SlideShare a Scribd company logo
1 of 87
Unearthing the Roots of Venice:From Relics to DNA Debora Afezolli Benjamin M. Allen Jaclyn Hepworth Andrew J. Kazanovicz
Ancient Documents Archaeology Genetic Genealogy
  Archaeologist 2 To be filled for every object/layer ~100 per intervento   Archaeological  potential map  Cross-reference     Searchable Scheda statua  Scheda sito  Scheda tomba Scheda inorganico   Index forms Scheda organico  Scheda unita stratigrafica (US)  Manually created Schede  Soprintendenza Archeologica Foto  Manually submitted    Archaeologist 1 Disegni 
ArchEasy: A Solution Web-based management system for the archival, geo-referencing, and interpretation of archaeology in Venice  Form management Database search Automatic indexing Interpretative maps Initial prototype system design
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation  Index forms ArchEasy database Schede   Electronically uploaded Foto  Disegni 
Forms Paper US form ArchEasy electronic US form
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation   Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Old paper index US form ArchEasy electronic index US form Indexing
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted     Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Traditional Search Manually searched Old searching methods to find desired data ,[object Object]
Ineffective
Difficult to cross-reference,[object Object]
Mapping Data View the Map
   Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Archaeological Potential Lower potential of archaeological find Higher potential of archaeological find Broad representation of archaeological potential
Public works official Archaeological Potential View all objects on map Consults map Relics near Via Barovier are found every 15m High likelihood of more of these objects, so budget accordingly Application to public works
   Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Object Correlation ArchEasy Correlates data Similar elevation, also 13th Century Brick floor Found: 1.5m beneath Origins: 13th Century  Brick floor Found: 1.5m beneath Origins: ??  Correlational ability of ArchEasy
The Future: Autonomous Agent Approach I have a similar floor pattern, therefore I could also be a 15th century church My brick size is 14x12x7 cm I’m a 15th century church with herringbone floors My brick size is 22x15x9 cm, and I am 100 years old I could also be 100 years old I have the same type of floor, oriented in the same direction My brick size is 22x15x9 cm Self-correlating autonomous agent approach
Results ,[object Object],Introducing ArchEasy… ,[object Object]
Easy completion of administrative form requirements
Archaeological potential maps
Complete customization and control of workspace
Effective search function to enable cross-referencing,[object Object]
Venice State Archive Unbroken documentary history 90km of shelves Painstaking to access and utilize the documents
Current Process at the Venice State Archive Publications Archive Scholar 1 Pages Transcriptions Santa Maria della Salute Manuscripts Retrieves Searches Deliver to  90km of Shelves Request Information Choose
Current Process at the Venice State Archive Publications Archive Scholar 2 Duplicate Transcriptions Pages SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
Current Process at the Venice State Archive Publications Archive Scholar 3 TriplicateTranscriptions Pages SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
Transcriptions are not shared! Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions     SHARING
uScript: A Solution Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions SHARING
Contribution Accountant uScript’s Components 3 Components Archive Assistant Transcription Assistant Archive Assistant Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 uScript: An Overview Archive Assistant Santa Maria della Salute Search
uScript Scholar 1 Scholar 3 Scholar 2 Manuscripts Archive Assistant
I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini Marie Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini n no nos nost nostr nostri nostri Marie Transcription Assistant
M Ma Mar Mary Mary Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
Marie Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Manuscripts Archive Assistant Contribution Accountant
The Components Contribution Accountant Archive Assistant Transcription Assistant Archive Assistant Contribution Accountant Search Manuscripts and Transcriptions  Rate Contributors and Transcriptions Transcription Database Promotes Accuracy  Learn Handwriting  Automatic Transcriptions Automatic Boxing
Transcriptions Transcriptions Transcriptions Transcriptions Nothing goes to waste! uScript
Recent Effort Promotional Website: show and explain everything that is uScript
Contribution to Origins Theory Origins of Venetians Unearth  Theory Evidence Validates Theory Research Theory Evidence
Venetian Origins Theories Lusatia ? Brittany ? Paphlagonia ?
Paphlagonian Theory
Paphlagonian Theory
Paphlagonian Theory Livy – Aburbe condita 1st Century B.C.E. “Antenor sailed into the furthest part of the Adriatic, accompanied by a number of Enetians…and the name was extended to the surrounding district; the whole nation were called Veneti”
Paphlagonian Theory Homer – The Illiad 8th Century B.C.E. “The Paphlagonianswere commanded by a stout-hearted Pylaemenes from Enetae…”
Brittany Theory
Brittany Theory
Brittany Theory Strabo – Ancient Greek Historian  1st Century A.C.E. Claim that ancestors of Veneto are not the Enetae of Paphlagoniabut the Veneti of Gaul
Lusatia Theory
Lusatia Theory
Lusatia Theory Salvi – Veneti: First Builders of European Community 1984 A.C.E. Developed VeneticTheory claiming most current day European populations are descendants of the Veneti of Lusatia
? ? ?
? ? ?
Confirming Theories ? ? ?
Genographic Project Collaboration
Genographic Project Collaboration
Genographic Project Collaboration
Genographic Project Collaboration 300
Genographic Requirements Males At least 18 years old From Northeast Italy (specifically Veneto)
Veneto Barcelona
163
DNA Extraction
Y-Chromosomal DNA Y-chromosome
Y-Chromosomal DNA Coding DNA (genes) Y-chromosome
Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Y-chromosome
Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Loci  - 12 locations of interest Y-chromosome
Y-Chromosomal DNA ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA 4 complementary nucleotides A,T,C, and G ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA 4 CATA repetitions = 4 STRs Y-chromosome
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA PaphlagoniaATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA Paphlagonia 	ATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA Paphlagonia 	ATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) Paphlagonia 	ATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) PaphlagoniaATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) PaphlagoniaATCACATACATACATACATAGCA                                                (4 STRs) Lusatia               	GCTGACCATACTGAACGATATC                                                (1 STRs) Brittany    		GCTAACGAATGTCAAGCTAATA (0 STRs)
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) PaphlagoniaATCACATACATACATACATAGCA                                                (4 STRs) Lusatia               	GCTGACCATACTGAACGATATC                                                (1 STRs) Brittany    		GCTAACGAATGTCAAGCTAATA (0 STRs)   

