SlideShare ist ein Scribd-Unternehmen logo
1 von 175
Downloaden Sie, um offline zu lesen
Hépatite B

     Fabien Zoulim
Département d’hépatologie
 & INSERM U871, Lyon
Guérison                                                          30-50 ans




VHB                    HCA                  cirrhose                CHC



 Vaccin                      ANTIVIRAUX                   Antiviraux/IFN?
                                 IFN                      Niederau N Engl J Med 1996
                                                          & Liaw N Engl J Med 2004


                     RESISTANCE VIRALE
                 Lee, N Engl J Med 1997; Lok, Hepatology 2001
EPIDEMIOLOGIE DE L’HÉPATITE B
EPIDEMIOLOGIE DE L'INFECTION A VHB

AUX USA



    • Hépatites aigues
          – VHA : 40%
          – VHB : 30%
          – VHC : 20%
    • incidence : 300 000 infections à VHB / an
    • 30 000 nouveaux porteurs chroniques / an
    • 3 000 décès / an
MODES DE TRANSMISSION DU VHB

•   1108 habitants de San Francisco
•   159 (14%) anti-HBc +
•   positivité des anti-HBc associée avec
     – âge
     – éthnie
     – degré d'éducation
     – toxicomanie IV
     – prostitution
     – nombre de partenaires sexuels
     – homosexualité
     – HIV / HSV 2 / syphilis
MODES DE TRANSMISSION DU VIRUS DE L'HÉPATITE B EN EUROPE

                                           transfusions
                          contact avec         2%
                          porteur du VHB
                              4%                  personnels de santé
    sexuelle                                          2%
                   homo                                     hémodialysés
       34%         11%                                          8%

    hétéro
    23%




                                                                      inconnue
                                                                          31%
        Asie                      drogue IV
                                      26%
Transmission verticale
Déclaration obligatoire
       de l’hépatite B en France :
 résultats des 12 premiers mois de notification


Denise Antona, E Delarocque-Astagneau, D Lévy-Bruhl
        département des maladies infectieuses
Incidence of acute hepatitis B in France
Sentinel networks 1991-1996 et Lyon (COURLY) 1983-1997
Circuit de l’information
                               Feuillets 2 et 3                    Médecin
    Biologiste                 à compléter                       prescripteur

   Feuillet 1 :                                   Relance      Feuillet 2 :
   parties 1-2 et                                              parties 3-4-5
   6-7 renseignées          MISP de DDASS du                   complétées
                               département
                                d’exercice
                       Feuillets 1 et 2 complétés et validés


                                    InVS

Fiche de notification autocopiante à 4 feuillets
Partie 1      : code d’anonymat irréversible, caractéristiques du patient
Partie 2      : information biologique
Parties 3-4-5 : information clinique et épidémiologique
Parties 6-7 : identification du médecin prescripteur et du biologiste déclarants
Results

158 acute hepatitis cases

• Hospital doctor in 64% cases

• Sex ratio M/F : 2,95 (118/40)

• Median age: 37 yrs for males, 36yrs for females

• Jaundice : 69%

• Hospitalisation : 46%

• Fulminant hepatitis : 3 (2 death)
Age distribution: comparison of the different periods
          1991-94 versus 03/2003 - 02/2004


      years 1991- 94
         n= 151
                                     March 03- February 04
                                            n= 158
Risk exposure within 6 months preceding the acute case
              Source : obligatory declaration 2003-04

• Source: obligatory declaration march 03- february 2004 N=145
  – Sexual                59     40,6%          No factor      43     29,6%
  – IVDU                  9        6,2%         >1 factor      38     26,3%
  – Invasive treatment    15     10,3%
  – Tatoo, piercing       5        3,4%
                                                • Sentinel networks 91-96
  – Familial              14       9,7%           N=195
  – Perinatal              2       1,4%            – sexual             35%
  – Live in instiution    11       7,6%            – IVDU               19%
                                                   – « percutaneous »   15%
  – Travel in endemic      21     14,5%
                                                   – No factor          35%
    areas
  91/145 patients (63 %) had a vaccine indication (2 vaccinated ≥ 3 doses)
Hépatites virales B: épidémiologie


- Vaccin mais 400 millions de porteurs
chroniques dans le monde
- 280 000 porteurs chroniques en France (INVS)
- 45% ignorent leur statut
- 1 300 décès par an en France
- 60 000 avec hépatite chronique active
- Seulement 13 000 patients traités
VIROLOGIE
LE VIRUS DE L ’HEPATITE B
• FAMILLE : Hepadnaviridae, seul représentant humain

•VIRUS RESISTANT :
      - 7 jours dans l’environnement
      - pendant 5 mn à 100° 10 h à 60°
                             C,      C
      - à la congélation.
LE GÉNOME DU VIRUS DE L’HÉPATITE B
                                              déterminant a
                                              vaccin/IgHBs
8 génotypes
   A to H                                         Gène pol
                                                  antiviraux




Mt du core
Réponse CTL
                                        Tiollais Nature 1985
        Mt pre-core                     Günther Adv Virus Res 1999
        Réponse anti-HBe         ?      Norder J Gen Virol 2003
Ganem & Prince, NEJM 2004
Réplication du génome viral. Implication pour la
        persistance virale et l’intégration du génome viral
                                                       Membrane cellulaire
                  ARN pg

                                 ds DNA
                        10%                                         virion
               ss DNA
90%



                                                          intégration
                                          cccDNA
                                          illégitime
               RC DNA
                                                          noyau
      virion                   cccDNA
Modèles Animaux                    Chimpanzé

   VHB HUMAIN




                                                              Souris Transgéniques
                                                              Souris SCID uPa
                                       Tupaia




    MARMOTTE (WHV)                                             CANARD (DHBV)
    Summers PNAS 1978, Mason J Virol 1981, Chisari Science 1985, Petersen PNAS 1998
Modèles in vitro

• Polymerase virale                       • Culture cellulaire
   – DHBV : lysat réticulocytaire             – Transfection : lignées d’hépatome

   – HBV : baculovirus                        – Infection : hépatocytes primaires, HepaRG
                                              – Baculovirus ou adenovirus recombinant

                                                                               RC -
                                                                                L-

  Polymerase VHB



       DNA(-)
       DNA(
                        U                                                      SS -


           ELONGATION
                                                                              CCC -


                Sells PNAS 1987, Wang Cell 1992, Zoulim J Virol 1994,
                Lanford J Virol 1995, Gripon PNAS 2002, Sprinzl J Virol 2001
Cycle de réplication du VHB




Zoulim & Locarnini, Gastroenterology 2009
Comparative dynamics among three viruses
                           HIV              HCV               HBV
                       (Ritonav ir)       (IFN- )         (Lamivu dine)

Plasma virus
 Half-life                5.8 h         2.7 - 7.2 h           24 h
 Mea n viral              2.7 d         3.8 - 7.3 d          24.7 d
genera tion time
 Daily t urnover          95%          94% - 99. 8%           50%
 Daily produ ction        10 10            (1.1 -             10 11
(plasm a)                                12.7 )*10 11
 Tot al load             1.2*1 0 9    (3.8 - 5.6)*10 10      2*10 11

Infecte d ce lls
 Half-life                1.6 d         2.4 - 4.9 d        10 - 10 0 d
 Mea n lifespan           2.3 d         3.5 - 7.1 d          23.3 d
 Daily t urnover          38%           13% - 25%           1% - 7%


                     (Tsiang et al. Hepatology 1999)
Infection à VHB et risque de CHC

• Etude de Beasley à Taiwan
   – risque relatif = 100 chez les porteurs de l'AgHBs
• Etude de Tsukuma
   – risque cumumatif de CHC à 3 ans
      • 12,5% chez 240 patients avec cirrhose
      • 3,8% chez 677 patients avec hépatite chronique
   – risque x 7 si AgHBs +
   – risque X 4 si anti-HCV +
• Facteurs associés : alcool, tabac, aflatoxine
• Diminution incidence avec la vaccination de masse (Chen,
 NEJM 1995)
CARCINOME HEPATOCELLULAIRE ET VIRUS
           DE L'HEPATITE B


• Co-incidence de répartition géographique
VHB / CHC
• Porteurs AgHBs : RR x 100 pour le CHC
• CHC dans les modèles animaux de l'hépatite B :
   – marmotte
   – écureuil
• Présence d'ADN viral intégré dans les tumeurs
HBV replication and its role in HCC development




                                          Wands, NEJM 2004
PATHOGENIE DU CARCINOME
         HEPATOCELLULAIRE
                         ALCOOL
VHB                                             VHC



             LESIONS HEPATIQUES CHRONIQUES        DESORDRES
                                                 METABOLIQUES
ACTIVATION FACTEURS
  DE CROISSANCE

                      REGENERATION                FACTEURS
                                             ENVIRONNEMENTAUX




                 ALTERATIONS GENETIQUES




                CARCINOME HEPATOCELLULAIRE
Role du VHB dans l’oncogénèse hépatique

               REACTION INFLAMMATOIRE CHRONIQUE
                      REGENERATION HEPATIQUE




       VHB                                           CARCINOGENES
INFECTION CHRONIQUE              CHC                 CO-FACTEURS




                      MUTAGENESE INSERTIONNELE
              TRANSACTIVATION DE GENES CELLULAIRES
                      INTERACTIONS PROTEIQUES
          INACTIVATION DE GENES SUPPRESSEURS DE TUMEUR
PHYSIOPATHOLOGIE /
IMMUNOPATHOLOGIE
Ganem and Prince, NEJM 2004
IMMUNOPATHOGÉNIE
              DES HÉPATITES B CHRONIQUES
                                               RÉPONSE IMMUNITAIRE
     HÉPATOCYTE
                                                   CYTOKINES
     NON INFECTÉ

                                       CTL       cytokines

                          perforine
                            Fas

ANTICORPS NEUTRALISANTS                                 AgHBc/e




                    VHB                                  HLAI


                   ANTIVIRAUX
                                      HÉPATOCYTE INFECTÉ
IMMUNOPATHOLOGY OF HBV INFECTION

                       CD8+
                               HBV
Immune tolerance



                      CD8+    HBV
Clairance phase
Chronic hepatitis


                              HBV
Seroconversion      CD8+
Remission
Immunopathology

  Fulminant hepatitis



                HBV

 CD8+
MECHANISMS OF VIRAL CLEARANCE



Non cytolytic processes                           Turn-over of infected cells
TH1 cytokines with direct antiviral            Immune mediated lysis of infected cells
  effect


       Transgenic mice                                       Ducks
        Chimpanzees                                        Woodchucks
        (Guidotti Science 1999,                           (Guo J Virol 1999
         Thimme J Virol 2003)
                                                       Summers PNAS 2003&2004)


                                  Antivirals
             Inhibition of viral DNA synthesis
             -> inhibition of intracellular recycling of cccDNA
             (Werle Gastroenterology 2004)
             Restoration of anti-HBV immune response
             (Boni Hepatology 2000)
Non cytolytic clearance of acute
 HBV infection in chimpanzee




                              Wieland S et al, PNAS 2004
Hepatocyte turn-over is required for clearance of
       viral infection in acute infection




                            Summers et al, PNAS 2003 & 2004
Phase de tolérance immunitaire

                                            Marqueurs
Hépatocyte                                  AgHBe +
non infecté
                                            HBV DNA +++
                                            ALAT = N
                                            Foie = N


                                              HBc/e Ag
              HBV




                       Hépatocyte infecté
Phase de clairance immune
                 (hépatite chronique)
                                                   Marqueurs
Hépatocyte                                         AgHBe+
non infecté
                                                   HBV DNA +
                               CTL
                                                   ALAT +++
                                                   Foie: Hépatite
                                         cytokines chronique
                       perforine
                         Fas
                                                   HBc/e Ag
                 HBV




                                                    HLAI




                             Hépatocyte infecté
Phase de rémission
               portage inactif de l’AgHBs
                                             Marqueurs
Hépatocyte
non infecté
                                             AgHBe-
                                             anti-HBe +
                                             HBV DNA < 104 /mL
                                             ALAT = N
                                             Foie = rémission


              HBs Ag




                        Hépatocyte infecté           Réactivation
                                                      Virus sauvage
                           Oncogénèse                 ou mt pre-core
Clairance de l’AgHBs

                               Marqueurs
Hépatocytes                     HBsAg -
non infectés
                               anti-HBc +
                              Anti-HBs +/-
                          HBV DNA - mais PCR +




                    Hépatocytes infectés   Mutants d’échappement
  Oncogénèse
                                             Infections occultes
cccDNA levels in the different phases of
                                   chronic HBV infection
                          10 3                                                                             10 4
   cccDNA (copies/cell)




                                                                           Total HBV DNA
                                                                                                           10 3




                                                                                           (copies/cell)
                          10 2
                               1                                                                           10 2
                          10
                               0
                                                                                                           10 1
                          10
                               -1
                                                                                                           10 0
                          10
                               -2
                                                                                                           10 -1
                          10
                                                                                                           10 -2
                               -3
                          10
                                                                                                           10 -3
                                       )        )           )          )                                                                    )          )
                                     63      18          10          (7                                                3)    18)         10          (7
                                    (       (           (          -                                                (6    -(            (          -
                              g +       g-           rs          Ag                                            g +       g           rs          Ag
                            eA       eA           rie         BS                                                     eA            ie
                                   B            r           H                                                eA     B            rr           BS
                          HB      H
                                          .  Ca                                                            HB      H        .C
                                                                                                                               a          H
                                        ct                                                                                 t
                                      a                                                                                 ac
                                    In                                                                                In

• HBeAg+ patients had significantly higher cccDNA (90-fold) and total HBV
  DNA (147- fold) levels compared to HBeAg- patients. (p<0.001, Wilcoxon
  tests)
                                                                                                              Werle et al, Gastroenterology 2004
HISTOIRE NATURELLE ET
 VIROLOGIE CLINIQUE
Histoire Naturelle de l’hépatite B
                             Infection aigue           Seeger, Zoulim, Mason;
      Guérison                                         Fields Virology; 2007
      5% nx-nés             Infection chronique
      90% adultes

                           Hépatite chronique
                           Virus sauvage (HBeAg+)
                           Mutant pre-core (HBeAg-)      Portage inactif
  Tolérance immunitaire


                                                        Réactivation


                                Cirrhose



30-50 ans                 Carcinome hépatocellulaire
MARQUEURS SEROLOGIQUES

• Système AgHBe /anti-HBe
  – distinction virus sauvage / virus muté AgHBe
   négatif

• Virémie
  – détection quantitative de l'ADN viral
HEPATITE B AIGUE
• Incubation 1 à 6 mois
• Le plus souvent asymptomatique
    – Évolution plus fréquente vers la chronicité
• Prodromes:
    – Maladie sérique : arthralgies, urticaire,
      acrodermatite etc. ..
• Formes ictériques : + graves que VHA et VHC
    – Durée de l’ictère : jusqu’à 4 mois
•   Evolution : chronicité 5 à 10%
•   Hépatites fulminantes
Laboratory Diagnosis of Acute Hepatitis B


                                                        HBsAg                      Anti-HBs Ab
                                                1000
                  IU/L and million copies/ml



                                                 900
                                                           HBeAg                Anti-HBe Ab
                                                 800       ALT
ALT and HBV DNA




                                                 700                                    Total anti-HBc
                                                 600
                                                                Symptoms
                                                 500
                                                 400 HBV DNA               IgM anti-HBc
                                                 300
                                                 200
                                                 100           Normal
                                                   0
                                                     0   1    2    3  4  5    6 12 24 36 48 60

                                                          Months After Exposure
                                                                         Seeger, Zoulim, Mason, Fields Virology 2007
HEPATITE B PROLONGEE
• Définition
  – Persistance réplication virale à la 8ème
    semaine d’évolution :
  – AgHBe + ou ADN-VHB +
• Evolution
  – Chronicité : 8 cas / 10
• Traitement : IFN
  – Guérison : 7 à 8 cas / 10
INFECTIONS CHRONIQUES A VHB
            FORMES CLINIQUES
• virus sauvage
  – tolérance immunitaire
  – rupture de tolérance -> lésions hépatocytaires : HCA
  – séroconversion anti-HBe spontanée (portage inactif) :
    5-10% /an
  – > diminution significative réplication virale
  – > amélioration signes histologiques
• virus muté pré-C (-)
  – sélection au moment de la séroconversion anti-HBe
  – dépend du génotype viral
  – immunopathologie ?
  – sévérité de l'hépatopathie : controversée
  – association au CHC
Laboratory Diagnosis of Chronic Hepatitis B
                                                associated with wild type virus infection

