2. INTRODUCTION
Menkes disease is an X-linked disease due to mutations in a gene which is designated as ATP7A
gene (basolateral form). The apical form of this gene, ATP7B is known to cause Wilson disease.
ATP7A gene is known as the Cu++ transporting alpha polypeptide while the beta polypeptide is
the ATP7B gene. Copper is necessary for the cells but a defect in the ATP7A gene leads to toxic
accumulation of this heavy metal in the body. Menkes disease effects the bone, hair, skin,
blood vessels and nerve function.
ATP7A gene encodes for a P-type copper transolcating ATPase which generally stays in the
trans-Golgi network and then shuttles in and out as per requirement. It has heavy-metal
binding domains in the N-terminal and these are six in number which bind Cu via their CxxC
amino acid motifs, where X is any amino acid ( C is the acronym for Cysteine). The Cysteine
residues aid in the Cu metal binding to these domains via their thiol groups. Also, these
Cysteine residues (thiol groups) are glucathionylated which triggers the binding of Glrx1 to the
CxxC motif of the N-terminal side of ATP7A thus forwarding the entire process of ATP7A to
supply Copper to the enzymes needing it and to help the cells in the efflux of excess Copper
from it.
A mutation in the ATP7A gene results in the production of an abnormal truncated protein which
gets stuck in the cell membrane and thus cannot shuttle in and out from the Golgi apparatus.
This mutated activity disrupts the normal distribution of Copper in the body leading to
accumulation of Copper , also impairing the Copper-dependent enzyme activities in the body
affecting the bone, skin, hair, blood and nervous system.
GENE INFORMATION :
Name of the Gene : ATP7A; ATPase, Cu++ transporting, alpha polypeptide
Accession number : NM_000052
Species : Homo sapiens
Size : 8499 base pairs (bp)
Chromosome location : Xq 13.2 (q is the long arm)
Reason for the disease : Mutations such as ‘Deletions’ ‘Transitions’ ‘Nonsense’ or ‘Mismatch’
are the most common mutations causing Menkes disease and thus, a truncated ATP7A protein
which is not long enough to bind Copper and activate Glrx1 activity for further metabolism. The
shortened ATP7A remains in the Trans-Golgi network because it can not reach out for the
normal activity.
3. cDNA sequence of ATP7A
5’atggatccaa gtatgggtgtgaattctgtt accatttctg ttgagggtat gacttgcaat tcctgtgttt
ggaccattgagcagcagatt ggaaaagtga atggtgtgca tcacattaag gtatcactgg aagaaaaaaa
tgcaactatt atttatgacc ctaaactaca gactccaaag accctacagg aagctattgatgacatgggc
///////////////////////////////////////////////////////////////////////////
taaactttac aggaaaccaa tcagcgttca tgttggaata gatgatacct caaggaattctcctaaactg
ggtttgctgg accggattgt taattatagc actgtctgat aaacgctccc taaacagtgt tgttaccagt
gaacctgaca agcactcactcctggtggga gacttcaggg aagatgatga cactgcatta taa 3’
3’ cc ttctactact gtgacgtaat att 5’
Protein size : 8499bp/3 x 110=311.63 kDa
Requisites for PCR
Primers (Primer design)
Top Primer :
- Tm = 70⁰C
- Sequence
5’ atggatccaa gtatgggtgtgaatt 3’
Bottom Primer :
- Tm = 68⁰C
- Sequence
5’ ttataatgcagtgtcatcatcttcc 3’
LINKERS
The restriction sites on pmWasabi-C and our gene of interest gives us two restriction enzymes –
BsaAI and DraI.
Top Primer with BsaAI Linker
5’ acgt atggatccaa gtatgggtgtgaatt 3’
Bottom Primer with DraI Linker
5’ ttt ttataatgcagtgtcatcatcttcc 3’
*Used NEBcutter online version for the above restriction site determination; we can also
MOLECULAR COMBING technique.
4. In-vitro protocol for the process:
Raw Material. Amniotic stem cells (diseased and normal), DNA isolation kit, enzymes, cell
culture system, PCR, synthetic tRNA suppressors (amber, UAG; opal, UGA)
Procedure. ATP7A gene is also expressed in the placenta, due to its functional importance.