More Related Content

Similar to Origins Final Presentation

Final Presentation_B10_Origins
Final Presentation_B10_OriginsFinal Presentation_B10_Origins
Final Presentation_B10_Originsvenice2point0
 
Pelagios OU Open Access Week 2015
Pelagios OU Open Access Week 2015Pelagios OU Open Access Week 2015
Pelagios OU Open Access Week 2015IzzyChad
 
Pelagios at KCL, June 2015
Pelagios at KCL, June 2015Pelagios at KCL, June 2015
Pelagios at KCL, June 2015PelagiosNetwork
 
Encyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdf
Encyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdfEncyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdf
Encyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdfAndrsHernndezGarca3
 
Research Paper On The Parthenon
Research Paper On The ParthenonResearch Paper On The Parthenon
Research Paper On The ParthenonDani Cox
 
The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...
The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...
The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...Martin Kalfatovic
 
B9 raines venice_timemachine_minimized
B9 raines venice_timemachine_minimizedB9 raines venice_timemachine_minimized
B9 raines venice_timemachine_minimizedevaminerva
 
B9 raines venice_timemachine
B9 raines venice_timemachineB9 raines venice_timemachine
B9 raines venice_timemachineevaminerva
 

Similar to Origins Final Presentation (8)

Final Presentation_B10_Origins
Final Presentation_B10_OriginsFinal Presentation_B10_Origins
Final Presentation_B10_Origins
 
Pelagios OU Open Access Week 2015
Pelagios OU Open Access Week 2015Pelagios OU Open Access Week 2015
Pelagios OU Open Access Week 2015
 
Pelagios at KCL, June 2015
Pelagios at KCL, June 2015Pelagios at KCL, June 2015
Pelagios at KCL, June 2015
 
Encyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdf
Encyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdfEncyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdf
Encyclopedia.of.Archaeology.History.and.Discoveries.eBook-EEn.pdf
 
Research Paper On The Parthenon
Research Paper On The ParthenonResearch Paper On The Parthenon
Research Paper On The Parthenon
 
The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...
The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...
The Shoulders of Giants: Leveraging Existing Technologies for the Digital Pub...
 