                                                             HBsAg
                                               800
                                                             HBeAg
                  IU/L or million copies/ml




                                               700
ALT and HBV DNA




                                               600
                                               500
                                                                          HBV DNA
                                               400
                                               300
                                                                ALT
                                               200
                                               100
                                                                                            Normal
                                                 0
                                                     0   1   2   3    4    5    6 12 24 36 48 60
                                                             Months After Exposure
                                                                             Seeger, Zoulim, Mason, Fields Virology 2007
Laboratory Diagnosis of Transition of Chronic
                                                 Hepatitis B to The inactive Carrier State

                                               800
                                                                       HBsAg         ``
                  IU/L and million copies/ml



                                               700
                                                                       HBeAg                        Anti-HBe
                                               600
ALT and HBV DNA




                                               500
                                               400                              HBV DNA
                                               300
                                               200                    ALT
                                               100
                                                                                     Normal
                                                0
                                                     0   1   2   3     4    5   6   12 24 36 48 60 72 80 92 104
                                                                     Months After Exposure
                                                                                  Seeger, Zoulim, Mason, Fields Virology 2007
Laboratory Diagnosis of HBeAg negative
                                                              Chronic Hepatitis B
                                                         HBsAg
                                                          HBeAg                     Anti-HBe
                  IU/L and million copies/ml




                                               450
                                               400                    ALT
ALT and HBV DNA




                                               350
                                               300
                                               250
                                               200
                                                                        HBV DNA
                                               150
                                               100
                                                50
                                                         Normal ALT levels
                                                 0
                                                     0    3   6   9   12 15 18 21 24 27 30 33 36 39 42 45 48       Months
                                                                                   Seeger, Zoulim, Mason, Fields Virology 2007
AgHBs
UI/ml
UI/
pg/ml
pg/
             AgHBe +                              anti-HBe +
  1000                                                                              ALAT
9 log
                                                                                    ADN-
8 log
   100                                                                              VHB


7 log
        10
6 log
        1                                                                      hybridation
5 log
4 log
   0,1

3 log
  0,01
2 log
                                                                                PCR
 0,001
1 log
         Tolérance   hép chronique   p. inactif         mt pré-core   VHB occulte
Dynamic ranges of quantification
                          of HBV DNA assays
                        10   102   103   104   105   106   107   108   109
Amplicor HBV Monitor
v2.0 (Roche)

HBV Hybrid-Capture II
(Digene)

Ultra-sensitive HBV
Hybrid-Capture II

Versant HBV DNA
3.0 (bDNA, Siemens)


Cobas Taqman HBV
(Roche)

RealArt HBV LC PCR
(Artus Biotech)

Abbot Real-time HBV
(Abbott)

Versant HBV DNA 1.0
(kPCR, Siemens)*

 *in development
Formes cliniques
MANIFESTATIONS
      EXTRAHEPATIQUES DU VHB
• PAN
    – Complexes immuns circulants HBs/anti-HBs
    – Dépots artères moyens et petit calibre
    – Traitement : plasmaphéreses, corticoides, antiviraux
      (vidarabine / IFN / famciclovir / lamivudine)
•   Glomérulonéphrites
•   Cryoglobulinémies
•   Guillain-Barré
•   Myocardite
TRANSMISSION VERTICALE DU VHB

• mère AgHBe +
  – transmission : 90%
• mère anti-HBe +
  – transmission : 10-20%
  – VHB muté pré-C (-) : hépatites fulminantes
• chronicité chez l’enfant : 90%
PRESENTATION CLINIQUE
• INFECTION PERI-NATALE
  – ALT normales ou subnormales
  – ADN-VHB > 1000 pg/ml
  – histologie : lésions minimes
• INFECTION POST-NATALE
  – ALT élevées
  – ADN-VHB < 1000 pg/ml
  – histologie : hépatite modérée à sévère
• CARCINOME HEPATOCELLULAIRE : 30 ANS
Histoire naturelle de l’infection chronique
            par le virus de l’hépatite B
                     en Alaska
• McMahon BJ, Ann Intern Med 2001;135(9):759-68
• 1536 natifs d’Alaska : 641 AgHBe+, 83 anti-HBe+
• Probabilité d’éliminer l’Ag HBe à 10 ans : 72,5 %.
• Elimination de l’Ag HBs chez 106 porteurs
  chroniques du VHB (7 %)
• Incidence des événements cliniques: 2,3/1000
  porteurs/année
• Incidence du CHC: 1,9/1000 porteurs/année (2,3 chez
  l’homme; 1,2 chez la femme).
Pathophysiologic Cascade of
                 Chronic HBV Infection
         HBV Replication
          HBV Replication                                          Liver
                                                                   Liver
           (Measured by
           (Measured by                                       Inflammation
                                                              Inflammation
         Serum HBV DNA)
         Serum HBV DNA)


                                      ALT
                                      ALT
                                   Elevation
                                   Elevation


                                                      Worsening Histology
                                                      Worsening Histology                       Disease Progression
                                                                                                Disease Progression
                                                      • Necroinflammation
                                                      • Necroinflammation                       • Liver Failure
                                                                                                • Liver Failure
                                                      • Fibrosis
                                                      • Fibrosis                                • Liver Cancer
                                                                                                • Liver Cancer
                                                      • Cirrhosis
                                                      • Cirrhosis                               • Transplant
                                                                                                • Transplant
                                                                                                • Death
                                                                                                • Death




Adapted from: Lavanchy D. Journal of Viral Hepatitis, 2004, 11, 97–107. Chen JC, et al. JAMA. 2006;295:65-73. Iloeje U. H, et al.
Gastroenterology. 2006;130:678-86.
Normal Aminotransferase Levels and
        Risk of Mortality from Liver Diseases
                                                                              59.0

               >100
                                               30.0

               50-99
                                        19.2
                                                                            Elevated

               40-49              9.5
         ALT




               30-39
                            2.9

               20-29                                                          Normal
                           1.0

                 <20

                       0          10      20     30       40        50         60         70         80       90

•   Korea Medical Insurance Corporation               Risk ratio (95% CI)

     – 94,533 men; 47,522 women
     – 35-59 yrs old
     – Relative risk for liver mortality compared with AST and ALT <20 IU/l
                                                                            Kim HC et al. BMJ 2004; 328:983
                                                                                      al.     2004;
AgHBeAg et risque de CHC
   • 11,893 Taiwanese men; 92,359 person-years
     follow-up
                                         12
             Cumulative incidence (%)




                                                                         HBsAg+
                                         10                              HBeAg+

                                          8

                                          6

                                          4
                                                                         HBsAg+, HBeAg -
                                          2

                                         0                               HBsAg -, HBeAg -
                                              0   2   4          6   8     10
                                                          Year
Yang et al. N Engl J Med. 2002;347:168-174.
Charge virale et incidence de la cirrhose
                                    .4
                                                                                                    P <0.001
 Incidence cumulative de cirrhose




                                                                                                                                    37.1%
                                                         1.0 x 106 n=627
                                                         1.0-9.9x105 n=344
                                                                                   n=3774
                                                         1.0-9.9x104 n=649
                                    .3                   300-9.9x103 n=1210
                                                         <300 n=944


                                                                                                                                   23.0%
                                    .2




                                    .1                                                                                             10.0%

                                                                                                                                    6.3%
                                                                                                                                    5.2%

                                    0
                                         0   1   2   3      4      5      6    7     8        9      10      11       12      13
                                                                       Année de suivi
R.E.V.E.A.L. – HBV Study                                                           Iloeje UH et al. Gastroenterology 2006; 130: 678-686
Survie chez les patients au stade cirrhose

                                      100
              Patients Surviving, %



                                      80

                                      60                       Cirrhosis1          55%
                                                               (n = 130)
                                       40


                                      20            Decompensated cirrhosis2       14%
                                                    (n = 21)
                                       0
                                            0   1          2           3       4     5
                                                               Years
1. Weissberg et al. Ann Intern Med. 1984;101:613.
2. De Jongh et al. Gastroenterology. 1992;103:1630.
Charge virale et incidence du CHC




                        Chen et al; JAMA 2006
REVEAL-Incidence of HCC
                                  Increases with Increasing HBV DNA
                                  20%     Baseline Viral Level
  % cumulative incidence of HCC




                                                                                         14.9%
                                  15%
                                                                              12.2%

                                  10%


                                   5%                           3.6%
                                        1.3%      1.4%
                                   0%
                                        <300   >300 - 103    > 103 - 104    >104 - 106   ≥106
                                                     Baseline HBV DNA (copies/mL)




Chen JC, et al. JAMA. 2006;295:65-73.
High Baseline Serum HBV DNA Levels are
      Associated with Increased Risk of HCC Mortality
                in HBsAg-Positive Patients
                                                                                                      HBV DNA
                                                                                                      Negative
          100%

                                                                                  HBV DNA Low
            96%                                                                  < 105 copies/mL
                                                                                       copies/
                                                                                 RR = 1.7 (0.5-5.7)
                                                                                          (0.5-5.7)

            92%


            88%
                                                                HBV DNA High
                                                                ≥ 105 copies/mL
                                                                      copies/
                           p < 0.001 across viral              RR = 11.2 (3.6-35.0)
                                                                         (3.6-35.0)
            84%                  categories

            80%
                   0      1       2       3      4       5       6       7        8       9       10        11   12
                                                     Survival time (Years)

http://www.fccc.edu/docs/sci_report/Evans.pdf#search=%22haimen. Accessed 1/23/07.
Chen G, et al. J Hepatology 2005; 42 (suppl 2):477A.
Chen G, et al. Hepatology 2005; 40 (suppl 1):594A.
Relationship Between Persistent Viremia and HCC:
                         Argument For Antiviral Therapy
           •                Persistent replication associated with greater risk of HCC
           •                Decreased risk when viral replication declines
                Rate Per 100,000
HCC Incidence




                                     1.2x104                                                10,108
                                     1.0x104                                 8730
                                     8.0x103                  5882
                                     6.0x103
                                     4.0x103     1473
                                     2.0x103
                                           0
           Baseline HBV DNA,
                   (copies/mL)
                                                  < 104          ≥105            ≥105            ≥105

     Follow-up HBVDNA,
               copies/mL
                                                   ---           < 104        104 to <105        ≥105

                                   Adjusted RR     1.0            3.6              6.9             9.1
                                      (95% CI)    (ref)        (1.7-7.6)       (3.4-13.8)      (5.8-14.1)
                                       P Value      --          < 0.001         < 0.001          < .001
                                                                                                            Chen, et al. JAMA 2006
Impact Clinique de la Variabilité
       du Génome Viral
VARIABILITE GENETIQUE DU VHB


• Multiplication virale
   » taux d'erreur de la transcriptase inverse
• Pression de sélection
   » réponse immunitaire cellulaire / humorale
   » antiviraux
   -> possibilité de variants d'échappement
• Conséquences cliniques
   » diagnostic sérologique
   » traitements antiviraux
VARIABILITE GENETIQUE DU VHB

• SOUS-TYPES : acides aminés et déterminants HBs
   – boucle 139-147 -> det a
   – 122 -> det d ou y
   – 127 -> det w1-4
   – 160 -> det w ou r
• GENOTYPES : variabilité de séquence génomique
   – du génome complet : 8%
   – du gène S : 4%
   – 8 génotypes A à H
• MUTANTS DU VHB
   – mutations ponctuelles / délétions / insertions
8 genotypes, numerous sub-genotypes, and
           recombinant forms

   B6



                      D1




                       World J Gastroenterol 2007; 13: 14-21
Génotypes VHB chez les patients atteints
                              d’hépatite chronique en France
                                                       37.4%
                          100

                          90
                                30.2%
                          80
     Number of subjects




                          70

                          60

                          50

                          40                   12.5%
                                                               11.3%
                          30
                                        7.9%
                          20

                          10                                                   1.1%
                                                                       0.4 %
                           0
                                 A      B       C       D       E       F      G
Zoulim et al J Viral Hepatitis 2006
Impact du génotype sur la
                                                      séroconversion
                                               PEG-IFN a-2b                                                                  PEG-IFN a-2b
                                               HBeAg Loss 1                                                                  HBsAg Loss 2
                                     47%
                              50                                                                                21




                                                                                   Percentage of patients (%)
Percentage of patients (%)




                                                44%
                                                                                                                18
                              40
                                                                                                                     15%
                                                                                                                15
                                                        28%
                              30
                                                                 25%                                            12

                              20                                                                                9            8%

                                                                                                                6                    5%
                              10
                                                                                                                3
                                                                                                                                            0%
                               0                                                                                0
                                      A          B        C        D                                                  A       B       C       D
                                     n=90       n=23     n=39    n=103                                               n=90    n=23    n=39   n=103

                                               HBV genotype                                                                 HBV genotype


                             1 Janssen,   Lancet 2005; 2 Flink, Am J Gastro 2006
LES MUTANTS DU GÉNOME DU VHB

                                        déterminant a
                                        vaccin/HBIg


                                         polymérase
                                         antiviraux




Mt core
Réponse CTL

        Mt pré-core
        Réponse anti-e            ?
ROLE DE LA RÉGION PRÉ-C ET DE L’AgHBe

 • Non nécessaire à la réplication du VHB
      – Culture cellulaire
      – Modèles in vivo
           • Marmotte
           • Canard
 • Modulation de la réponse immune
      – Tolérogène : souris transgéniques
      – Cible de la réponse anti-capside

Chang et al, J. Virol 1987; Schlicht et al J. Virol 1987; Chen J. Virol 1992; Millich et al PNAS
LES MUTANTS PRÉ-C (-)
           • codon stop / région pré-C
               TGG -> TAG en pos. 1896

               – génotypes B à E (A : exceptionnel)

               – arrêt traduction protéine pré-C/C

               – AgHBe négatif

           • mutation dans promoteur pré-C
               TTAAAGG -> TTAATGA en pos. 1762 /1764

               – génotypes A à E

               – transcrits pré-C/C :

               – synthèse d'AgHBe :

Carman et al Lancet 1989, Okamoto et al J Virol 1990/1994, Tong et al Virology 1990
HBeAg and Precore Mutation
                   G 1896A = stop codon, TAG

             ATG              ATG
Core gene

            1814       1901

             Precore                Core
             region                 region


                                             HBcAg   Virion


                                    HBeAg            Serum
HBeAg and Precore Mutation

              ATG         ATG
Core gene

             1814       1901

              Precore           Core
              region            region


                                         HBcAg   Virion


                                HBeAg            Serum
VARIANTS NÉGATIFS POUR L ’AgHBe

1762-1764       1896
PROMOTEUR PRE-C                             C

   *        *     *
                 TAG


                                                                mRNA

                                                                Protéine
                                                                pré-C/C
                       arrêt des synthèses protéiques
                       Diminution de l’expression de l ’AgHBe
Main pre-c/core promoter mutations observed in vivo

                                                Basic core promoter
                         LEF
                                                                  Pre-C mRNA
   AGGTCA        HNF4
                                1762 64 66 68

         GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCATAAATT
                                  TGA TTA
  GGTTAATNATTA         HNF1         TTG
                                                HNF3     WTRTTKRY


               Deletion 63-70
    Insertion (RGTTAATYATTA) at 74/75                  Insertion (TTG) at 66/67
Mutation AGG to TCA and insertion TA at 65/66
Sélection des mutants pré-core au cours de
 l’histoire naturelle de l’hépatite B chronique
                  AgHBe      Anti-HBe
ALAT
           2500
ADN-VHB    2000
           1500
           1000
            500
             0                             temps
           100
sauvage
            80
            60
Mt pré-C    40
            20
             0                             temps
Outcome of Chronic Anti-HBe Positive Hepatitis B
                   Biochemical patterns in 164 untreated patients
                  after 23 months (range 12-36) monthly monitoring
    400
                         With flares     and normalization                      73 pts
    300
                                                                              ( 44.5% )
    200