Amniocentesis allows us to isolate few amniotic stem cells from the amniotic fluid around the
growing embryo. These cells are grown in vitro in a culture dish. When these cells are at least
70-80% confluent in the dish, they are Trypsinised and the cell suspension is centrifuged . The
pellet that is obtained now contains DNA and RNA. It is treated with Dnases. The mRNA from
total RNA content is isolated using Oligo (dT) magnetic beads. To isolate ATP7A mRNA, we use
His Trap ᵀᴹ Column for Affinity chromatographical separation of Histidine rich ATP7A mRNA.
Wash the column with Elution buffer and the eluate contains ATP7A mRNA. mRNA is Reverse
Transcribed into cDNA using RT-PCR and the above designed primers. cDNA is amplified by PCR.
The product is then purified using PCR product purifying kit. The cDNA is then subjected to
restriction digestioin with enzymes BsaAI and DraI. The vector Allᵉᴵᵉustrious pmWasabi-C is also
treated with the same two restriction enzymes. Followin digestion, the cDNA is inserted into
the expression vector using Ligase. The plasmid is transformed into competent DH5α cells
(better strain than others) by heat shock. These cells are plated in LB-Agar medium containing
Ampicillin (ampᴿ gene present in the Vector is used for selection of transformed cells). The
selected cells are inoculated and cultured in LB media containing Ampicillin. The recombinant
plasmids are then isolated by screening and selection.
Validation of cDNA. The plasmids obtained can be validated by :
1) Restriction digestion of the plasmids with BsaAI and DraI. The produced fragments are then
run on gel and the bands obtained corresponding to the ‘gene of interest’ and ‘vector used’ are
observed.
2) Automated DNA sequencing of the resultant recombinant plasmid will also give us the ‘gene’
and ‘vector’ sequence.
3) Restriction digestion using only BsaAI will give a linear molecule from which the cDNA can be
validated using DNA Microarray technique by using probed DNA primers complementary to the
gene/cDNA region.
5. Transfection of the recombinant plasmid
TARGET CELLS : Paneth or Goblet cell lines (Small Intestine where Cu²⁺ absorption occurs)
TRANSFECTION METHOD : Liposome mediated transfection
VALIDATION of TRANSFECTION :
The expression vector we are using is a Green Fluorescent protein (GFP) which can be detected
and thus our protein localisation can be visualised under Flourescent microscope.
Two more methods that we may use for validation :
1) IMMUNOSTAINING : A primary antibody is used against target ATP7A protein. Then a
secondary antibody tagged with a Fluorophore/Chromophore is used against the primary
antibody. The reaction between these two give detectable results which can be visualised
under the microscope if the protein is translated successfully.
2) WESTERN BLOT : The protein is isolated traditionally and run on SDS-PAGE gel. This gel is
then transferred onto the membrane and a primary antibody agains ATP7A protein is used. We
then incubate this membrane with a secondary antibody against the primary antibody. The
binding of these two gives a chemiluminiscent reaction which can be developed on the X-ray
film in a dark room.
6. RESEARCH PROPOSAL
GOAL : The goal is to design codon read-through ‘tRNA suppressors’ for UGA termination
codons which occur in some exons of the ATP7A gene due to mutations (Nonsense) leading to
sudden termination and thus a non-functional truncated protein which remains in the Trans-
Golgi network due to unusually shortened length.
BACKGROUND : According to many experiments conducted on the Mouse homolog of Human
ATP7A gene, it was found that this gene produces a protein which help in Cu ²⁺ absorption as
well as efflux of the excess and is Copper-transporting ATPase (Vulpe et al, 1993). The different
mutations of the ATP7A gene that lead to Menkes Disease were X-linked recessive with point
mutations and exon skipping were observed and identified by Kaler et al, 1994; Tumer et al,
1997; Poulsen et al, 2002; Moller et al, 2005; Moizard et al, 2011. Almost all of these mutations
led to a truncated ATP7A protein.
The work of Chiara Cecchi, Mario Tosi et al, 1997 indicated the 3D model of the ATP7A gene
which showed the transmembrane properties of the protein and indicated the 6 metal binding
domains on the -NH₂ terminal and an ATP-binding domain on the –COOH terminal. The
presence of this protein in the Gastrointestinal tract and Golgi body was determined by Ilia
Voskoboinik et al, 2002 and Subba Rao Gangi Setty et al, 2008 and Sharon La Fontaine et al,
1998. The metal binding sites have a consensus sequence of MXCXXC where X is any amino acid
and the main domains important for proper functioning of ATP7A is Metal binding site 5 and 6
was determined by Daniel Strausak et al, 1999. The ATP7A is also rich in amino acid Histidine
and Methionine, which is found to be essential for ATP7A was studied by Yan Guo et al, 2004.