B9 raines venice_timemachine_minimized
B9 raines venice_timemachine_minimizedB9 raines venice_timemachine_minimized
B9 raines venice_timemachine_minimized
 
B9 raines venice_timemachine
B9 raines venice_timemachineB9 raines venice_timemachine
B9 raines venice_timemachine
 

More from venice2point0

Ve11 super final presentation
Ve11 super final presentationVe11 super final presentation
Ve11 super final presentationvenice2point0
 
An Update on Canal Hydrodynamics
An Update on Canal HydrodynamicsAn Update on Canal Hydrodynamics
An Update on Canal Hydrodynamicsvenice2point0
 
Ve11 mobility presentation_part2
Ve11 mobility presentation_part2Ve11 mobility presentation_part2
Ve11 mobility presentation_part2venice2point0
 
Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1venice2point0
 
Final Presentation - Material Culture B11
Final Presentation - Material Culture B11Final Presentation - Material Culture B11
Final Presentation - Material Culture B11venice2point0
 
Bien B '11 Final Presentation EN
Bien B '11  Final Presentation ENBien B '11  Final Presentation EN
Bien B '11 Final Presentation ENvenice2point0
 
Mobility_B11_Presentation_EN
Mobility_B11_Presentation_ENMobility_B11_Presentation_EN
Mobility_B11_Presentation_ENvenice2point0
 
Final presentation b10_shops
Final presentation b10_shopsFinal presentation b10_shops
Final presentation b10_shopsvenice2point0
 
PreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material CulturePreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material Culturevenice2point0
 
Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation venice2point0
 
Cruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of VeniceCruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of Venicevenice2point0
 
Return to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian CanalsReturn to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian Canalsvenice2point0
 
Presentation final no_wifi_venipedia
Presentation final no_wifi_venipediaPresentation final no_wifi_venipedia
Presentation final no_wifi_venipediavenice2point0
 
Presentation final b10_venipedia
Presentation final b10_venipediaPresentation final b10_venipedia
Presentation final b10_venipediavenice2point0
 
Mobility B09 (Italian)
Mobility B09 (Italian)Mobility B09 (Italian)
Mobility B09 (Italian)venice2point0
 
B09 Origins Archaeological Process
B09 Origins Archaeological ProcessB09 Origins Archaeological Process
B09 Origins Archaeological Processvenice2point0
 
PublicEarthPresentationB09
PublicEarthPresentationB09PublicEarthPresentationB09
PublicEarthPresentationB09venice2point0
 
Final Presentation English B09 Veninomics
Final Presentation English B09 VeninomicsFinal Presentation English B09 Veninomics
Final Presentation English B09 Veninomicsvenice2point0
 
Final Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing VeniceFinal Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing Venicevenice2point0
 
Final Presentation Italian B09 Ships
Final Presentation Italian B09 ShipsFinal Presentation Italian B09 Ships
Final Presentation Italian B09 Shipsvenice2point0
 

More from venice2point0 (20)

Ve11 super final presentation
Ve11 super final presentationVe11 super final presentation
Ve11 super final presentation
 
An Update on Canal Hydrodynamics
An Update on Canal HydrodynamicsAn Update on Canal Hydrodynamics
An Update on Canal Hydrodynamics
 
Ve11 mobility presentation_part2
Ve11 mobility presentation_part2Ve11 mobility presentation_part2
Ve11 mobility presentation_part2
 
Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1
 
Final Presentation - Material Culture B11
Final Presentation - Material Culture B11Final Presentation - Material Culture B11
Final Presentation - Material Culture B11
 
Bien B '11 Final Presentation EN
Bien B '11  Final Presentation ENBien B '11  Final Presentation EN
Bien B '11 Final Presentation EN
 
Mobility_B11_Presentation_EN
Mobility_B11_Presentation_ENMobility_B11_Presentation_EN
Mobility_B11_Presentation_EN
 
Final presentation b10_shops
Final presentation b10_shopsFinal presentation b10_shops
Final presentation b10_shops
 
PreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material CulturePreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material Culture
 
Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation
 
Cruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of VeniceCruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of Venice
 
Return to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian CanalsReturn to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian Canals
 
Presentation final no_wifi_venipedia
Presentation final no_wifi_venipediaPresentation final no_wifi_venipedia
Presentation final no_wifi_venipedia
 
Presentation final b10_venipedia
Presentation final b10_venipediaPresentation final b10_venipedia
Presentation final b10_venipedia
 
Mobility B09 (Italian)
Mobility B09 (Italian)Mobility B09 (Italian)
Mobility B09 (Italian)
 
B09 Origins Archaeological Process
B09 Origins Archaeological ProcessB09 Origins Archaeological Process
B09 Origins Archaeological Process
 
PublicEarthPresentationB09
PublicEarthPresentationB09PublicEarthPresentationB09
PublicEarthPresentationB09
 