    100
                                                                                       Asymptomatic
                                                                                         flare-up:
      0                                                                                90% of cases
    400
A                                 Without flares                                59 pts
    300
L                                                                             ( 36.0% )
    200                                                                                   Flare-up yearly
T
    100                                                                                     frequency:
                                                                                           once 57.1%
      0                                                                                      twice 20%
                                                                                           < once 22.8%
                       With flares and   without normalization
    400
                                                                                32 pts
    300
                                                                              ( 19.5% )
    200

    100

          0
              0                          12                         24
                                                      months
                                                                 Brunetto MR et al, J Hepatol 2002
Augmentation de prévalence des hépatites
     chroniques avec AgHBe négatif en France




                            62%        48%     HBeAg(+)
                                       N=119   HBeAg(-)
                            N=164




Zoulim et al, J Viral Hepatitis 2006
Pre-core mutations



  Both mutations                         No pre-core mutation
  (n = 95; 33.6%)                           (n = 42; 14.8%)
                                                                Data unavailable
                                                                 (n = 12; 4.2%)




                                                                Stop codon mutation
                                                                   (n = 55; 19.4%)
                             Promoter mutation
                               (n = 99; 27.9%)


Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
HBe serotype and pre-core mutations

                          90
                          80         HBe-positive
     Number of subjects




                          70         HBe-negative
                          60
                          50
                          40
                          30
                          20
                          10
                          0
                               No pre-core    Stop codon   Promoter     Both
                                mutation       mutation    mutation   mutations

Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
MUTANTS PRÉ-C ET SÉVÉRITÉ HISTOLOGIQUE
           LA CONTROVERSE
    • Italie
       – Cirrhose plus fréquente
             • Bonino Gastroenterology 1986, Fattovich Hepatology 1988
    • France
       – Activité idem / cirrhose plus fréquente
             • Zarski et al, J Hepatol 1993
             • Grandjacques et al, J Hepatol 2000
             • Zoulim et al, J Viral Hepatitis 2006
    • Asie
       – Mt promoteur : activité histologique et fibrose plus importante
       – Mt pré-C : activité histologique moins importante
             • Lindh et al, J Infect Dis 1999
       – Rémission histologique
             • Chan et al, Hepatology 1999
    • Afrique
       – Mt promoteur : plus fréquents dans le CHC
             • Baptista et al, Hepatology 1999
HBe serotype and liver pathology


                                                          HBe-positive
                                                          HBe-negative



                     70                                      70
Number of subjects




                     60                                      60
                     50                                      50
                     40                                      40
                     30                                      30
                     20                                      20
                     10                                      10
                     0                                       0
                          0-4     5-9     10-14   15-22             ≤ F2         F3        F4

                                Knodell score                              Metavir score

Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
HÉPATITES FULMINANTES ET MUTANTS PRE-C
       • Lien de causalité :
           – Épidémies hépatites fulminantes
           – Transmission souche mutée pré-C (-)
           – Rôle immunomodulateur de l ’AgHBe
       • Pas de lien de causalité
           – Séquençage génome complet
           – Pas de profil commun de mutation
       • Sélection des mutants par la réponse immunitaire cytotoxique
          dirigée contre la souche à l ’origine de l ’HF
Stuyver et al, Hepatology 1999, Sternbeck et al Hepatology 1996, Liang et al, NEJM 1991
DIAGNOSTICS DIFFICILES

    I. Porteur inactif
    II. Exacerbation
Diagnosis of inactive carrier versus
 HBeAg negative chronic hepatitis
• Inactive Carrier
  – Persistently normal ALT levels
  – Persistently low levels of serum HBV DNA
     • Threshold : 2,000 IU/ mL ?
• HBeAg negative chronic hepatitis
  – Fluctuation / exacerbation of ALT
  – Fluctuations of HBV DNA levels usually below 6
    log IU/ mL
  – Presence of pre-core / core promoter mutations
DIAGNOSTIC D'UNE EXACERBATION AIGUE
     SUR HEPATITE B CHRONIQUE
  • Définition : poussée cytolytique
  ≠ réactivation virale

  • Ag HBe + initialement
     – rupture de tolérance immunitaire
     – séroconversion anti-HBe
     – très fréquent chez patients asiatiques
  • Anti-HBe + initialement
     – réactivation virus sauvage : -> AgHBe +
     – réactivation virus muté pré-C (-)
     – corticothérapie
     – surinfection delta / VHC
Pichoud et al, J hepatol 2000



                                 interferon
  HBeAg                  +        +           -       -   -       -        +    -
  Anti-HBe Ab            -        +           +       +   +       +        -    +
                25                                                                       10000000000

                                                                                         1000000000

                20                                                                       100000000

                                                                                         10000000

                15                                                                       1000000


  case#6        10
                                                                                         100000

                                                                                         10000            ALT


Genotype A                                                                               1000
                                                                                                          pre-S1


                     5                                                                   100              bDNA

                                                                                         10               PCR


                     0                                                                   1
                                                                                                 months
                         0            1           2   5       9       12   13   16

   pre-C promoter
   WT                        -            -           +   +                -    +
   MT                        +            +           +   -                +    -
   pre-C region
   WT                        +            +           +   +                +    +
   M2                        -            -           -   -                -    -
   M4                        -            -           -   -                -    -
   M2+M4                     -            -           -   -                -    -
PreS2
                                                                                      PreS1


                                                                                                    Pol                    S



            HBs Ag                                                                                 0/3221




                                                                                                              GR
                                                                                                                E
                                                                                              Brin(-) 3,2kb
                                                                                              Brin(+) 2,4kb

SHBs (S)                                                                                  TATAA

MHBs (preS2+S)                       « a » determinant                                      U5-like
                                                                                             DR1
                                                                                                  Enh2   Enh1
                                                                                  C                  DR2
LHBs (preS2+preS2+S)                               S-S
                                               sP120T                                   Pré-C


                                                                                                     X



                                                     137  S- S
                                                   138           149
                                        107      S-S     S-S      147
                                                   139             sG145R
                                                                  sD144H/A/E
                                        99                       NH2                                S-S




                                                                                                                    COOH


         « a » determinant induces the synthesis of
            anti-HBs neutralizing antibodies
            Tiollais P. et al., Nature 1985. Torresi J., J. Clin Virol 2002; Dryden KA. et al., Mol Cell 2006
Variants de l'Ag HBs


• échappement à la réponse humorale anti-HBs

   – naturelle

   – vaccination (transmission mère-enfant)

   – immunoprophylaxie (transplantation hépatique)

• infection active malgré Ac anti-HBs

• sérologie AgHBs faussement négative

á Risques : transmission virale + infections occultes
VARIANTS DE L'AgHBs

• Mutations ponctuelles dans le déterminant a de
 l'AgHBs (124-147)
   – aa 145 : Gly -> Arg
   – aa 126 : Ile -> Ser / Thr -> Asn
• transmission mère-enfant malgré la serovaccination
 (3%)
• infection du greffon hépatique malgré
 Immunoglobulines anti-HBs
• hépatites chroniques avec anti-HBc et anti-HBs +
Occult HBV Infection (OBI)

Presence of HBV DNA in the liver (± serum) of
individuals testing HBsAg negative by currently
               available assays




                              Raimondo et al, J Hepatol 2008
How to Detect Occult HBV Infection



     Currently there is no standardized
  diagnostic assay for occult HBV infection
Reported Prevalence of Occult HBV Infection in HIV Positive Patients
                                                     Occult
            Study          Country       N° of        HBV                   Methods
                                        patients     N° (%)

  Hofer, 1998            Switzerland      57       51 (89%)              “nested” PCR
                                                                       (serial evaluation)
  Torres-Baranda, 2006     Mexico         35
                                                    7 (20%)               “nested” PCR

  Filippini, 2006           Italy         86       17 (20%)             single step PCR

  Mphahlele, 2006        South Africa     140      31 (22.%)              “nested” PCR

  Pogany, 2005           Netherlands       93      4 (4%)               single step PCR

  Neau, 2005               France         160      1 (0.6%)            Cobas Amplicor HBV
                                                                         Monitor (Roche)
  Santos, 2003              Brazil        101      16 (16%)             single step PCR

  Wagner, 2004             France          30      11 (37%)               “nested” PCR


  Goncales, 2003            Brazil        159       8 (5%)                “nested” PCR

  Nunez, 2002               Spain          85          0                Cobas Amplicor HBV
                                                                          Monitor (Roche)
  Piroth, 2000             France          37      13 (35%)              single step PCR
  Raffa, 2007               Italy         101      42 (41%)         “nested” PCR (liver)

                                                           Raimondo et al, J Hepaol 2007, modified
Cause(s) for the
        failure of HBsAg detection


      OBI                “false” OBI

  Suppression of
                           Infection by
HBV replication and
                         S gene Variants
 gene expression
HBV replication



                      HBV cccDNA                        Integrated HBV DNA




          HBV mutants              Epigenetic control

Immune surveillance
Viral co-infections

                                   Occult HBV infection
Schematic representation of HBV serum marker profile in OBI and
                          “false” OBI


                             OBI                                      „false“ OBI
                         HBV DNA levels
                           < 200 UI/ml




 Seropositive                                                                S gene
                                                                             S gene
 Seropositive                                       Seronegative
                                                    Seronegative         escape mutants
                                                                         escape mutants




                                   Primary occult                        HBV DNA levels
                HBsAg lost
                HBsAg lost         Primary occult
                                                                          comparable to
                 after AH
                 after AH                                                 overt infection


HBsAg lost
HBsAg lost                                     Progressive antibody
                                               Progressive antibody
during CH
 during CH                                        disappearence
                                                  disappearence
Occult hepatitis B
Torbenson M. & Thomas D.L., Lancet Inf Dis, 2002
Occult HBV infections: unresolved issues
                                   Diagnostic
  Specific                                       To be
  treatments ?                                   improved
                      High             Tools ?
                   prevalence




Co-infections ?
Therapy?                        ROLE
                  Worsen
                   HCV           in
                  infection ?   HCC       Not fully
                                          understood ?
Antiviraux
   Persistance virale
Resistance aux antiviraux
Monitoring des traitements
HBsAg
Immunotolerant              Immuno-active   Inactive phase                                      Occult infection
                                                                   Reactivation phase
   phase                       phase        Low replication

                 HBeAg(+)                            HBeAg(-) / anti-HBe(+)

   HBV DNA




109-1012 IU/mL          >2000-<109 IU/mL        <2000 IU/mL          >2000 IU/mL



     ALAT


 Minimal CH         Moderate to severe CH          Remission            Moderate to severe CH

                            Cirrhosis         Inactive cirrhosis                 Cirrhosis


                     Treatment indicated                               Treatment indicated



                                                               Adapted from Fattovich G. Sem Liver Dis. 2003
Endpoints of therapy

Persistence of high viral load is associated with a significant risk of progression of
                             the liver disease and of HCC

                             Aim of antiviral therapy:
      HBV DNA < 10-15 IU/mL by real-time PCR assays


    Viral suppression                                                      No replication
                                                                                 =
Histological and clinical                                                  No resistance
     improvement

                  Chen CJ, et al. JAMA 2006. Iloeje UH, et al. Gastroenterology 2006. Chen C, et al.
         Am J Gastroenterol 2006. Zoulim & Perrillo J Hepatol 2008. Zoulim & Locarnini Gastroenterology 2009
Antivirals approved for hepatitis B

Drug Type                            Approved                Phase 3            Phase 2
Nucleoside analogs             • Lamivudine*            • Emtricitabine*   • Elvucitabine
                               • Entecavir              • Clevudine**      • Valtorcitabine
                               • Telbivudine                               • Amdoxovir
                                                                           • Racivir
                                                                           • LB80380
Nucleotide analogs             • Adefovir dipivoxil                        • Alamifovir
                               • Tenofovir*                                • Pradefovir

Cytokines                      • Interferon alfa
                               • Pegylated Interferon
                               alfa-2a

 *Currently approved for HIV
 **development on hold
Treatment failure


Primary non response                        Secondary treatment failure
Partial response                            Antiviral drug resistance


Host factors                                Drug factors
Drug metabolism                             Barrier to resistance
Patient’s compliance
                                            Viral factors
Drug factors                                Resistant mutants
Antiviral potency

                        Zoulim & Perrillo J Hepatol 2008; EASL CPG J Hepatol 2009
Clinical definition of resistance

• Virologic Breakthrough: Rebound in serum HBV DNA levels
  (e.g. 1 log10 above nadir)
• Genotypic Resistance: Detection of mutations known to
  confer resistance while on therapy
• Virologic Breakthrough with Genotypic Resistance: Viral
  rebound associated with a mutation(s) known to cause
  resistance.
• Primary non response: <1log10 decrease of viral load after 3
  months
• Partial response: detectable HBV DNA levels during therapy
        Zoulim & Perrillo, J Hepatol 2008; EASL CPG, J Hepatol 2009
Laboratory Definition of HBV Resistance to Antivirals


Laboratory Investigations
• Phenotypic Resistance: Decreased susceptibility (in vitro testing) to
  inhibition by anti-viral drugs associated with genotypic resistance.

• Cross Resistance: Mutants selected by one agent that also confer
  resistance to other antiviral agents




                                                    Zoulim et al; Future Virology 2006
Kinetics of emergence of HBV drug resistant mutants




Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004;
Villet et al Gastroenterology 2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
Lamivudine Resistance Accelerates
           Progression of Liver Disease
25         Placebo (N=215)
           YMDDm (N=209) (49%)                                       Placebo              21%
20         Wild Type (N=221)

15
                                                                      YMDDm               13%

10

                                                                           WT             5%
 5

 0
     0       6           12           18              24              30             36
                     Time after randomization (Months)



                                   Liaw YF et al. N Engl J Med. 2004;351:1521-1531
Biochemical and Histologic
              Correlates of HBV Resistance
  • Rise in ALT levels
        – Mild ALT elevations in most cases
        – ALT flares with acute exacerbations and liver failure:
          especially patients with liver cirrhosis and/or pre-core
          mutant infection

  • Progression of liver disease
        – Progressive worsening of liver histology
        – Clinical deterioration, liver decompensation, HCC
          development
Lai et al Clin Infect Dis 2003; 36: 687-696; Dienstag et al Gastroenterology 2003;124:105-117 ; Lok et al Gastroenterology
2003; 125 : 1714-1722; Hadziyannis et al Hepatology 2000;32:847-851; Si Ahmed et al Hepatology 2000; Zoulim et al J Viral
Hepatitis 2006;13:278-288 ; Fung et al J Hepatol 2005;43:937-943; Liaw et al NEJM 2004;351:1521-1531.
ALT flares in patients with lamivudine
        resistance over time




                         Lok et al Gastroenterology 2003; 125 : 1714-1722
Incidence of drug resistance over time

                                          Resistance at year of therapy expressed as percentage of
                                                                   patients

  Drug and patient population                 1            2           3           4           5      6

Lamivudine                                   23            46         55          71          80       -

Telbivudine HBeAg-Pos                        4.4           21          -           -           -       -

Telbivudine HBeAg-Neg                        2.7          8.6          -           -           -       -

Adefovir HBeAg-Neg                            0            3           6          18          29       -
Adefovir (LAM-resistant)                  Up to 20%         -          -           -           -       -

Tenofovir                                     0            0           0           -           -       -

Entecavir (naïve)                            0.2          0.5         1.2         1.2         1.2     1.2

Entecavir (LAM resistant)                     6            15         36          46          51      57

            CL Lai Clin Infect Dis 2003; CL Lai NEJM 2007; Hadzyiannis Gastroenterology 2006;
            Marcellin NEJM 2008; CL Lai & Chang NEJM 2006; Zoulim & Locarnini Gastroenterology 2009
Zoulim & Locarnini, Gastroenterology, 2009
HBV
                   HBV                                                     HBV
                                                                           HBV                         hepatocytes
                                                                                                       hepatocytes
     viral polymerase spontaneous                             cccDNA long half-life                    infected cells long
                                        mutant archiving
     error rate                                                                                        half-life




    mutant                                       wild type

                                                                                                              defective immune
                                                                                                                  response
                                       viral quasi-                                      viral
                                          species                                     persistence
                          host
                          host
          selective pressure                                                                selection of
                                                                                            selection of
          antivirals or others                                                            escape mutants
                                                                                          escape mutants