OUTLINE : The ATP7A protein (an ATPase) is truncated due to the mutations (nonsense, etc)
and thus its Cu²⁺effluxing is affected leading to accumulation of Cu²⁺ in high toxic
concentrations. Glrx1 interacts with ATP7A’s CXXC motifs in the N-terminal which is signalled by
glutathionylation of the ‘Cysteine’s thiol residues’ but Glrx1 cannot sense that in a truncated
protein. Thus, we can create an expression cassette including ATP7A gene and Glrx1 and insert
into the same vector.
RESULT ANALYSIS : The validation can be done using the GFP in the pmWasabi-C vector. Once
the glutathionylation (post-translational modification) occurs, Glrx1, due to close proximity of
transcription of the gene, might be able to bind to the N-terminal of ATP7A and carry forth the
functional responsibility as in a normal situation. We can make use of the Locus control regions
(LCR) of both genes to stimulate gene expression as per the layout. If this works, we can then
use this ‘expression cassette’ as a gene therapy for Menkes Disease.
(*http://www.ncbi.nlm.nih.gov/projects/gorf/orfig.cgi- the mutation can be counted and
analysed using ORF Finder, maximum are point mutations of various kinds)
8. REFERENCES
1. Danks, D. M., Campbell, P. E., Stevens, B. J., Mayne, V., Cartwright, E. Menkes’ kinky
hair syndrome: an inherited defect in copper absorption with widespread effects.
Pediatrics 50: 188-201, 1972
2. Tumer, Z., Horn, N. Menkes disease: recent advances and new aspects.
J.Med. Genet. 34: 265-274, 1997
3. Moller, L. B., Bukrinsky, J. T., Molgaard, A., Paulsen, M., Lund, C., Tumer, Z., Larsen, S.,
Horn, N. Identification and analysis of 21 novel disease-causing amino acid
substitutions in the conserved part of ATP7A.
Hum. Mutat. 26: 84-93, 2005
4. Poulsen, L., Horn, N., tumer, Z., Heilstrup, H., Lund, C., Moller, L. B. X-linked recessive
Menkes disease : identification of partial gene deletions in affected males.
Clin. Genet. 62: 449-457, 2002
5. Moizard, M., Ronce, N., Blessen, S., Bieth, E., Burglen, L., Mignot, C., Mortemousque,
I., Marmin, N., Dessay, B., Danesino, C., Feillet, F., Castelnau, P., Toutain, A., Moraine,
C., Raynaud M Twenty-five novel mutations includiing duplications in the ATP7A gene.
Clin. Genet. 79: 243-253, 2011
6. Zeynep, T., Lisbeth, B. M., Nina, H. Mutation spectrum of ATP7A, the gene defective in
Menkes disease. Adv. Exp. Med. Biol. 448: 83-95, 1999
7. Baci, L., Bertini, I., Cantini, F., Migliardi, M., Rosato, A., Wang, S.
An atomic-level investigation of the disease causing A629P mutant of the Menked
protein, ATP7A. J Mol Biol 16: 352(2) : 409-17, 2005
8. Kuo, Y. M., Gitshcier, J., Packman, S. Developmental expression of the mouse mottled
and toxic milk genes suggests distinct functions for the Menkes and Wilson disease
Copper transporters. Hum. Molec. Genet. 6: 1043-1049, 1997
9. Tumer, Z., Lund, C., Tolshave, J., Vural, B., Tonnesen, T., Horn, N.
Identification of point mutations in 41 unrelated patients affected with Menkes disease.
Am. J. Hum. Genet. 60: 63-71, 1997
10. Gourdon, P., Liu, X. Y., Skjorringe, T., Morth, J. P., Moller, L. B., Pedersen, B. P., Nissen,
P. Crystal structure of copper-transporting PIB-type ATPase. Nature 475: 59-64, 2011
11. William C. J., Kelly T. M., Michael A. C., Wendy R. W., Ross M., Yu Y., Philip E. T., Julian
F. B. M., Sharon L. F. Role of Glutaredoxin 1 and Glutathione in regulating the activity of
the copper-transporting P-type ATPases, ATP7A and ATP7B.
The Journal of Biological Chemistry 285 : 27111-27121, 2010
12. http://www.ncbi.nlm.nih.gov/nuccore/NM_000052.5
The source pages are attached on the next page, for ATP7A sequence as obtained from
NCBI site.