Final Presentation English B09 Veninomics
Final Presentation English B09 VeninomicsFinal Presentation English B09 Veninomics
Final Presentation English B09 Veninomics
 
Final Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing VeniceFinal Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing Venice
 
Final Presentation Italian B09 Ships
Final Presentation Italian B09 ShipsFinal Presentation Italian B09 Ships
Final Presentation Italian B09 Ships
 

Recently uploaded

Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Ishani Gupta
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...parulsinha
 
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...Dipal Arora
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Availableperfect solution
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...tanya dube
 
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...GENUINE ESCORT AGENCY
 
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...BhumiSaxena1
 
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...parulsinha
 
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...khalifaescort01
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...Sheetaleventcompany
 
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...Sheetaleventcompany
 
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableGENUINE ESCORT AGENCY
 
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...Sheetaleventcompany
 
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service AvailableGENUINE ESCORT AGENCY
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...adilkhan87451
 

Recently uploaded (20)

Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
 
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
 
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
 
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
 
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
 
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
 
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
 
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
 
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
 
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
 
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
 
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
 

Origins Final Presentation

  • 1. Unearthing the Roots of Venice:From Relics to DNA Debora Afezolli Benjamin M. Allen Jaclyn Hepworth Andrew J. Kazanovicz
  • 2. Ancient Documents Archaeology Genetic Genealogy
  • 3.
  • 4.   Archaeologist 2 To be filled for every object/layer ~100 per intervento  Archaeological potential map  Cross-reference   Searchable Scheda statua  Scheda sito  Scheda tomba Scheda inorganico   Index forms Scheda organico  Scheda unita stratigrafica (US)  Manually created Schede  Soprintendenza Archeologica Foto  Manually submitted Archaeologist 1 Disegni 
  • 5. ArchEasy: A Solution Web-based management system for the archival, geo-referencing, and interpretation of archaeology in Venice Form management Database search Automatic indexing Interpretative maps Initial prototype system design
  • 6. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 7. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation  Index forms ArchEasy database Schede   Electronically uploaded Foto  Disegni 
  • 8. Forms Paper US form ArchEasy electronic US form
  • 9. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation   Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 10. Old paper index US form ArchEasy electronic index US form Indexing
  • 11. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted   Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 12.
  • 14.
  • 15. Mapping Data View the Map
  • 16. Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 17. Archaeological Potential Lower potential of archaeological find Higher potential of archaeological find Broad representation of archaeological potential
  • 18. Public works official Archaeological Potential View all objects on map Consults map Relics near Via Barovier are found every 15m High likelihood of more of these objects, so budget accordingly Application to public works
  • 19. Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 20. Object Correlation ArchEasy Correlates data Similar elevation, also 13th Century Brick floor Found: 1.5m beneath Origins: 13th Century Brick floor Found: 1.5m beneath Origins: ?? Correlational ability of ArchEasy
  • 21. The Future: Autonomous Agent Approach I have a similar floor pattern, therefore I could also be a 15th century church My brick size is 14x12x7 cm I’m a 15th century church with herringbone floors My brick size is 22x15x9 cm, and I am 100 years old I could also be 100 years old I have the same type of floor, oriented in the same direction My brick size is 22x15x9 cm Self-correlating autonomous agent approach
  • 22.
  • 23. Easy completion of administrative form requirements
  • 25. Complete customization and control of workspace
  • 26.
  • 27. Venice State Archive Unbroken documentary history 90km of shelves Painstaking to access and utilize the documents
  • 28. Current Process at the Venice State Archive Publications Archive Scholar 1 Pages Transcriptions Santa Maria della Salute Manuscripts Retrieves Searches Deliver to 90km of Shelves Request Information Choose
  • 29. Current Process at the Venice State Archive Publications Archive Scholar 2 Duplicate Transcriptions Pages SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
  • 30. Current Process at the Venice State Archive Publications Archive Scholar 3 TriplicateTranscriptions Pages SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