                                                                                        replication fitness
                                                                                        replication space
                                            immune response
                                         drug pharmacodynamics


                                                                                                     Virus spread in the
                                                           treatment failure                         liver
                                                                       +

Zoulim et al., Gastroenterology 2009
                                         Disease progression / HCC development
L(-)-SddU

   mitochondria                        deaminase


                                                                  L(-)-SddC, 3TC
Mt DNA            L(-)-SddC-TP           L(-)-SddC                 Lamivudine

                                         kinase

                        L(-)-SddC-TP                    HBV DNA


                  nucleus

                       L(-)-SddC-TP
                                                                 cytoplasm


                     Nuclear DNA
                                            Bridges; Progress in Liver Disease 1995
The HBV life cycle
                       receptor ?                                                                 Hepatocyte
      Virion
                                      polymerase
         interaction    entry                           Nucleus
                                                              cccDNA formation              transcription
                                                                                              pgRNA
                                                                                                     AAA
                                                                                                    AAA
                                                                                                   AAA
                                                                                                 AAA
                                                          RC DNA         cccDNA               mRNA
                                  cccDNA
                                amplification
                                                                                       translation
                                          DNA (+)          DNA (-)        pgRNA
                           ER

                                           (+) strand            encapsidation
                                           synthesis          reverse transcription                ER

                       virion secretion
                                                                                 viral proteins
                                                                                   secretion


                                                                                                         HBsAg
                                                Nucleoside
                                                 analogs                         HBeAg
Zoulim et al Future Virology 2006
Formation of the recalcitrant cccDNA: a difficult
     target for antiviral therapy

uncoating              CCC DNA                       supercoiled DNA
                                                     minichromosome




                                                       topoisomerase?
               removal of protein primer               Acetyl transferase ?
                                                       Histones
               removal of RNA primer
               completion of viral (+) strand DNA
               ligation of DNA strands extremities

Antivirals ?
                viral polymerase?
                                                        Tuttleman et al Cell 1986
                DNA repair protein?                     Le Guerhier et al AAC 2000
                other cellular enzymes?                 Delmas et al AAC 2002
                                                        Kock et al Hepatology 2003
Can we prevent cccDNA formation ?
Nucleoside analogs in monotherapy or
combination therapy cannot prevent the de
novo formation of cccDNA in hepatocyte
culture and in vivo in animal experiments
(Delmas et al AAC 2000; Seigneres et al AAC 2002)
Can we clear cccDNA from a chronically
infected cell ?
The decrease of intrahepatic cccDNA during
nucleoside analog requires hepatocyte turn
over in animal experiments
(Zhu et al J Virol 2001; Litwin et al J Clin Virol 2005)
Kinetics of Viral Loss During Antiviral Therapy with L-
      FMAU (clevudine) in the woodchuck model




                                      Zhu et al, J Virol 2001
ADV Associated Serum HBsAg Reductions are
 Similar in Magnitude to cccDNA Reductions
                                       Serum       Total
                                  0     HBV    Intracellular   cccDNA         Serum
      Changes in HBV Markers

       (log 10 copies/cell(ml))
                                        DNA        DNA                        HBsAg
                                  -1
           from Baseline



                                  -2

                                  -3

                                  -4

                                  -5

                                  -6

   48 weeks of ADV resulted in significant reductions in :
   serum HBV DNA > total intrahepatic HBV DNA > cccDNA
    Changes in HBsAg levels correlated with cccDNA changes
 -> 14 years of therapy to clear completely viral cccDNA
                                                                        Werle et al, Gastroenterology 2004
Immunohistochemical Staining of Patient Biopsies at
        Baseline and After 48 Weeks ADV Therapy




    Baseline                                       Week 48
• 0.8 log10 (84%) decline in cccDNA, not paralleled by a similar decline in the number of
  HBcAg+ cells
• Suggests cccDNA depleted primarily by non-cytopathic mechanisms or that cell turn-over
  occurred but was associated with infection of new cells during therapy
Persistence of cccDNA after HBs seroconversion




                                         Maynard et al, J Hepatol 2005
Clearance of viral infection versus selection of
                escape mutants
The most important factors to consider:
§ The rate of immune killing of infected hepatocytes
§ The rate of replication and spread of mutant virus in the
   chronically infected liver (I.e. fitness of the virus: the rate of
   spread to uninfected hepatocytes)
§ Small changes in these factors may have profound effect on
   whether treatment response is durable or subject to rapid
   rebound (Litwin et al J Clin Virol 2005)
§ These factors may be subject to therapeutic intervention
Kinetics of emergence of drug resistant virus
during antiviral therapy
                                Lamivudine

  wt                   mt


                              X                     X                   X

                              X

                              X                                                • Free liver space

                              X                                                • Mutant fitness

                              X
  ni

  I                     II                    III               IV
  INHIBITION OF WILD TYPE VIRUS REPLICATION             DELAYED EMERGENCE OF
                                                        DRUG RESISTANT VIRUS
                                                                                   Zhou et al AAC 1999
Kinetics of HBV drug resistance emergence
                                                                                         Drug-susceptible virus
                            Treatment begins
                                                                                         Naturally—occurring viral variants

                                                                                         Drug-resistant variant


                                                                              Secondary resistance mutations
          HBV replication




                                                                           / compensatory resistance mutations

                                                        Primary resistance
                                                            mutations




                                                               Time
Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology
2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
Partial response to adefovir dipivoxil is not due to the
                        selection of DR mutants
•       The top 25% patients (quartile 1): > 4.91 log10 reduction in serum HBV DNA at week 48.
•       In Q2: 3.52 to 4.90 log10 reduction of viral load.
•       In Q3: 2.22 to 3.51 log10 reduction in viral load.
•       The bottom 25% of patients (Q4):< 2.22 log10 reduction in HBV DNA levels at week
        48.
•       Phenotypic analysis of viral strains: Q4 as sensitive to ADV as Q1 strains
•       Documented Drug Compliance (% of days without taking ADV)


               Virological Response      Virological Response   Virological Response       Virological Response
                Q1 (best response)                Q2                     Q3                Q4 (worse response)
                      (n=38)                    (n=38)                 (n=38)                     (n=38)


Median                99%                       99%                    99%                        97% a


range               86-100%                   41*-100%               91-100%                    70-100%




•       Wilcoxon rank sum test, P=0.01
                                                                           Durantel et al, Antiviral Therapy, 2008
Amino acid substitutions result in conformation
  changes of the polymerase catalytic site
  Wild-type M204/L180                 LVDr M204V/L180M

                   L180                                        L180M

       M204                               M204V




                    LVD-TP                                       LVD-TP

  LVDr M204V/L180M
                                  M204V reduces pocket size
                   L180M          Steric clash between lamivudine and V204
     M204V




                              Minimal steric clash between entecavir and
                     ETV-TP   V204

                              Langley DR, et al. J Virol. 2007;81:3992-4001.
Polymerase gene mutations may result in decreased
                inhibitory activity of antivirals

          wt polymerase      3TC-R polymerase     PMEA-R polymerase     3TC+PMEA-R polymerase
Drug      IC50 (µM)   P      IC50 (µM)  P         IC50 (µM)  P          IC50 (µM) P

Elongation
  FLG-TP 4 ± 0.9             5.43 ± 0.6           7.8 ± 1.9             6.33 ± 1.3
  3TC-TP 10.75 ± 4.8 <0.05   >100         <0.05   14 ± 5.7     <0.05    >100         <0.05
  PMEA-DP 2.8 ± 0.3  >0.05   0.9 ± 0.1    <0.05   49.5 ± 3.4   <0.05    16.5 ± 7.2   <0.05




                                                         Jacquard et al, Antimicrob Agents Chemother 2006
Definition of fitness

• A parameter that quantifies the adaptation of an
  organism or a virus to a given environment

• For a virus, ability to produce infectious progeny
  relative to a reference viral clone, in a defined
  environment



                            Esteban Domingo, In Fields Virology 2007
HBIg
                                                               adefovir

                                                  lamivudine                                           wt
                                                                                                       Mutant #1
                                                                                                       Mutant #2
                                                                                                       Mutant #3
                                                                                                       Mutant #4



                                 Polymerase clonal genetic analysis



                      Polymerase gene mutations                                    Surface gene mutations
wt                                 none                                                       none
mutant #1   T128I; V173L; L180M; A181V;   N236T                       F20S; P120S; E164D; L173F
mutant #2            T128I; V173L; L180M; A181V; M204V                        R79H; P120S; E164D; L173F; I195M; Y206F
mutant #3   ∆111-120; T128I; V173L; L180M; A181V                      F20S;     ∆102-111; P120S; E164D; L173F
mutant #4    T128I; V173L; L180M; A181V; M204V; L220I; N236T                     P120S; E164D; L173F; I195M




                                                                          Villet et al, Gastroenterology 2006
Viral replication capacity in the presence of both
            antivirals (LAM + ADV)

                                             400
      Mutant replication capacity / wt (%)



                                             350


                                             300

                                             250

                                             200

                                             150


                                             100

                                              50

                                               0

                                                   wt   #1   #2   #3   #4           Mutant




                                                                        Villet, Billioud et al, Gastroenterology 2008
Infectivity of the mutants in HepaRG cells
Impact of mutations in the overlapping S gene
            HDV hybrids with HBV mutant envelopes
     HDV replication in HepaRG cells as a reporter of infection
                                                                       Mutant
           A
                                                   wt   #1        #2        #3       #4



                                                                                               1,7 kb




          B
               Mutant infectivity / wt (%)




                                             120

                                             100

                                             80

                                             60

                                             40

                                             20

                                              0
                                                        wt   #1        #2       #3   #4   Mutant

                                                                                          Villet, Billioud et al, Gastroenterology 2008
Archiving of viral variants
                                                                                   Viral quasispecies
                  Liver
                                                                                            Majority population
                                                                                            Minority variants
                                                                                            Resistant variants

                                                                                            cccDNA variants



                                                                           •    cccDNA in the liver:
                                                                                  – Is propagated during the normal
                                                                                    replication cycle of HBV
                                                                                  – Can serve as a template for the
                                                                                    production of new virus




           Blood circulation

Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
Archiving of viral variants
                                                                                    Viral quasispecies
                  Liver
                                                                                             Majority population
                                                                                             Minority variants
                                                                                             Resistant variants

                                                                                             cccDNA variants


                                                                           •    cccDNA in the liver:
                                                                                –     Is propagated during the normal replication
                                                                                      cycle of HBV
                                                                                –     Can serve as a template for the production of
                                                                                      new virus

                                                                           •    It is believed that viral variants with antiviral
                                                                                resistance may be archived in this way


           Blood circulation

Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
Archiving of viral variants
                                                                                    Viral quasispecies
                  Liver
                                                                                             Majority population
                                                                                             Minority variants
                                                                                             Resistant variants

                                                                                             cccDNA variants


                                                                           •    cccDNA in the liver:
                                                                                –     Is propagated during the normal replication
                                                                                      cycle of HBV
                                                                                –     Can serve as a template for the production of
                                                                                      new virus

                                                                           •    It is believed that viral variants with antiviral
                                                                                resistance may be archived in this way


           Blood circulation

Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
Phenotyping of HBV clinical isolates




                                                                                                           Cl ne A in
                                                                                                             o ra
                                                                                     Southern blot




                                                                                                           Cl e D
                                                                                                           Cl e C

                                                                                                                eE
                                                                                                           Cl A
                                                                                                           Cl b St

                                                                                                               e


                                                                                                             on
                                                                                                             on
                                                                                                             on
                                                                                                             on
                                                                                     analysis




                                                                                                            La
                             Whole genome
                             HBV clones
                PCR                            Transfection
                cloning


      Patient                                                            HepG2
      serum                                                              Huh7
                                                                                              lamivudine      adefovir
                   Cell culture plate
                                                                                       RC
                                                                                       -
   Wild-type
   virus                                                                               SS -


   Patient’s
                                                              Fold resistance
   virus                                                                          IC50 mutant
                                                              =
                                                                             IC50 reference strain
                   Increasing antiviral concentration



1. Durantel D, et al., Hepatology, 2004;40:855-64. 2. Yang H, et al., Antiv Ther, 2005;10:625-33.
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs

Weitere ähnliche Inhalte

Was ist angesagt?

Zoulim du 2015
Zoulim  du 2015 Zoulim  du 2015
Zoulim du 2015 odeckmyn
 
Occult hepatitis B virus infection
Occult hepatitis B virus infectionOccult hepatitis B virus infection
Occult hepatitis B virus infectionDr.Arifa Akram
 
Ocult Hepatitis B Infection
Ocult Hepatitis B InfectionOcult Hepatitis B Infection
Ocult Hepatitis B Infectionyamameen
 
Hbv reactivation
Hbv reactivationHbv reactivation
Hbv reactivationyamameen
 
Hcv presentation
Hcv presentationHcv presentation
Hcv presentationdoczia
 
Hepatitis b(surface antigen) strip method
Hepatitis b(surface antigen) strip methodHepatitis b(surface antigen) strip method
Hepatitis b(surface antigen) strip methodmassab bashir
 
Hepatitis B Virus in transfusion
Hepatitis B Virus in transfusionHepatitis B Virus in transfusion
Hepatitis B Virus in transfusionSUJAY BHOWMIK
 
Update on prevalence, diagnosis and treatment of Hepatitis B Virus
Update on prevalence, diagnosis and treatment of Hepatitis B VirusUpdate on prevalence, diagnosis and treatment of Hepatitis B Virus
Update on prevalence, diagnosis and treatment of Hepatitis B VirusProf. Hesham N. Mustafa
 
AN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS C
AN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS CAN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS C
AN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS Cicsp
 
Samuel hbv lt du hepatite 1-15
Samuel  hbv lt du hepatite 1-15Samuel  hbv lt du hepatite 1-15
Samuel hbv lt du hepatite 1-15odeckmyn
 
Chronic hbv infection diagnosis and management dr neeraj nagaich
Chronic hbv infection diagnosis and management dr neeraj nagaichChronic hbv infection diagnosis and management dr neeraj nagaich
Chronic hbv infection diagnosis and management dr neeraj nagaichDr .Neeraj Nagaich
 
Viral hepatitis
Viral hepatitisViral hepatitis
Viral hepatitisLm Huq
 
W5 HIV, HCV, and HBV Co-Infection Jayaweera
W5 HIV, HCV, and HBV Co-Infection JayaweeraW5 HIV, HCV, and HBV Co-Infection Jayaweera
W5 HIV, HCV, and HBV Co-Infection JayaweeraDSHS
 

Was ist angesagt? (20)

Zoulim du 2015
Zoulim  du 2015 Zoulim  du 2015
Zoulim du 2015
 
Hepatitis
HepatitisHepatitis
Hepatitis
 
Management Of Chronic Hepatitis B
Management Of Chronic Hepatitis BManagement Of Chronic Hepatitis B
Management Of Chronic Hepatitis B
 
Hepatitis in Swaziland
Hepatitis in SwazilandHepatitis in Swaziland
Hepatitis in Swaziland
 
Occult hepatitis B virus infection
Occult hepatitis B virus infectionOccult hepatitis B virus infection
Occult hepatitis B virus infection
 
HBV EASL 2017
HBV EASL 2017HBV EASL 2017
HBV EASL 2017
 
Ocult Hepatitis B Infection
Ocult Hepatitis B InfectionOcult Hepatitis B Infection
Ocult Hepatitis B Infection
 
Hap (1)
Hap (1)Hap (1)
Hap (1)
 
Hepatitis B
Hepatitis BHepatitis B
Hepatitis B
 
Hbv reactivation
Hbv reactivationHbv reactivation
Hbv reactivation
 
Update on Hepatitis C Virus
Update on Hepatitis C Virus Update on Hepatitis C Virus
Update on Hepatitis C Virus
 
Hcv presentation
Hcv presentationHcv presentation
Hcv presentation
 
Hepatitis b(surface antigen) strip method
Hepatitis b(surface antigen) strip methodHepatitis b(surface antigen) strip method
Hepatitis b(surface antigen) strip method
 
