be supplied with gRNA used in generation
• Supplied with wild type control line
$990 per cell line (Academic pricing)
How can Horizon advance your research?
43. 43
How can Horizon advance your research?
Haploid Genome Editing On Demand
• Hap1 cell line background
• Rapid, cost effective knockouts and
genomic deletions
• Custom modifications also available
(knockins, translocations, tags)
Custom Cell Line Engineering Service
• Your cell line
• Your choice of modification
• Fully custom service
iPSC Gene Editing Service
• Knockouts, knockins, mutation
corrections
• You supply the iPSCs
• Custom modifications in 12-18 weeks
In vivo Genome Editing
• Many mice and rat knockout models
already available
• Microinjection ready guide RNAs
• Custom in vivo genome editing service
also available
44. Your Horizon Contact:
t + 44 (0)1223 655580
f + 44 (0)1223 655581
e info@horizondiscovery.com
w www.horizondiscovery.com
Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Your Horizon Contact:
t + 44 (0)1223 655580
f + 44 (0)1223 655581
e info@horizondiscovery.com
w www.horizondiscovery.com
Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Chris Thorne, PhD
Commercial Marketing Manager
c.thorne@horizondiscovery.com
+44 1223 204 799
Follow me on LinkedIn: cmcthorne
Editor's Notes
Pleasure to be here to today to tell you more about Horizon and our suite of technologies based around a core expertise in human genome editing and how we are applying this to better understand the human genome, find new validated targets and support targeted drug discovery with predictive, genetically-defined, in vitro models that accurately represent target patient groups.
Generally speaking when targeting genes of interest two DNA repair pathways are used to mediate the majority of genomic modifications we want to make.
The first of these is NHEJ
HR
For
Key to this approach is confirming that a frameshift mutation has been introduced into all copies of the gene presence. In diploid or polyploid cells this requires subcloning of the PCR products such that they can be sequenced individually.
Here is an example of a MAPK3 knockout in A375 cells which contain threee copies of the gene – and where we have different frameshift mutations in each allele.
This need to deconvolute and verify creates a labour intensive bottleneck for cells with multiple alleles
10 guide RNAs, one clone each
On-target site contains frameshift mutation
Off-target sites:
Amplify 10 closest off-target sites in each clone by PCR
Submit to Sanger sequencing
CRISPR/Cas is revolutionizing biological research
Small RNA (20bp) allows the targeting of Cas9 endonuclease to any locus in the human genome (followed by PAM motif: NGG)
Double-strand break inflicted by Cas9 is repaired by NHEJ
NHEJ gives rise to frameshift mutations