1. AS BIOLOGY 18 November 2008
“Lorem Ipsum Dolor Set Ahmet In
Condinmentum. Nullam Wisi Acru Suscpit
Consectetuer viviamus Lorem Ipsum Dolor
Set Ahmet. Lorem Ipsum Dolor Set Ahmet
In Wisi Acru Suscpit Consectetuer
viviamus.”
Leo Praesen
Reading the DNA Code
DNA - Amino Acids - Proteins
DNA contains four base pairs and the order determines the characteristics of the products of a
gene. Remember one gene codes for one protein. A series of three base pairs is called a codon
this codes for one single amino acid.
Use the table on the other side of this sheet to unravel the message below.
TGGCAAAAATCTCAACAAACTCGTAATGATGGTATGTGGATTTATATGGAACAATGTGATGGTAT
GAATGTTATGGAAGAAATGGAATGTCAACATGTTGGTATTTGGGCTCCTTGGGCTTTTTGGATT
GATCAAAATCATCAAGATATGCCTTGGCCTTGGGATGGTATGCCTCAACAAACTGTCCAAATATAT
GATTATGTTTGATATGTCTTCTTATATGGATGGTATGATTTGGGAAAAAATGCAT
Once you have interpreted the code, have a go at writing a short message for someone else in the
class to decode.
How long would the protein created by this code be?
1

2. AS BIOLOGY 18 November 2008
unravel the Code
Use the table to unravel the message
Codon Amino Acid Letter
ATT, ATC, ATA Isoleucine A
CTT, CTC, CTA, CTG Leucine B
GTT, GTC, GTG Valine C
TTT, TTC Phenylalanine D
ATG Methionine E
TGT, TGC Cysteine F
GCT, GCC Alanine G
GGT, GGC Glycine H
CCT, CCC Proline I
ACT, ACC, ACA Threonine K
TCT, TCC, TCA Serine L
TAT, TAC Tyrosine M
TGG Tryptophan N
CAA, CAG Glutamine O
AAT, AAC Asparagine P
CAT, CAC Histidine R
GAA, GAC Glutamic Acid S
GAT, GAC Aspartic Acid T
AAA, AAG Lysine W
CGT, CGC Arginine U
2