Hepatitis B Virus in transfusion
Hepatitis B Virus in transfusionHepatitis B Virus in transfusion
Hepatitis B Virus in transfusion
 
Update on prevalence, diagnosis and treatment of Hepatitis B Virus
Update on prevalence, diagnosis and treatment of Hepatitis B VirusUpdate on prevalence, diagnosis and treatment of Hepatitis B Virus
Update on prevalence, diagnosis and treatment of Hepatitis B Virus
 
AN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS C
AN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS CAN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS C
AN INNOVATIVE APPROACH TOWARDS THE TREATMENT of HEPATITIS C
 
Samuel hbv lt du hepatite 1-15
Samuel  hbv lt du hepatite 1-15Samuel  hbv lt du hepatite 1-15
Samuel hbv lt du hepatite 1-15
 
Chronic hbv infection diagnosis and management dr neeraj nagaich
Chronic hbv infection diagnosis and management dr neeraj nagaichChronic hbv infection diagnosis and management dr neeraj nagaich
Chronic hbv infection diagnosis and management dr neeraj nagaich
 
Viral hepatitis
Viral hepatitisViral hepatitis
Viral hepatitis
 
W5 HIV, HCV, and HBV Co-Infection Jayaweera
W5 HIV, HCV, and HBV Co-Infection JayaweeraW5 HIV, HCV, and HBV Co-Infection Jayaweera
W5 HIV, HCV, and HBV Co-Infection Jayaweera
 

Andere mochten auch

Lhépatite virale-b-2012
Lhépatite virale-b-2012Lhépatite virale-b-2012
Lhépatite virale-b-2012Hassan HAMALA
 
Grand livre de PubMed
Grand livre de PubMedGrand livre de PubMed
Grand livre de PubMedeveillard
 
CES 2015 wrap up - Disrupt of Be Disrupted
CES 2015 wrap up - Disrupt of Be DisruptedCES 2015 wrap up - Disrupt of Be Disrupted
CES 2015 wrap up - Disrupt of Be DisruptedVidal Chriqui
 
Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...
Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...
Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...Bruno Sbille
 
Key figures of French gas market
Key figures of French gas market Key figures of French gas market
Key figures of French gas market GRTgaz
 
Excavator against gas main
Excavator against gas mainExcavator against gas main
Excavator against gas mainMicAymeric
 
Natural gas, the future of fuel
Natural gas, the future of fuelNatural gas, the future of fuel
Natural gas, the future of fuelGRTgaz
 
La place du power-to-gas dans le système énergétique futur
La place du power-to-gas dans le système énergétique futurLa place du power-to-gas dans le système énergétique futur
La place du power-to-gas dans le système énergétique futurVéronique SEEL (Michaut)
 
Gas: the future of energy by GRTgaz
Gas: the future of energy by GRTgazGas: the future of energy by GRTgaz
Gas: the future of energy by GRTgazGRTgaz
 
Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...
Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...
Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...006148
 
Déposer une thèse dans TEL ou HAL
Déposer une thèse dans TEL ou HALDéposer une thèse dans TEL ou HAL
Déposer une thèse dans TEL ou HALOAccsd
 

Andere mochten auch (20)

Lhépatite virale-b-2012
Lhépatite virale-b-2012Lhépatite virale-b-2012
Lhépatite virale-b-2012
 
Propriété intellectuelle février 2012
Propriété intellectuelle février 2012Propriété intellectuelle février 2012
Propriété intellectuelle février 2012
 
Grand livre de PubMed
Grand livre de PubMedGrand livre de PubMed
Grand livre de PubMed
 
CES 2015 wrap up - Disrupt of Be Disrupted
CES 2015 wrap up - Disrupt of Be DisruptedCES 2015 wrap up - Disrupt of Be Disrupted
CES 2015 wrap up - Disrupt of Be Disrupted
 
Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...
Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...
Des outils du monde de la psychologie pour les équipiers, les coachs ou les ...
 
Windows 10 - Découverte - Usages au quotidien
Windows 10 - Découverte - Usages au quotidienWindows 10 - Découverte - Usages au quotidien
Windows 10 - Découverte - Usages au quotidien
 
clase_9mayo_Curso Fotografia histórica (2)
clase_9mayo_Curso Fotografia histórica (2)clase_9mayo_Curso Fotografia histórica (2)
clase_9mayo_Curso Fotografia histórica (2)
 
clase 17en curso Fotografia histórica (muros 1)
clase 17en curso Fotografia histórica (muros 1)clase 17en curso Fotografia histórica (muros 1)
clase 17en curso Fotografia histórica (muros 1)
 
VAN AFVAL NAAR ENERGIE
VAN AFVAL NAAR ENERGIEVAN AFVAL NAAR ENERGIE
VAN AFVAL NAAR ENERGIE
 
Key figures of French gas market
Key figures of French gas market Key figures of French gas market
Key figures of French gas market
 
Excavator against gas main
Excavator against gas mainExcavator against gas main
Excavator against gas main
 
Natural gas, the future of fuel
Natural gas, the future of fuelNatural gas, the future of fuel
Natural gas, the future of fuel
 
La place du power-to-gas dans le système énergétique futur
La place du power-to-gas dans le système énergétique futurLa place du power-to-gas dans le système énergétique futur
La place du power-to-gas dans le système énergétique futur
 
Gas: the future of energy by GRTgaz
Gas: the future of energy by GRTgazGas: the future of energy by GRTgaz
Gas: the future of energy by GRTgaz
 
Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...
Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...
Mediat bibliothèques et droit de l'information [lecture seule] [mode de compa...
 
Theories of corrosion
Theories of corrosionTheories of corrosion
Theories of corrosion
 
Déposer une thèse dans TEL ou HAL
Déposer une thèse dans TEL ou HALDéposer une thèse dans TEL ou HAL
Déposer une thèse dans TEL ou HAL
 
Prevention of corrosion
Prevention of corrosionPrevention of corrosion
Prevention of corrosion
 
Cathodic and anodic protection
Cathodic and anodic protectionCathodic and anodic protection
Cathodic and anodic protection
 
Corrosion
CorrosionCorrosion
Corrosion
 

Ähnlich wie Zoulim Hbv EpidéMio Marqueurs

Zoulim du 2012
Zoulim du 2012Zoulim du 2012
Zoulim du 2012odeckmyn
 
Hépatite B.pdf
Hépatite B.pdfHépatite B.pdf
Hépatite B.pdfodeckmyn
 
Hepatitis and travellers 15.04.11 isom
Hepatitis and travellers 15.04.11 isomHepatitis and travellers 15.04.11 isom
Hepatitis and travellers 15.04.11 isomPeter Noone
 
Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...
Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...
Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...HMO Research Network
 
3.the cost effectiveness & real world impact of quadrivalent
3.the cost effectiveness & real world impact of quadrivalent3.the cost effectiveness & real world impact of quadrivalent
3.the cost effectiveness & real world impact of quadrivalentTofik Apik
 
Viral hepatitis-a-b-c-d.pp
Viral hepatitis-a-b-c-d.ppViral hepatitis-a-b-c-d.pp
Viral hepatitis-a-b-c-d.ppHugo Pinto
 
PrecriptionPiont - 2.ppt
PrecriptionPiont - 2.pptPrecriptionPiont - 2.ppt
PrecriptionPiont - 2.pptRajKumarSingha5
 
Humanretroviruses 120401050128-phpapp01
Humanretroviruses 120401050128-phpapp01Humanretroviruses 120401050128-phpapp01
Humanretroviruses 120401050128-phpapp01Sarah Abhinay
 
Viral hepatitis MBBS HCV,HEV- (2015) (1).pptx
Viral hepatitis MBBS HCV,HEV- (2015) (1).pptxViral hepatitis MBBS HCV,HEV- (2015) (1).pptx
Viral hepatitis MBBS HCV,HEV- (2015) (1).pptxDeepikaGupta967065
 
Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...
Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...
Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...Gianfranco Tammaro
 
Epstein barr virus [autosaved]
Epstein barr virus [autosaved]Epstein barr virus [autosaved]
Epstein barr virus [autosaved]Karthick Kumar
 
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouterswvdamme
 
Genital tuberculosis
Genital tuberculosis Genital tuberculosis
Genital tuberculosis PathKind Labs
 
Hepatitis b virus for PG presentation
Hepatitis b virus for PG presentationHepatitis b virus for PG presentation
Hepatitis b virus for PG presentationSreejith SL
 

Ähnlich wie Zoulim Hbv EpidéMio Marqueurs (20)

Zoulim du 2012
Zoulim du 2012Zoulim du 2012
Zoulim du 2012
 
Hépatite B.pdf
Hépatite B.pdfHépatite B.pdf
Hépatite B.pdf
 
Hepatitis and travellers 15.04.11 isom
Hepatitis and travellers 15.04.11 isomHepatitis and travellers 15.04.11 isom
Hepatitis and travellers 15.04.11 isom
 
Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...
Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...
Identification of Prognostic Tumor Markers in HIV Diffuse Large B cell Lympho...
 
3.the cost effectiveness & real world impact of quadrivalent
3.the cost effectiveness & real world impact of quadrivalent3.the cost effectiveness & real world impact of quadrivalent
3.the cost effectiveness & real world impact of quadrivalent
 
Hepatitis virus
Hepatitis virusHepatitis virus
Hepatitis virus
 
Hepatitis
HepatitisHepatitis
Hepatitis
 
Viral hepatitis-a-b-c-d.pp
Viral hepatitis-a-b-c-d.ppViral hepatitis-a-b-c-d.pp
Viral hepatitis-a-b-c-d.pp
 
PrecriptionPiont - 2.ppt
PrecriptionPiont - 2.pptPrecriptionPiont - 2.ppt
PrecriptionPiont - 2.ppt
 
Hepatitis ppt final
Hepatitis ppt finalHepatitis ppt final
Hepatitis ppt final
 
Humanretroviruses 120401050128-phpapp01
Humanretroviruses 120401050128-phpapp01Humanretroviruses 120401050128-phpapp01
Humanretroviruses 120401050128-phpapp01
 
Viral hepatitis MBBS HCV,HEV- (2015) (1).pptx
Viral hepatitis MBBS HCV,HEV- (2015) (1).pptxViral hepatitis MBBS HCV,HEV- (2015) (1).pptx
Viral hepatitis MBBS HCV,HEV- (2015) (1).pptx
 
Hepatitis ppt final
Hepatitis ppt finalHepatitis ppt final
Hepatitis ppt final
 
Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...
Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...
Galati V. Quali sono i principali tipi di infezione? E come si manifestano? A...
 
Epstein barr virus [autosaved]
Epstein barr virus [autosaved]Epstein barr virus [autosaved]
Epstein barr virus [autosaved]
 
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
 
Genital tuberculosis
Genital tuberculosis Genital tuberculosis
Genital tuberculosis
 
Hepatitis b virus for PG presentation
Hepatitis b virus for PG presentationHepatitis b virus for PG presentation
Hepatitis b virus for PG presentation
 
Viral hepatitis 2014
Viral hepatitis 2014Viral hepatitis 2014
Viral hepatitis 2014
 
fungal management
fungal management fungal management
fungal management
 

Mehr von odeckmyn

VHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfantVHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfantodeckmyn
 
Sujets examen DU - 2015
Sujets examen DU - 2015Sujets examen DU - 2015
Sujets examen DU - 2015odeckmyn
 
Examen DU - 2014
Examen DU - 2014 Examen DU - 2014
Examen DU - 2014 odeckmyn
 
Thabut beneferadic16
Thabut beneferadic16Thabut beneferadic16
Thabut beneferadic16odeckmyn
 
Thabut vhc2016duhv
Thabut vhc2016duhvThabut vhc2016duhv
Thabut vhc2016duhvodeckmyn
 
Du 2016 programme v2 a4
Du 2016 programme v2 a4Du 2016 programme v2 a4
Du 2016 programme v2 a4odeckmyn
 
Histoire hcv du 2016
Histoire hcv du 2016Histoire hcv du 2016
Histoire hcv du 2016odeckmyn
 
Du 2016 tp biomarkers
Du 2016 tp biomarkersDu 2016 tp biomarkers
Du 2016 tp biomarkersodeckmyn
 
Thabut1 vhc tt du16
Thabut1 vhc tt du16Thabut1 vhc tt du16
Thabut1 vhc tt du16odeckmyn
 
Zoulim vhb du16
Zoulim vhb du16Zoulim vhb du16
Zoulim vhb du16odeckmyn
 
Zarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpzZarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpzodeckmyn
 
Thabut2 vhc vhb du16
Thabut2 vhc  vhb du16Thabut2 vhc  vhb du16
Thabut2 vhc vhb du16odeckmyn
 
Sos hepatites du16
Sos hepatites du16Sos hepatites du16
Sos hepatites du16odeckmyn
 
Thibault vha vhe- du16
Thibault vha vhe- du16Thibault vha vhe- du16
Thibault vha vhe- du16odeckmyn
 
Rosmorduc carninogenese du16
Rosmorduc  carninogenese du16Rosmorduc  carninogenese du16
Rosmorduc carninogenese du16odeckmyn
 
Roulo tbis vhd-du16
Roulo tbis vhd-du16Roulo tbis vhd-du16
Roulo tbis vhd-du16odeckmyn
 
Rudler hépatites ir du16
Rudler hépatites ir du16Rudler hépatites ir du16
Rudler hépatites ir du16odeckmyn
 
Rudler réinfection vhb du16
Rudler réinfection vhb du16Rudler réinfection vhb du16
Rudler réinfection vhb du16odeckmyn
 
Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16odeckmyn
 
Roulot vhd du16
Roulot vhd du16Roulot vhd du16
Roulot vhd du16odeckmyn
 

Mehr von odeckmyn (20)

VHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfantVHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfant
 
Sujets examen DU - 2015
Sujets examen DU - 2015Sujets examen DU - 2015
Sujets examen DU - 2015
 
Examen DU - 2014
Examen DU - 2014 Examen DU - 2014
Examen DU - 2014
 
Thabut beneferadic16
Thabut beneferadic16Thabut beneferadic16
Thabut beneferadic16
 
Thabut vhc2016duhv
Thabut vhc2016duhvThabut vhc2016duhv
Thabut vhc2016duhv
 
Du 2016 programme v2 a4
Du 2016 programme v2 a4Du 2016 programme v2 a4
Du 2016 programme v2 a4
 
Histoire hcv du 2016
Histoire hcv du 2016Histoire hcv du 2016
Histoire hcv du 2016
 
Du 2016 tp biomarkers
Du 2016 tp biomarkersDu 2016 tp biomarkers
Du 2016 tp biomarkers
 
Thabut1 vhc tt du16
Thabut1 vhc tt du16Thabut1 vhc tt du16
Thabut1 vhc tt du16
 
Zoulim vhb du16
Zoulim vhb du16Zoulim vhb du16
Zoulim vhb du16
 
Zarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpzZarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpz
 
Thabut2 vhc vhb du16
Thabut2 vhc  vhb du16Thabut2 vhc  vhb du16
Thabut2 vhc vhb du16
 
Sos hepatites du16
Sos hepatites du16Sos hepatites du16
Sos hepatites du16
 
Thibault vha vhe- du16
Thibault vha vhe- du16Thibault vha vhe- du16
Thibault vha vhe- du16
 
Rosmorduc carninogenese du16
Rosmorduc  carninogenese du16Rosmorduc  carninogenese du16
Rosmorduc carninogenese du16
 
Roulo tbis vhd-du16
Roulo tbis vhd-du16Roulo tbis vhd-du16
Roulo tbis vhd-du16
 
Rudler hépatites ir du16
Rudler hépatites ir du16Rudler hépatites ir du16
Rudler hépatites ir du16
 
Rudler réinfection vhb du16
Rudler réinfection vhb du16Rudler réinfection vhb du16
Rudler réinfection vhb du16
 
Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16
 
Roulot vhd du16
Roulot vhd du16Roulot vhd du16
Roulot vhd du16
 

Kürzlich hochgeladen

Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Servicevidya singh
 
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...Neha Kaur
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Dipal Arora
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipurparulsinha
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...narwatsonia7
 
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...CALL GIRLS
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...hotbabesbook
 
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...narwatsonia7
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...astropune
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableNehru place Escorts
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...narwatsonia7
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Deliverynehamumbai
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 

