2. In any situation where DNA may be
used, a DNA profile must be created.
3. DNA profiling is simply the collection,
processing and analysis of VNTRs (variable
number tandem repeats)
Most DNA sequences in diffe-rent people
look too similar to tell apart. After
processing, however, VNTRs result in bands
that are unique enough to be used for
identification.
These differences were discovered in 1984
by Dr. Alec Jeffreys, while using DNA
belonging to different family members of
one of his lab technicians.
4. For example, you may have a stretch of
DNA made up of the following base
sequence:
ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGTTCCATGATAGCACAT
This sequence starts off looking random, but
then has repeats of the sequence CATG
towards the middle. It becomes random
again near the end. The repetitive section
of the sequence is what is referred to as an
STR.
5. For a given STR, you will have inherited
different numbers of the repeated sequence
from each of your parents.
For example, you may have inherited 11
repeats of the CATG sequence, as shown, on
a chromosome from your mother, and 3
repeats of this sequence within the STR on the
matching chromosome from your father.
Different numbers of repeats = DNA of
different lengths. Therefore, electrophoresis
can show how many repeats you have.
6. Generating a DNA profile usually involves
analyzing an individual's DNA for ten
different STRs on different chromosomes.
Statistically, no two people (except
identical twins) are likely to have the
same numbers of repeats in all of these
STRs.
7. CODIS uses algorithms to
compare 13 different STR
locations, plus one that
determines the gender of
the person in question.
The matching algorithms --
which must be confirmed by
an analyst--can produce
leads for law enforcement or
even identify a potential
assailant.
The downside of using CODIS
is that it's only as strong as
the number of profiles
included, and there is a
backlog of more one million
profiles to be entered.
8. A band present in the child must come either
from the mother or from the father
Comparing male 1 with the child then male 2
with the child.
Interpretation:
The bands on the child's fragments are either
found on the mother or the male1.
Male 1 therefore is this father of this child.
None of the Male 2 bands appear in the child
9. A specimen of DNA is taken from the
victim or the crime scene.
DNA samples are taken from the 3
suspects.
The bands are compared to associate
the suspects to the crime scene
Interpretation:
Note that the bands on the specimen
are matched by the bands on the
Suspect 1.
This means that Suspect 1 was present at
the crime scene.
The law will still require to prove a crime
was committed and then that Suspect 1
committed the crime
10. It is often difficult to identify victims after
disasters such as bombing or fires. Forensic
scientists are called in to identify the DNA
obtained from body parts or teeth.
During the aftermath of the 2002 Bali
bombing, relatives of victims were asked to
arrange collection of DNA samples from
personal items such as toothbrushes or combs.
So far, of the 221 missing or deceased in Bali
, 182 have been identified.
DNA profiling identified 115 people, while
fingerprints, dental records and medical
records were also used to identify victims.
http://www.biotechnologyonline.gov.au/human/dnaforensic.html
11. Family Tree DNA uses Y-SRT (Y
chromosome testing) to determine
paternal lineage and mtDNA
(mitochondrial DNA testing) to
determine maternal lineage.
12. http://www.genome.gov/
«The Human Genome Project (HGP) was the
international, collaborative research program whose goal
was the complete mapping and understanding of all the
genes of human beings. All our genes together are known
as our "genome."
In 1911, Alfred Sturtevant, an undergraduate researcher in
the laboratory of Thomas Hunt Morgan, realized that he
could - and had to, in order to manage his data - map the
locations of the fruit fly (Drosophila melanogaster) genes
whose mutations the Morgan laboratory was tracking over
generations. Sturtevant's very first gene map can be
likened to the Wright brothers' first flight at Kitty Hawk. In
turn, the Human Genome Project can be compared to
the Apollo program bringing humanity to the moon.»
13. Outline three outcomes of the sequencing of the complete
human genome.
Begun formally in 1990 the international project’s aims
where:
› identify all the approximate 30,000 genes in human DNA.
› determine the sequences of the 3 billion chemical base pairs
that make up human DNA.
› store this information in database.
› improve tools for data analysis.
› transfer related technologies to the private sector.
› address the ethical, legal, and social issues (ELSI) that may arise
from the project.
To help achieve these goals, researchers also are studying
the genetic makeup of several nonhuman organisms.
These include the common human gut bacterium
Escherichia coli, the fruit fly, and the laboratory mouse.
14. Read about the Genographic Project:
https://genographic.nationalgeographic
.com/genographic/index.html
15.
16. Most bacteria are unicellular and do not have the
ability to turn genes on or off to produce different
kinds of cells as more complex organisms do.
However, a bacterium can change its functions in
response to changes in its environment. For example,
consider the E. coli living in the constantly changing
chemical environment of your intestine. Suppose
you've just had a glass of milk. One of the main
nutrients in milk is the sugar lactose. When lactose is
plentiful in the intestine, E. coli makes the three
enzymes necessary to absorb and use this
disaccharide. When lactose is not plentiful, E. coli
does not waste energy producing those enzymes.
17. Before the genes, there are two short stretches
of DNA called control sequences. Such a
cluster of genes, along with its control
sequences, is called an operon. The operon
discussed here is the lac operon, for "lactose."
The first control sequence, the promoter, is the
site where RNA polymerase attaches to the
DNA. (Recall that RNA polymerase transcribes
genes by making mRNA.) Between the
promoter and the enzyme genes is a second
control sequence called the operator. The
operator acts like a switch, determining
whether or not RNA polymerase can attach to
the promoter.