  • 31. Transcriptions are not shared! Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions     SHARING
  • 32. uScript: A Solution Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions SHARING
  • 33. Contribution Accountant uScript’s Components 3 Components Archive Assistant Transcription Assistant Archive Assistant Transcription Assistant
  • 34. uScript Scholar 1 Scholar 3 Scholar 2 uScript: An Overview Archive Assistant Santa Maria della Salute Search
  • 35. uScript Scholar 1 Scholar 3 Scholar 2 Manuscripts Archive Assistant
  • 36. I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini Marie Transcription Assistant
  • 37. uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
  • 38. I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini n no nos nost nostr nostri nostri Marie Transcription Assistant
  • 39. M Ma Mar Mary Mary Transcription Assistant
  • 40. uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
  • 42. uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Manuscripts Archive Assistant Contribution Accountant
  • 43. The Components Contribution Accountant Archive Assistant Transcription Assistant Archive Assistant Contribution Accountant Search Manuscripts and Transcriptions  Rate Contributors and Transcriptions Transcription Database Promotes Accuracy  Learn Handwriting  Automatic Transcriptions Automatic Boxing
  • 44. Transcriptions Transcriptions Transcriptions Transcriptions Nothing goes to waste! uScript
  • 45. Recent Effort Promotional Website: show and explain everything that is uScript
  • 46.
  • 47. Contribution to Origins Theory Origins of Venetians Unearth Theory Evidence Validates Theory Research Theory Evidence
  • 48. Venetian Origins Theories Lusatia ? Brittany ? Paphlagonia ?
  • 51. Paphlagonian Theory Livy – Aburbe condita 1st Century B.C.E. “Antenor sailed into the furthest part of the Adriatic, accompanied by a number of Enetians…and the name was extended to the surrounding district; the whole nation were called Veneti”
  • 52. Paphlagonian Theory Homer – The Illiad 8th Century B.C.E. “The Paphlagonianswere commanded by a stout-hearted Pylaemenes from Enetae…”
  • 55. Brittany Theory Strabo – Ancient Greek Historian 1st Century A.C.E. Claim that ancestors of Veneto are not the Enetae of Paphlagoniabut the Veneti of Gaul
  • 58. Lusatia Theory Salvi – Veneti: First Builders of European Community 1984 A.C.E. Developed VeneticTheory claiming most current day European populations are descendants of the Veneti of Lusatia
  • 59. ? ? ?
  • 60. ? ? ?
  • 66. Genographic Requirements Males At least 18 years old From Northeast Italy (specifically Veneto)
  • 68. 163
  • 71. Y-Chromosomal DNA Coding DNA (genes) Y-chromosome
  • 72. Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Y-chromosome
  • 73. Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Loci - 12 locations of interest Y-chromosome
  • 75. Y-Chromosomal DNA 4 complementary nucleotides A,T,C, and G ATCTCATACATACATACATAGCTA Y-chromosome
  • 76. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
  • 77. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
  • 78. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
  • 79. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA 4 CATA repetitions = 4 STRs Y-chromosome
  • 80. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA
  • 81. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA PaphlagoniaATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 82. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA Paphlagonia ATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 83. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA Paphlagonia ATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 84. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) Paphlagonia ATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 85. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) PaphlagoniaATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 86. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) PaphlagoniaATCACATACATACATACATAGCA (4 STRs) Lusatia GCTGACCATACTGAACGATATC (1 STRs) Brittany GCTAACGAATGTCAAGCTAATA (0 STRs)
  • 87. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) PaphlagoniaATCACATACATACATACATAGCA (4 STRs) Lusatia GCTGACCATACTGAACGATATC (1 STRs) Brittany GCTAACGAATGTCAAGCTAATA (0 STRs)   
  • 89. Ancient Documents Archaeology Genetic Genealogy
  • 90. Acknowledgements Professor Fabio Carrera Professor Daniel Gibson Dr. Marco Bortoletto and Dr. Alberto Zandinella, Dr. Giovanni Caniato Dr. David Comas Alberto Gallo MatteoSecchi, PierluigiTamburrini, and Venessia.com The Settimari Caffé Brasilia John Brunelli And a special thanks to all of the Genographic participants!

Editor's Notes

  1. Venice State Archive houses one of the largest collections of unbroken documentary historyDating back to the beginning of the Venetian Republic90km of shelves
  2. Show the first three words, one at a timeLink this with the three people thing, with more edits
  3. Show the first three words, one at a timeLink this with the three people thing, with more edits
  4. Show the first three words, one at a timeLink this with the three people thing, with more edits
  5. Dna extraction is generic example, random str, explain significanceFor example, go back to map and show comparison from everythingOne sample tracking throughLab gets bottle, extract Y chromosomeFrom Y chromosome, DNA helixFrom DNA Helix, zoom in on a non-coding DNAFrom ncDNA, zoom to nucleotides(explain STR’s, and all the stuff I read)Bunch of other samples come in, randomly? (fabio just said it)Show comparison from samples from the test regions and the control regions, make up how some are similar but some are different