Kürzlich hochgeladen (20)

Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
 
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
 
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
 
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
 
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
 
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCREscort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
 

Zoulim Hbv EpidéMio Marqueurs

  • 1. Hépatite B Fabien Zoulim Département d’hépatologie & INSERM U871, Lyon
  • 2. Guérison 30-50 ans VHB HCA cirrhose CHC Vaccin ANTIVIRAUX Antiviraux/IFN? IFN Niederau N Engl J Med 1996 & Liaw N Engl J Med 2004 RESISTANCE VIRALE Lee, N Engl J Med 1997; Lok, Hepatology 2001
  • 4.
  • 5. EPIDEMIOLOGIE DE L'INFECTION A VHB AUX USA • Hépatites aigues – VHA : 40% – VHB : 30% – VHC : 20% • incidence : 300 000 infections à VHB / an • 30 000 nouveaux porteurs chroniques / an • 3 000 décès / an
  • 6. MODES DE TRANSMISSION DU VHB • 1108 habitants de San Francisco • 159 (14%) anti-HBc + • positivité des anti-HBc associée avec – âge – éthnie – degré d'éducation – toxicomanie IV – prostitution – nombre de partenaires sexuels – homosexualité – HIV / HSV 2 / syphilis
  • 7. MODES DE TRANSMISSION DU VIRUS DE L'HÉPATITE B EN EUROPE transfusions contact avec 2% porteur du VHB 4% personnels de santé sexuelle 2% homo hémodialysés 34% 11% 8% hétéro 23% inconnue 31% Asie drogue IV 26% Transmission verticale
  • 8. Déclaration obligatoire de l’hépatite B en France : résultats des 12 premiers mois de notification Denise Antona, E Delarocque-Astagneau, D Lévy-Bruhl département des maladies infectieuses
  • 9. Incidence of acute hepatitis B in France Sentinel networks 1991-1996 et Lyon (COURLY) 1983-1997
  • 10. Circuit de l’information Feuillets 2 et 3 Médecin Biologiste à compléter prescripteur Feuillet 1 : Relance Feuillet 2 : parties 1-2 et parties 3-4-5 6-7 renseignées MISP de DDASS du complétées département d’exercice Feuillets 1 et 2 complétés et validés InVS Fiche de notification autocopiante à 4 feuillets Partie 1 : code d’anonymat irréversible, caractéristiques du patient Partie 2 : information biologique Parties 3-4-5 : information clinique et épidémiologique Parties 6-7 : identification du médecin prescripteur et du biologiste déclarants
  • 11. Results 158 acute hepatitis cases • Hospital doctor in 64% cases • Sex ratio M/F : 2,95 (118/40) • Median age: 37 yrs for males, 36yrs for females • Jaundice : 69% • Hospitalisation : 46% • Fulminant hepatitis : 3 (2 death)
  • 12. Age distribution: comparison of the different periods 1991-94 versus 03/2003 - 02/2004 years 1991- 94 n= 151 March 03- February 04 n= 158
  • 13. Risk exposure within 6 months preceding the acute case Source : obligatory declaration 2003-04 • Source: obligatory declaration march 03- february 2004 N=145 – Sexual 59 40,6% No factor 43 29,6% – IVDU 9 6,2% >1 factor 38 26,3% – Invasive treatment 15 10,3% – Tatoo, piercing 5 3,4% • Sentinel networks 91-96 – Familial 14 9,7% N=195 – Perinatal 2 1,4% – sexual 35% – Live in instiution 11 7,6% – IVDU 19% – « percutaneous » 15% – Travel in endemic 21 14,5% – No factor 35% areas 91/145 patients (63 %) had a vaccine indication (2 vaccinated ≥ 3 doses)
  • 14. Hépatites virales B: épidémiologie - Vaccin mais 400 millions de porteurs chroniques dans le monde - 280 000 porteurs chroniques en France (INVS) - 45% ignorent leur statut - 1 300 décès par an en France - 60 000 avec hépatite chronique active - Seulement 13 000 patients traités
  • 16. LE VIRUS DE L ’HEPATITE B • FAMILLE : Hepadnaviridae, seul représentant humain •VIRUS RESISTANT : - 7 jours dans l’environnement - pendant 5 mn à 100° 10 h à 60° C, C - à la congélation.
  • 17.
  • 18. LE GÉNOME DU VIRUS DE L’HÉPATITE B déterminant a vaccin/IgHBs 8 génotypes A to H Gène pol antiviraux Mt du core Réponse CTL Tiollais Nature 1985 Mt pre-core Günther Adv Virus Res 1999 Réponse anti-HBe ? Norder J Gen Virol 2003
  • 19. Ganem & Prince, NEJM 2004
  • 20. Réplication du génome viral. Implication pour la persistance virale et l’intégration du génome viral Membrane cellulaire ARN pg ds DNA 10% virion ss DNA 90% intégration cccDNA illégitime RC DNA noyau virion cccDNA
  • 21. Modèles Animaux Chimpanzé VHB HUMAIN Souris Transgéniques Souris SCID uPa Tupaia MARMOTTE (WHV) CANARD (DHBV) Summers PNAS 1978, Mason J Virol 1981, Chisari Science 1985, Petersen PNAS 1998
  • 22. Modèles in vitro • Polymerase virale • Culture cellulaire – DHBV : lysat réticulocytaire – Transfection : lignées d’hépatome – HBV : baculovirus – Infection : hépatocytes primaires, HepaRG – Baculovirus ou adenovirus recombinant RC - L- Polymerase VHB DNA(-) DNA( U SS - ELONGATION CCC - Sells PNAS 1987, Wang Cell 1992, Zoulim J Virol 1994, Lanford J Virol 1995, Gripon PNAS 2002, Sprinzl J Virol 2001
  • 23. Cycle de réplication du VHB Zoulim & Locarnini, Gastroenterology 2009
  • 24. Comparative dynamics among three viruses HIV HCV HBV (Ritonav ir) (IFN- ) (Lamivu dine) Plasma virus Half-life 5.8 h 2.7 - 7.2 h 24 h Mea n viral 2.7 d 3.8 - 7.3 d 24.7 d genera tion time Daily t urnover 95% 94% - 99. 8% 50% Daily produ ction 10 10 (1.1 - 10 11 (plasm a) 12.7 )*10 11 Tot al load 1.2*1 0 9 (3.8 - 5.6)*10 10 2*10 11 Infecte d ce lls Half-life 1.6 d 2.4 - 4.9 d 10 - 10 0 d Mea n lifespan 2.3 d 3.5 - 7.1 d 23.3 d Daily t urnover 38% 13% - 25% 1% - 7% (Tsiang et al. Hepatology 1999)
  • 25. Infection à VHB et risque de CHC • Etude de Beasley à Taiwan – risque relatif = 100 chez les porteurs de l'AgHBs • Etude de Tsukuma – risque cumumatif de CHC à 3 ans • 12,5% chez 240 patients avec cirrhose • 3,8% chez 677 patients avec hépatite chronique – risque x 7 si AgHBs + – risque X 4 si anti-HCV + • Facteurs associés : alcool, tabac, aflatoxine • Diminution incidence avec la vaccination de masse (Chen, NEJM 1995)
  • 26. CARCINOME HEPATOCELLULAIRE ET VIRUS DE L'HEPATITE B • Co-incidence de répartition géographique VHB / CHC • Porteurs AgHBs : RR x 100 pour le CHC • CHC dans les modèles animaux de l'hépatite B : – marmotte – écureuil • Présence d'ADN viral intégré dans les tumeurs
  • 27. HBV replication and its role in HCC development Wands, NEJM 2004
  • 28. PATHOGENIE DU CARCINOME HEPATOCELLULAIRE ALCOOL VHB VHC LESIONS HEPATIQUES CHRONIQUES DESORDRES METABOLIQUES ACTIVATION FACTEURS DE CROISSANCE REGENERATION FACTEURS ENVIRONNEMENTAUX ALTERATIONS GENETIQUES CARCINOME HEPATOCELLULAIRE
  • 29. Role du VHB dans l’oncogénèse hépatique REACTION INFLAMMATOIRE CHRONIQUE REGENERATION HEPATIQUE VHB CARCINOGENES INFECTION CHRONIQUE CHC CO-FACTEURS MUTAGENESE INSERTIONNELE TRANSACTIVATION DE GENES CELLULAIRES INTERACTIONS PROTEIQUES INACTIVATION DE GENES SUPPRESSEURS DE TUMEUR
  • 31. Ganem and Prince, NEJM 2004
  • 32. IMMUNOPATHOGÉNIE DES HÉPATITES B CHRONIQUES RÉPONSE IMMUNITAIRE HÉPATOCYTE CYTOKINES NON INFECTÉ CTL cytokines perforine Fas ANTICORPS NEUTRALISANTS AgHBc/e VHB HLAI ANTIVIRAUX HÉPATOCYTE INFECTÉ
  • 33. IMMUNOPATHOLOGY OF HBV INFECTION CD8+ HBV Immune tolerance CD8+ HBV Clairance phase Chronic hepatitis HBV Seroconversion CD8+ Remission
  • 34. Immunopathology Fulminant hepatitis HBV CD8+
  • 35. MECHANISMS OF VIRAL CLEARANCE Non cytolytic processes Turn-over of infected cells TH1 cytokines with direct antiviral Immune mediated lysis of infected cells effect Transgenic mice Ducks Chimpanzees Woodchucks (Guidotti Science 1999, (Guo J Virol 1999 Thimme J Virol 2003) Summers PNAS 2003&2004) Antivirals Inhibition of viral DNA synthesis -> inhibition of intracellular recycling of cccDNA (Werle Gastroenterology 2004) Restoration of anti-HBV immune response (Boni Hepatology 2000)
  • 36. Non cytolytic clearance of acute HBV infection in chimpanzee Wieland S et al, PNAS 2004
  • 37. Hepatocyte turn-over is required for clearance of viral infection in acute infection Summers et al, PNAS 2003 & 2004
  • 38. Phase de tolérance immunitaire Marqueurs Hépatocyte AgHBe + non infecté HBV DNA +++ ALAT = N Foie = N HBc/e Ag HBV Hépatocyte infecté
  • 39. Phase de clairance immune (hépatite chronique) Marqueurs Hépatocyte AgHBe+ non infecté HBV DNA + CTL ALAT +++ Foie: Hépatite cytokines chronique perforine Fas HBc/e Ag HBV HLAI Hépatocyte infecté
  • 40. Phase de rémission portage inactif de l’AgHBs Marqueurs Hépatocyte non infecté AgHBe- anti-HBe + HBV DNA < 104 /mL ALAT = N Foie = rémission HBs Ag Hépatocyte infecté Réactivation Virus sauvage Oncogénèse ou mt pre-core
  • 41. Clairance de l’AgHBs Marqueurs Hépatocytes HBsAg - non infectés anti-HBc + Anti-HBs +/- HBV DNA - mais PCR + Hépatocytes infectés Mutants d’échappement Oncogénèse Infections occultes
  • 42. cccDNA levels in the different phases of chronic HBV infection 10 3 10 4 cccDNA (copies/cell) Total HBV DNA 10 3 (copies/cell) 10 2 1 10 2 10 0 10 1 10 -1 10 0 10 -2 10 -1 10 10 -2 -3 10 10 -3 ) ) ) ) ) ) 63 18 10 (7 3) 18) 10 (7 ( ( ( - (6 -( ( - g + g- rs Ag g + g rs Ag eA eA rie BS eA ie B r H eA B rr BS HB H . Ca HB H .C a H ct t a ac In In • HBeAg+ patients had significantly higher cccDNA (90-fold) and total HBV DNA (147- fold) levels compared to HBeAg- patients. (p<0.001, Wilcoxon tests) Werle et al, Gastroenterology 2004
  • 43. HISTOIRE NATURELLE ET VIROLOGIE CLINIQUE
  • 44. Histoire Naturelle de l’hépatite B Infection aigue Seeger, Zoulim, Mason; Guérison Fields Virology; 2007 5% nx-nés Infection chronique 90% adultes Hépatite chronique Virus sauvage (HBeAg+) Mutant pre-core (HBeAg-) Portage inactif Tolérance immunitaire Réactivation Cirrhose 30-50 ans Carcinome hépatocellulaire
  • 45. MARQUEURS SEROLOGIQUES • Système AgHBe /anti-HBe – distinction virus sauvage / virus muté AgHBe négatif • Virémie – détection quantitative de l'ADN viral
  • 46. HEPATITE B AIGUE • Incubation 1 à 6 mois • Le plus souvent asymptomatique – Évolution plus fréquente vers la chronicité • Prodromes: – Maladie sérique : arthralgies, urticaire, acrodermatite etc. .. • Formes ictériques : + graves que VHA et VHC – Durée de l’ictère : jusqu’à 4 mois • Evolution : chronicité 5 à 10% • Hépatites fulminantes
  • 47. Laboratory Diagnosis of Acute Hepatitis B HBsAg Anti-HBs Ab 1000 IU/L and million copies/ml 900 HBeAg Anti-HBe Ab 800 ALT ALT and HBV DNA 700 Total anti-HBc 600 Symptoms 500 400 HBV DNA IgM anti-HBc 300 200 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  • 48. HEPATITE B PROLONGEE • Définition – Persistance réplication virale à la 8ème semaine d’évolution : – AgHBe + ou ADN-VHB + • Evolution – Chronicité : 8 cas / 10 • Traitement : IFN – Guérison : 7 à 8 cas / 10
  • 49. INFECTIONS CHRONIQUES A VHB FORMES CLINIQUES • virus sauvage – tolérance immunitaire – rupture de tolérance -> lésions hépatocytaires : HCA – séroconversion anti-HBe spontanée (portage inactif) : 5-10% /an – > diminution significative réplication virale – > amélioration signes histologiques • virus muté pré-C (-) – sélection au moment de la séroconversion anti-HBe – dépend du génotype viral – immunopathologie ? – sévérité de l'hépatopathie : controversée – association au CHC
  • 50. Laboratory Diagnosis of Chronic Hepatitis B associated with wild type virus infection HBsAg 800 HBeAg IU/L or million copies/ml 700 ALT and HBV DNA 600 500 HBV DNA 400 300 ALT 200 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  • 51. Laboratory Diagnosis of Transition of Chronic Hepatitis B to The inactive Carrier State 800 HBsAg `` IU/L and million copies/ml 700 HBeAg Anti-HBe 600 ALT and HBV DNA 500 400 HBV DNA 300 200 ALT 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 72 80 92 104 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  • 52. Laboratory Diagnosis of HBeAg negative Chronic Hepatitis B HBsAg HBeAg Anti-HBe IU/L and million copies/ml 450 400 ALT ALT and HBV DNA 350 300 250 200 HBV DNA 150 100 50 Normal ALT levels 0 0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 Months Seeger, Zoulim, Mason, Fields Virology 2007
  • 53. AgHBs UI/ml UI/ pg/ml pg/ AgHBe + anti-HBe + 1000 ALAT 9 log ADN- 8 log 100 VHB 7 log 10 6 log 1 hybridation 5 log 4 log 0,1 3 log 0,01 2 log PCR 0,001 1 log Tolérance hép chronique p. inactif mt pré-core VHB occulte
  • 54. Dynamic ranges of quantification of HBV DNA assays 10 102 103 104 105 106 107 108 109 Amplicor HBV Monitor v2.0 (Roche) HBV Hybrid-Capture II (Digene) Ultra-sensitive HBV Hybrid-Capture II Versant HBV DNA 3.0 (bDNA, Siemens) Cobas Taqman HBV (Roche) RealArt HBV LC PCR (Artus Biotech) Abbot Real-time HBV (Abbott) Versant HBV DNA 1.0 (kPCR, Siemens)* *in development
  • 56. MANIFESTATIONS EXTRAHEPATIQUES DU VHB • PAN – Complexes immuns circulants HBs/anti-HBs – Dépots artères moyens et petit calibre – Traitement : plasmaphéreses, corticoides, antiviraux (vidarabine / IFN / famciclovir / lamivudine) • Glomérulonéphrites • Cryoglobulinémies • Guillain-Barré • Myocardite
  • 57. TRANSMISSION VERTICALE DU VHB • mère AgHBe + – transmission : 90% • mère anti-HBe + – transmission : 10-20% – VHB muté pré-C (-) : hépatites fulminantes • chronicité chez l’enfant : 90%
  • 58. PRESENTATION CLINIQUE • INFECTION PERI-NATALE – ALT normales ou subnormales – ADN-VHB > 1000 pg/ml – histologie : lésions minimes • INFECTION POST-NATALE – ALT élevées – ADN-VHB < 1000 pg/ml – histologie : hépatite modérée à sévère • CARCINOME HEPATOCELLULAIRE : 30 ANS
  • 59. Histoire naturelle de l’infection chronique par le virus de l’hépatite B en Alaska • McMahon BJ, Ann Intern Med 2001;135(9):759-68 • 1536 natifs d’Alaska : 641 AgHBe+, 83 anti-HBe+ • Probabilité d’éliminer l’Ag HBe à 10 ans : 72,5 %. • Elimination de l’Ag HBs chez 106 porteurs chroniques du VHB (7 %) • Incidence des événements cliniques: 2,3/1000 porteurs/année • Incidence du CHC: 1,9/1000 porteurs/année (2,3 chez l’homme; 1,2 chez la femme).
  • 60. Pathophysiologic Cascade of Chronic HBV Infection HBV Replication HBV Replication Liver Liver (Measured by (Measured by Inflammation Inflammation Serum HBV DNA) Serum HBV DNA) ALT ALT Elevation Elevation Worsening Histology Worsening Histology Disease Progression Disease Progression • Necroinflammation • Necroinflammation • Liver Failure • Liver Failure • Fibrosis • Fibrosis • Liver Cancer • Liver Cancer • Cirrhosis • Cirrhosis • Transplant • Transplant • Death • Death Adapted from: Lavanchy D. Journal of Viral Hepatitis, 2004, 11, 97–107. Chen JC, et al. JAMA. 2006;295:65-73. Iloeje U. H, et al. Gastroenterology. 2006;130:678-86.
  • 61. Normal Aminotransferase Levels and Risk of Mortality from Liver Diseases 59.0 >100 30.0 50-99 19.2 Elevated 40-49 9.5 ALT 30-39 2.9 20-29 Normal 1.0 <20 0 10 20 30 40 50 60 70 80 90 • Korea Medical Insurance Corporation Risk ratio (95% CI) – 94,533 men; 47,522 women – 35-59 yrs old – Relative risk for liver mortality compared with AST and ALT <20 IU/l Kim HC et al. BMJ 2004; 328:983 al. 2004;
  • 62. AgHBeAg et risque de CHC • 11,893 Taiwanese men; 92,359 person-years follow-up 12 Cumulative incidence (%) HBsAg+ 10 HBeAg+ 8 6 4 HBsAg+, HBeAg - 2 0 HBsAg -, HBeAg - 0 2 4 6 8 10 Year Yang et al. N Engl J Med. 2002;347:168-174.
  • 63. Charge virale et incidence de la cirrhose .4 P <0.001 Incidence cumulative de cirrhose 37.1% 1.0 x 106 n=627 1.0-9.9x105 n=344 n=3774 1.0-9.9x104 n=649 .3 300-9.9x103 n=1210 <300 n=944 23.0% .2 .1 10.0% 6.3% 5.2% 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 Année de suivi R.E.V.E.A.L. – HBV Study Iloeje UH et al. Gastroenterology 2006; 130: 678-686
  • 64. Survie chez les patients au stade cirrhose 100 Patients Surviving, % 80 60 Cirrhosis1 55% (n = 130) 40 20 Decompensated cirrhosis2 14% (n = 21) 0 0 1 2 3 4 5 Years 1. Weissberg et al. Ann Intern Med. 1984;101:613. 2. De Jongh et al. Gastroenterology. 1992;103:1630.
  • 65. Charge virale et incidence du CHC Chen et al; JAMA 2006
  • 66. REVEAL-Incidence of HCC Increases with Increasing HBV DNA 20% Baseline Viral Level % cumulative incidence of HCC 14.9% 15% 12.2% 10% 5% 3.6% 1.3% 1.4% 0% <300 >300 - 103 > 103 - 104 >104 - 106 ≥106 Baseline HBV DNA (copies/mL) Chen JC, et al. JAMA. 2006;295:65-73.
  • 67. High Baseline Serum HBV DNA Levels are Associated with Increased Risk of HCC Mortality in HBsAg-Positive Patients HBV DNA Negative 100% HBV DNA Low 96% < 105 copies/mL copies/ RR = 1.7 (0.5-5.7) (0.5-5.7) 92% 88% HBV DNA High ≥ 105 copies/mL copies/ p < 0.001 across viral RR = 11.2 (3.6-35.0) (3.6-35.0) 84% categories 80% 0 1 2 3 4 5 6 7 8 9 10 11 12 Survival time (Years) http://www.fccc.edu/docs/sci_report/Evans.pdf#search=%22haimen. Accessed 1/23/07. Chen G, et al. J Hepatology 2005; 42 (suppl 2):477A. Chen G, et al. Hepatology 2005; 40 (suppl 1):594A.
  • 68. Relationship Between Persistent Viremia and HCC: Argument For Antiviral Therapy • Persistent replication associated with greater risk of HCC • Decreased risk when viral replication declines Rate Per 100,000 HCC Incidence 1.2x104 10,108 1.0x104 8730 8.0x103 5882 6.0x103 4.0x103 1473 2.0x103 0 Baseline HBV DNA, (copies/mL) < 104 ≥105 ≥105 ≥105 Follow-up HBVDNA, copies/mL --- < 104 104 to <105 ≥105 Adjusted RR 1.0 3.6 6.9 9.1 (95% CI) (ref) (1.7-7.6) (3.4-13.8) (5.8-14.1) P Value -- < 0.001 < 0.001 < .001 Chen, et al. JAMA 2006
  • 69. Impact Clinique de la Variabilité du Génome Viral
  • 70. VARIABILITE GENETIQUE DU VHB • Multiplication virale » taux d'erreur de la transcriptase inverse • Pression de sélection » réponse immunitaire cellulaire / humorale » antiviraux -> possibilité de variants d'échappement • Conséquences cliniques » diagnostic sérologique » traitements antiviraux
  • 71. VARIABILITE GENETIQUE DU VHB • SOUS-TYPES : acides aminés et déterminants HBs – boucle 139-147 -> det a – 122 -> det d ou y – 127 -> det w1-4 – 160 -> det w ou r • GENOTYPES : variabilité de séquence génomique – du génome complet : 8% – du gène S : 4% – 8 génotypes A à H • MUTANTS DU VHB – mutations ponctuelles / délétions / insertions
  • 72. 8 genotypes, numerous sub-genotypes, and recombinant forms B6 D1 World J Gastroenterol 2007; 13: 14-21
  • 73. Génotypes VHB chez les patients atteints d’hépatite chronique en France 37.4% 100 90 30.2% 80 Number of subjects 70 60 50 40 12.5% 11.3% 30 7.9% 20 10 1.1% 0.4 % 0 A B C D E F G Zoulim et al J Viral Hepatitis 2006
  • 74. Impact du génotype sur la séroconversion PEG-IFN a-2b PEG-IFN a-2b HBeAg Loss 1 HBsAg Loss 2 47% 50 21 Percentage of patients (%) Percentage of patients (%) 44% 18 40 15% 15 28% 30 25% 12 20 9 8% 6 5% 10 3 0% 0 0 A B C D A B C D n=90 n=23 n=39 n=103 n=90 n=23 n=39 n=103 HBV genotype HBV genotype 1 Janssen, Lancet 2005; 2 Flink, Am J Gastro 2006
  • 75. LES MUTANTS DU GÉNOME DU VHB déterminant a vaccin/HBIg polymérase antiviraux Mt core Réponse CTL Mt pré-core Réponse anti-e ?
  • 76. ROLE DE LA RÉGION PRÉ-C ET DE L’AgHBe • Non nécessaire à la réplication du VHB – Culture cellulaire – Modèles in vivo • Marmotte • Canard • Modulation de la réponse immune – Tolérogène : souris transgéniques – Cible de la réponse anti-capside Chang et al, J. Virol 1987; Schlicht et al J. Virol 1987; Chen J. Virol 1992; Millich et al PNAS
  • 77. LES MUTANTS PRÉ-C (-) • codon stop / région pré-C TGG -> TAG en pos. 1896 – génotypes B à E (A : exceptionnel) – arrêt traduction protéine pré-C/C – AgHBe négatif • mutation dans promoteur pré-C TTAAAGG -> TTAATGA en pos. 1762 /1764 – génotypes A à E – transcrits pré-C/C : – synthèse d'AgHBe : Carman et al Lancet 1989, Okamoto et al J Virol 1990/1994, Tong et al Virology 1990
  • 78. HBeAg and Precore Mutation G 1896A = stop codon, TAG ATG ATG Core gene 1814 1901 Precore Core region region HBcAg Virion HBeAg Serum
  • 79. HBeAg and Precore Mutation ATG ATG Core gene 1814 1901 Precore Core region region HBcAg Virion HBeAg Serum
  • 80. VARIANTS NÉGATIFS POUR L ’AgHBe 1762-1764 1896 PROMOTEUR PRE-C C * * * TAG mRNA Protéine pré-C/C arrêt des synthèses protéiques Diminution de l’expression de l ’AgHBe
  • 81. Main pre-c/core promoter mutations observed in vivo Basic core promoter LEF Pre-C mRNA AGGTCA HNF4 1762 64 66 68 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCATAAATT TGA TTA GGTTAATNATTA HNF1 TTG HNF3 WTRTTKRY Deletion 63-70 Insertion (RGTTAATYATTA) at 74/75 Insertion (TTG) at 66/67 Mutation AGG to TCA and insertion TA at 65/66
  • 82. Sélection des mutants pré-core au cours de l’histoire naturelle de l’hépatite B chronique AgHBe Anti-HBe ALAT 2500 ADN-VHB 2000 1500 1000 500 0 temps 100 sauvage 80 60 Mt pré-C 40 20 0 temps
  • 83. Outcome of Chronic Anti-HBe Positive Hepatitis B Biochemical patterns in 164 untreated patients after 23 months (range 12-36) monthly monitoring 400 With flares and normalization 73 pts 300 ( 44.5% ) 200 100 Asymptomatic flare-up: 0 90% of cases 400 A Without flares 59 pts 300 L ( 36.0% ) 200 Flare-up yearly T 100 frequency: once 57.1% 0 twice 20% < once 22.8% With flares and without normalization 400 32 pts 300 ( 19.5% ) 200 100 0 0 12 24 months Brunetto MR et al, J Hepatol 2002
  • 84. Augmentation de prévalence des hépatites chroniques avec AgHBe négatif en France 62% 48% HBeAg(+) N=119 HBeAg(-) N=164 Zoulim et al, J Viral Hepatitis 2006
  • 85. Pre-core mutations Both mutations No pre-core mutation (n = 95; 33.6%) (n = 42; 14.8%) Data unavailable (n = 12; 4.2%) Stop codon mutation (n = 55; 19.4%) Promoter mutation (n = 99; 27.9%) Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  • 86. HBe serotype and pre-core mutations 90 80 HBe-positive Number of subjects 70 HBe-negative 60 50 40 30 20 10 0 No pre-core Stop codon Promoter Both mutation mutation mutation mutations Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  • 87. MUTANTS PRÉ-C ET SÉVÉRITÉ HISTOLOGIQUE LA CONTROVERSE • Italie – Cirrhose plus fréquente • Bonino Gastroenterology 1986, Fattovich Hepatology 1988 • France – Activité idem / cirrhose plus fréquente • Zarski et al, J Hepatol 1993 • Grandjacques et al, J Hepatol 2000 • Zoulim et al, J Viral Hepatitis 2006 • Asie – Mt promoteur : activité histologique et fibrose plus importante – Mt pré-C : activité histologique moins importante • Lindh et al, J Infect Dis 1999 – Rémission histologique • Chan et al, Hepatology 1999 • Afrique – Mt promoteur : plus fréquents dans le CHC • Baptista et al, Hepatology 1999
  • 88. HBe serotype and liver pathology HBe-positive HBe-negative 70 70 Number of subjects 60 60 50 50 40 40 30 30 20 20 10 10 0 0 0-4 5-9 10-14 15-22 ≤ F2 F3 F4 Knodell score Metavir score Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  • 89. HÉPATITES FULMINANTES ET MUTANTS PRE-C • Lien de causalité : – Épidémies hépatites fulminantes – Transmission souche mutée pré-C (-) – Rôle immunomodulateur de l ’AgHBe • Pas de lien de causalité – Séquençage génome complet – Pas de profil commun de mutation • Sélection des mutants par la réponse immunitaire cytotoxique dirigée contre la souche à l ’origine de l ’HF Stuyver et al, Hepatology 1999, Sternbeck et al Hepatology 1996, Liang et al, NEJM 1991
  • 90. DIAGNOSTICS DIFFICILES I. Porteur inactif II. Exacerbation
  • 91. Diagnosis of inactive carrier versus HBeAg negative chronic hepatitis • Inactive Carrier – Persistently normal ALT levels – Persistently low levels of serum HBV DNA • Threshold : 2,000 IU/ mL ? • HBeAg negative chronic hepatitis – Fluctuation / exacerbation of ALT – Fluctuations of HBV DNA levels usually below 6 log IU/ mL – Presence of pre-core / core promoter mutations
  • 92. DIAGNOSTIC D'UNE EXACERBATION AIGUE SUR HEPATITE B CHRONIQUE • Définition : poussée cytolytique ≠ réactivation virale • Ag HBe + initialement – rupture de tolérance immunitaire – séroconversion anti-HBe – très fréquent chez patients asiatiques • Anti-HBe + initialement – réactivation virus sauvage : -> AgHBe + – réactivation virus muté pré-C (-) – corticothérapie – surinfection delta / VHC
  • 93. Pichoud et al, J hepatol 2000 interferon HBeAg + + - - - - + - Anti-HBe Ab - + + + + + - + 25 10000000000 1000000000 20 100000000 10000000 15 1000000 case#6 10 100000 10000 ALT Genotype A 1000 pre-S1 5 100 bDNA 10 PCR 0 1 months 0 1 2 5 9 12 13 16 pre-C promoter WT - - + + - + MT + + + - + - pre-C region WT + + + + + + M2 - - - - - - M4 - - - - - - M2+M4 - - - - - -
  • 94. PreS2 PreS1 Pol S HBs Ag 0/3221 GR E Brin(-) 3,2kb Brin(+) 2,4kb SHBs (S) TATAA MHBs (preS2+S) « a » determinant U5-like DR1 Enh2 Enh1 C DR2 LHBs (preS2+preS2+S) S-S sP120T Pré-C X 137 S- S 138 149 107 S-S S-S 147 139 sG145R sD144H/A/E 99 NH2 S-S COOH « a » determinant induces the synthesis of anti-HBs neutralizing antibodies Tiollais P. et al., Nature 1985. Torresi J., J. Clin Virol 2002; Dryden KA. et al., Mol Cell 2006
  • 95. Variants de l'Ag HBs • échappement à la réponse humorale anti-HBs – naturelle – vaccination (transmission mère-enfant) – immunoprophylaxie (transplantation hépatique) • infection active malgré Ac anti-HBs • sérologie AgHBs faussement négative á Risques : transmission virale + infections occultes
  • 96. VARIANTS DE L'AgHBs • Mutations ponctuelles dans le déterminant a de l'AgHBs (124-147) – aa 145 : Gly -> Arg – aa 126 : Ile -> Ser / Thr -> Asn • transmission mère-enfant malgré la serovaccination (3%) • infection du greffon hépatique malgré Immunoglobulines anti-HBs • hépatites chroniques avec anti-HBc et anti-HBs +
  • 97. Occult HBV Infection (OBI) Presence of HBV DNA in the liver (± serum) of individuals testing HBsAg negative by currently available assays Raimondo et al, J Hepatol 2008
  • 98. How to Detect Occult HBV Infection Currently there is no standardized diagnostic assay for occult HBV infection
  • 99. Reported Prevalence of Occult HBV Infection in HIV Positive Patients Occult Study Country N° of HBV Methods patients N° (%) Hofer, 1998 Switzerland 57 51 (89%) “nested” PCR (serial evaluation) Torres-Baranda, 2006 Mexico 35 7 (20%) “nested” PCR Filippini, 2006 Italy 86 17 (20%) single step PCR Mphahlele, 2006 South Africa 140 31 (22.%) “nested” PCR Pogany, 2005 Netherlands 93 4 (4%) single step PCR Neau, 2005 France 160 1 (0.6%) Cobas Amplicor HBV Monitor (Roche) Santos, 2003 Brazil 101 16 (16%) single step PCR Wagner, 2004 France 30 11 (37%) “nested” PCR Goncales, 2003 Brazil 159 8 (5%) “nested” PCR Nunez, 2002 Spain 85 0 Cobas Amplicor HBV Monitor (Roche) Piroth, 2000 France 37 13 (35%) single step PCR Raffa, 2007 Italy 101 42 (41%) “nested” PCR (liver) Raimondo et al, J Hepaol 2007, modified
  • 100. Cause(s) for the failure of HBsAg detection OBI “false” OBI Suppression of Infection by HBV replication and S gene Variants gene expression
  • 101. HBV replication HBV cccDNA Integrated HBV DNA HBV mutants Epigenetic control Immune surveillance Viral co-infections Occult HBV infection
  • 102. Schematic representation of HBV serum marker profile in OBI and “false” OBI OBI „false“ OBI HBV DNA levels < 200 UI/ml Seropositive S gene S gene Seropositive Seronegative Seronegative escape mutants escape mutants Primary occult HBV DNA levels HBsAg lost HBsAg lost Primary occult comparable to after AH after AH overt infection HBsAg lost HBsAg lost Progressive antibody Progressive antibody during CH during CH disappearence disappearence
  • 103. Occult hepatitis B Torbenson M. & Thomas D.L., Lancet Inf Dis, 2002
  • 104. Occult HBV infections: unresolved issues Diagnostic Specific To be treatments ? improved High Tools ? prevalence Co-infections ? Therapy? ROLE Worsen HCV in infection ? HCC Not fully understood ?
  • 105. Antiviraux Persistance virale Resistance aux antiviraux Monitoring des traitements
  • 106. HBsAg Immunotolerant Immuno-active Inactive phase Occult infection Reactivation phase phase phase Low replication HBeAg(+) HBeAg(-) / anti-HBe(+) HBV DNA 109-1012 IU/mL >2000-<109 IU/mL <2000 IU/mL >2000 IU/mL ALAT Minimal CH Moderate to severe CH Remission Moderate to severe CH Cirrhosis Inactive cirrhosis Cirrhosis Treatment indicated Treatment indicated Adapted from Fattovich G. Sem Liver Dis. 2003
  • 107. Endpoints of therapy Persistence of high viral load is associated with a significant risk of progression of the liver disease and of HCC Aim of antiviral therapy: HBV DNA < 10-15 IU/mL by real-time PCR assays Viral suppression No replication = Histological and clinical No resistance improvement Chen CJ, et al. JAMA 2006. Iloeje UH, et al. Gastroenterology 2006. Chen C, et al. Am J Gastroenterol 2006. Zoulim & Perrillo J Hepatol 2008. Zoulim & Locarnini Gastroenterology 2009
  • 108. Antivirals approved for hepatitis B Drug Type Approved Phase 3 Phase 2 Nucleoside analogs • Lamivudine* • Emtricitabine* • Elvucitabine • Entecavir • Clevudine** • Valtorcitabine • Telbivudine • Amdoxovir • Racivir • LB80380 Nucleotide analogs • Adefovir dipivoxil • Alamifovir • Tenofovir* • Pradefovir Cytokines • Interferon alfa • Pegylated Interferon alfa-2a *Currently approved for HIV **development on hold
  • 109. Treatment failure Primary non response Secondary treatment failure Partial response Antiviral drug resistance Host factors Drug factors Drug metabolism Barrier to resistance Patient’s compliance Viral factors Drug factors Resistant mutants Antiviral potency Zoulim & Perrillo J Hepatol 2008; EASL CPG J Hepatol 2009
  • 110. Clinical definition of resistance • Virologic Breakthrough: Rebound in serum HBV DNA levels (e.g. 1 log10 above nadir) • Genotypic Resistance: Detection of mutations known to confer resistance while on therapy • Virologic Breakthrough with Genotypic Resistance: Viral rebound associated with a mutation(s) known to cause resistance. • Primary non response: <1log10 decrease of viral load after 3 months • Partial response: detectable HBV DNA levels during therapy Zoulim & Perrillo, J Hepatol 2008; EASL CPG, J Hepatol 2009
  • 111. Laboratory Definition of HBV Resistance to Antivirals Laboratory Investigations • Phenotypic Resistance: Decreased susceptibility (in vitro testing) to inhibition by anti-viral drugs associated with genotypic resistance. • Cross Resistance: Mutants selected by one agent that also confer resistance to other antiviral agents Zoulim et al; Future Virology 2006
  • 112. Kinetics of emergence of HBV drug resistant mutants Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology 2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
  • 113. Lamivudine Resistance Accelerates Progression of Liver Disease 25 Placebo (N=215) YMDDm (N=209) (49%) Placebo 21% 20 Wild Type (N=221) 15 YMDDm 13% 10 WT 5% 5 0 0 6 12 18 24 30 36 Time after randomization (Months) Liaw YF et al. N Engl J Med. 2004;351:1521-1531
  • 114. Biochemical and Histologic Correlates of HBV Resistance • Rise in ALT levels – Mild ALT elevations in most cases – ALT flares with acute exacerbations and liver failure: especially patients with liver cirrhosis and/or pre-core mutant infection • Progression of liver disease – Progressive worsening of liver histology – Clinical deterioration, liver decompensation, HCC development Lai et al Clin Infect Dis 2003; 36: 687-696; Dienstag et al Gastroenterology 2003;124:105-117 ; Lok et al Gastroenterology 2003; 125 : 1714-1722; Hadziyannis et al Hepatology 2000;32:847-851; Si Ahmed et al Hepatology 2000; Zoulim et al J Viral Hepatitis 2006;13:278-288 ; Fung et al J Hepatol 2005;43:937-943; Liaw et al NEJM 2004;351:1521-1531.
  • 115. ALT flares in patients with lamivudine resistance over time Lok et al Gastroenterology 2003; 125 : 1714-1722
  • 116. Incidence of drug resistance over time Resistance at year of therapy expressed as percentage of patients Drug and patient population 1 2 3 4 5 6 Lamivudine 23 46 55 71 80 - Telbivudine HBeAg-Pos 4.4 21 - - - - Telbivudine HBeAg-Neg 2.7 8.6 - - - - Adefovir HBeAg-Neg 0 3 6 18 29 - Adefovir (LAM-resistant) Up to 20% - - - - - Tenofovir 0 0 0 - - - Entecavir (naïve) 0.2 0.5 1.2 1.2 1.2 1.2 Entecavir (LAM resistant) 6 15 36 46 51 57 CL Lai Clin Infect Dis 2003; CL Lai NEJM 2007; Hadzyiannis Gastroenterology 2006; Marcellin NEJM 2008; CL Lai & Chang NEJM 2006; Zoulim & Locarnini Gastroenterology 2009
  • 117. Zoulim & Locarnini, Gastroenterology, 2009
  • 118. HBV HBV HBV HBV hepatocytes hepatocytes viral polymerase spontaneous cccDNA long half-life infected cells long mutant archiving error rate half-life mutant wild type defective immune response viral quasi- viral species persistence host host selective pressure selection of selection of antivirals or others escape mutants escape mutants replication fitness replication space immune response drug pharmacodynamics Virus spread in the treatment failure liver + Zoulim et al., Gastroenterology 2009 Disease progression / HCC development
  • 119. L(-)-SddU mitochondria deaminase L(-)-SddC, 3TC Mt DNA L(-)-SddC-TP L(-)-SddC Lamivudine kinase L(-)-SddC-TP HBV DNA nucleus L(-)-SddC-TP cytoplasm Nuclear DNA Bridges; Progress in Liver Disease 1995
  • 120. The HBV life cycle receptor ? Hepatocyte Virion polymerase interaction entry Nucleus cccDNA formation transcription pgRNA AAA AAA AAA AAA RC DNA cccDNA mRNA cccDNA amplification translation DNA (+) DNA (-) pgRNA ER (+) strand encapsidation synthesis reverse transcription ER virion secretion viral proteins secretion HBsAg Nucleoside analogs HBeAg Zoulim et al Future Virology 2006
  • 121. Formation of the recalcitrant cccDNA: a difficult target for antiviral therapy uncoating CCC DNA supercoiled DNA minichromosome topoisomerase? removal of protein primer Acetyl transferase ? Histones removal of RNA primer completion of viral (+) strand DNA ligation of DNA strands extremities Antivirals ? viral polymerase? Tuttleman et al Cell 1986 DNA repair protein? Le Guerhier et al AAC 2000 other cellular enzymes? Delmas et al AAC 2002 Kock et al Hepatology 2003
  • 122. Can we prevent cccDNA formation ? Nucleoside analogs in monotherapy or combination therapy cannot prevent the de novo formation of cccDNA in hepatocyte culture and in vivo in animal experiments (Delmas et al AAC 2000; Seigneres et al AAC 2002) Can we clear cccDNA from a chronically infected cell ? The decrease of intrahepatic cccDNA during nucleoside analog requires hepatocyte turn over in animal experiments (Zhu et al J Virol 2001; Litwin et al J Clin Virol 2005)
  • 123. Kinetics of Viral Loss During Antiviral Therapy with L- FMAU (clevudine) in the woodchuck model Zhu et al, J Virol 2001
  • 124. ADV Associated Serum HBsAg Reductions are Similar in Magnitude to cccDNA Reductions Serum Total 0 HBV Intracellular cccDNA Serum Changes in HBV Markers (log 10 copies/cell(ml)) DNA DNA HBsAg -1 from Baseline -2 -3 -4 -5 -6 48 weeks of ADV resulted in significant reductions in : serum HBV DNA > total intrahepatic HBV DNA > cccDNA Changes in HBsAg levels correlated with cccDNA changes -> 14 years of therapy to clear completely viral cccDNA Werle et al, Gastroenterology 2004
  • 125. Immunohistochemical Staining of Patient Biopsies at Baseline and After 48 Weeks ADV Therapy Baseline Week 48 • 0.8 log10 (84%) decline in cccDNA, not paralleled by a similar decline in the number of HBcAg+ cells • Suggests cccDNA depleted primarily by non-cytopathic mechanisms or that cell turn-over occurred but was associated with infection of new cells during therapy
  • 126. Persistence of cccDNA after HBs seroconversion Maynard et al, J Hepatol 2005
  • 127. Clearance of viral infection versus selection of escape mutants The most important factors to consider: § The rate of immune killing of infected hepatocytes § The rate of replication and spread of mutant virus in the chronically infected liver (I.e. fitness of the virus: the rate of spread to uninfected hepatocytes) § Small changes in these factors may have profound effect on whether treatment response is durable or subject to rapid rebound (Litwin et al J Clin Virol 2005) § These factors may be subject to therapeutic intervention
  • 128. Kinetics of emergence of drug resistant virus during antiviral therapy Lamivudine wt mt X X X X X • Free liver space X • Mutant fitness X ni I II III IV INHIBITION OF WILD TYPE VIRUS REPLICATION DELAYED EMERGENCE OF DRUG RESISTANT VIRUS Zhou et al AAC 1999
  • 129. Kinetics of HBV drug resistance emergence Drug-susceptible virus Treatment begins Naturally—occurring viral variants Drug-resistant variant Secondary resistance mutations HBV replication / compensatory resistance mutations Primary resistance mutations Time Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology 2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
  • 130. Partial response to adefovir dipivoxil is not due to the selection of DR mutants • The top 25% patients (quartile 1): > 4.91 log10 reduction in serum HBV DNA at week 48. • In Q2: 3.52 to 4.90 log10 reduction of viral load. • In Q3: 2.22 to 3.51 log10 reduction in viral load. • The bottom 25% of patients (Q4):< 2.22 log10 reduction in HBV DNA levels at week 48. • Phenotypic analysis of viral strains: Q4 as sensitive to ADV as Q1 strains • Documented Drug Compliance (% of days without taking ADV) Virological Response Virological Response Virological Response Virological Response Q1 (best response) Q2 Q3 Q4 (worse response) (n=38) (n=38) (n=38) (n=38) Median 99% 99% 99% 97% a range 86-100% 41*-100% 91-100% 70-100% • Wilcoxon rank sum test, P=0.01 Durantel et al, Antiviral Therapy, 2008
  • 131. Amino acid substitutions result in conformation changes of the polymerase catalytic site Wild-type M204/L180 LVDr M204V/L180M L180 L180M M204 M204V LVD-TP LVD-TP LVDr M204V/L180M M204V reduces pocket size L180M Steric clash between lamivudine and V204 M204V Minimal steric clash between entecavir and ETV-TP V204 Langley DR, et al. J Virol. 2007;81:3992-4001.
  • 132. Polymerase gene mutations may result in decreased inhibitory activity of antivirals wt polymerase 3TC-R polymerase PMEA-R polymerase 3TC+PMEA-R polymerase Drug IC50 (µM) P IC50 (µM) P IC50 (µM) P IC50 (µM) P Elongation FLG-TP 4 ± 0.9 5.43 ± 0.6 7.8 ± 1.9 6.33 ± 1.3 3TC-TP 10.75 ± 4.8 <0.05 >100 <0.05 14 ± 5.7 <0.05 >100 <0.05 PMEA-DP 2.8 ± 0.3 >0.05 0.9 ± 0.1 <0.05 49.5 ± 3.4 <0.05 16.5 ± 7.2 <0.05 Jacquard et al, Antimicrob Agents Chemother 2006
  • 133. Definition of fitness • A parameter that quantifies the adaptation of an organism or a virus to a given environment • For a virus, ability to produce infectious progeny relative to a reference viral clone, in a defined environment Esteban Domingo, In Fields Virology 2007
  • 134. HBIg adefovir lamivudine wt Mutant #1 Mutant #2 Mutant #3 Mutant #4 Polymerase clonal genetic analysis Polymerase gene mutations Surface gene mutations wt none none mutant #1 T128I; V173L; L180M; A181V; N236T F20S; P120S; E164D; L173F mutant #2 T128I; V173L; L180M; A181V; M204V R79H; P120S; E164D; L173F; I195M; Y206F mutant #3 ∆111-120; T128I; V173L; L180M; A181V F20S; ∆102-111; P120S; E164D; L173F mutant #4 T128I; V173L; L180M; A181V; M204V; L220I; N236T P120S; E164D; L173F; I195M Villet et al, Gastroenterology 2006
  • 135. Viral replication capacity in the presence of both antivirals (LAM + ADV) 400 Mutant replication capacity / wt (%) 350 300 250 200 150 100 50 0 wt #1 #2 #3 #4 Mutant Villet, Billioud et al, Gastroenterology 2008
  • 136. Infectivity of the mutants in HepaRG cells Impact of mutations in the overlapping S gene HDV hybrids with HBV mutant envelopes HDV replication in HepaRG cells as a reporter of infection Mutant A wt #1 #2 #3 #4 1,7 kb B Mutant infectivity / wt (%) 120 100 80 60 40 20 0 wt #1 #2 #3 #4 Mutant Villet, Billioud et al, Gastroenterology 2008
  • 137. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  • 138. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus • It is believed that viral variants with antiviral resistance may be archived in this way Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  • 139. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus • It is believed that viral variants with antiviral resistance may be archived in this way Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  • 140. Phenotyping of HBV clinical isolates Cl ne A in o ra Southern blot Cl e D Cl e C eE Cl A Cl b St e on on on on analysis La Whole genome HBV clones PCR Transfection cloning Patient HepG2 serum Huh7 lamivudine adefovir Cell culture plate RC - Wild-type virus SS - Patient’s Fold resistance virus IC50 mutant = IC50 reference strain Increasing antiviral concentration 1. Durantel D, et al., Hepatology, 2004;40:855-64. 2. Yang H, et al., Antiv Ther, 2005;10:625-33.