Nucleic Acid Measurements

Nucleic Acid Measurements
Lecture 8
Nucleic Acid–Based Measurements Text Chapter 13
Wednesday, July 24, 2013
Total community DNA
Extract DNA from soil
– – – – remove cells from soil separate cells from soil lyse cells separate DNA from cells – purify
DNA
Extract DNA from soil
– Extract DNA from cells in presence of soil
Bead–beating chemical or enzymatic treatment
– Sodium dodecyl sulfate or lysozyme
DNA purification
Cesium chloride gradient centrifugation Kits
Low density DNA
High density
Visualizing nucleic acidsBlotting
Southern blotting
– DNA
Northern blotting
– RNA

Agarose gel electrophoresis
–
Stain gel with ethidium ... Show more content on Helpwriting.net ...
ednesday, July 24, 2013
50 µm
Combining ELF and CF319a probes to determine what portion of the PO4aseactive cells in floc
fall within cytophaga–flavobacteria group
ELFTM PO4ase CF319a FISH probe activity FISH probe & PO4ase activity
17% of total community PO4ase activity contributed by cytophaga
Summary
FISH provides information on
– Presence of specific populations – Morphology of specific populations – Relative numerical
contribution of specific populations to total community – Spatial relationships between populations
– Functions associated with specific populations
Gene probe detection of a DNA sequence
Digoxigenin (DIG) Probes range in size from 18–100bp ssDNA
Denatured ssDNA from suspect bacterium
Alternative gene probe detection of a DNA sequence
Exploring microbial activity
Need to know sequence of gene being expressed Alternatively, use random hexamer primers, then
sequence cDNA product to identify gene being expressed
Reverse transcriptase PCR (RT–PCR)
Make single–strand cDNA from mRNA – downstream antisense primer or random hexamer and RT
to make complete cDNA copy of RNA molecule Use cDNA, DNA polymerase, and a downstream
primer in conventional PCR – extension leads to double–stranded DNA Regular PCR of dsDNA

Applications of RT–PCR
Detection of
... Get more on HelpWriting.net ...

Essay On Duchenne's Muscular Dystrophy
Duchenne's muscular dystrophy is one of the most common forms over childhood muscular
dystrophy and primarily affects boys; in total there are 30 different forms of muscular dystrophy
50% being duchenne's muscular dystrophy (NIH, 2013). This type of muscular dystrophy usually
begins to show symptoms around the pre–school age and affects the lower extremities first. By the
age of twelve, most boys are in a wheelchair as the trunk muscles being to weaken leading to
scoliosis and kyphosis. Eventually the diaphragm begins to weaken and young men with Duchenne's
muscular dystrophy will need assistance with breathing through the use of a ventilator (Naff, C.
2012). According to the 1st Edition of Perspectives on Disease and Disorders Muscular Dystrophy
by the age of eighteen most young men would have experienced a cardio myopathy (weakening or
the heart muscle) (Naff, C. 2012). Duchenne's muscular dystrophy (DMD) is a chromosome X–
linked and genetically inherited neuromuscular disease. The New England Journal of Medicine
reports that Duchenne's muscular dystrophy affects 1 in 3500 new born baby boys. Duchenne's ...
Show more content on Helpwriting.net ...
Both research articles focused on the production of viable dystrophin protein in test subjects.
Throughout the research I feel as though the most promising treatment between the two studies
would be the study where the patient subject that were taking ataluren. The end result of the trial that
included ataluren showed that more than half of the young men that participated in this study ended
up having a positive result. That positive result was the increase of dystrophin, so they had a pretty
positive result. The other treatment type where the subjects received injections in the tibialis anterior
muscle was not necessarily where they wanted their study to be at the time, but it showed

Huntington's Disease Research Paper
Huntington's disease is an autosomal dominant disorder in which cells of the brain deteriorate and
eventually die. The disease does not currently have a cure. Currently, there are researchers studying
the effects of mutations and possible ways to silence them. Antisense therapy provides a form of
treatment for genetic disorders or infections. If a certain genetic sequence is known to cause a
particular disease, the nucleic strand can be synthesized to bind to the messenger RNA (mRNA)
produced to the gene to inactivate and thus silence the gene. Upon the expansion of the CAG tract in
the huntingtin gene (HTT), a toxic huntingtin protein (HTT) forms with an elongated polyglutamine
tract. Wild–type HTT is quite critical during the during early

Biological Processes Through Light Regulation Essay
Photolabile nucleobase protection has been used to achieve exquisite control over biological
processes through light regulation, also referred as photocaging. The concept was introduced by
Engels (Engels and Schlaeger, 1977; Engels and Reidys, 1978) and independently by Hofmann
(Kaplan et al., 1978). Watson–Crick base pairing is blocked by caging groups, completely
preventing oligonucleotide duplex formation. Duplex formation is restored when irradiated by light
at a specfic wavelength. Photolabile groups when introduced at specific locations render the
molecule inactive; however, upon irradiation with light at a particular wavelength, the molecules can
be activated (See detailed review by Shao and Xing, 2010; Tang et al. 2013; Liu and Deiters, 2014).
Caging groups can also be introduced at phosphate, 2′–OH, and nucleobases (Tang et al., 2013);
however, nucleobase caging has been of particular interest.
Oligonucleotides containing NVOC protecting groups were used as the photocleavable protecting
group at the N3 position of thymidine, and duplex formation was achieved by photoradiation at 365
nm for 5 h (Iwase et al., 2003).
NPOM–caged dT (X) introduced by the Deiters group is of particular interest. Figure 2.1.39 shows
the synthesis of NPOM–caged thymidine phsophoramidite S.62 (Lusic et al. 2007) from nucleoside
S.63 using reagent S.64, and DNA incorporating NPOM–caged thymdine was prepared by standard
phosphoramidite chemistry and irradiated at 365 nm to afford active

The Mechanical Basis Of Transcription Coupled Repair
DNA repair in motion: The mechanical basis of transcription–coupled repair in prokaryotes
Proper gene expression is crucial for normal physiological development. Unfortunately, the
structural and functional integrity of cellular DNA is constantly at risk by intrinsic and extrinsic
factors, from mistakes in metabolic processes to radiation damage. DNA repair pathways are critical
processes that address these offenses by maintaining the level genomic integrity necessary for
accurate cellular division and function. These pathways involve the seamless integration of repair
with processes that operate on DNA, such as replication and transcription [1]. However, the
coordination of these various pathways in DNA repair and the mechanisms by which specific sites
of damage are recognized remain poorly characterized.
Transcription–repair coupling factors (TRCFs) link DNA repair and transcription with a mechanism
known as transcription–coupled repair (TCR). The best characterized TCR pathway is found in the
prokaryotic system, which involves the TRCF Mfd. Mfd is a double–stranded DNA translocase that
recognizes stalled RNA polymerases (RNAPs) in transcription elongation complexes [1]. Stalled
RNAPs act as beacons of DNA damage, nucleotide deprivation, and protein roadblocks in
transcription. Once Mfd associates with a stalled RNAP, its translocation activity is activated and it
pushes RNAP downstream. This process can lead to two possible outcomes. If RNAP is able to
bypass the lesion,

Contributions Of Nanotechnology
Mirkin has published on a variety of nanotechnology applications, including; anisotropic
nanostructures, programmable nanostructure, dip–pen nanolithography, and spherical nucleic acids.
The general goal of his research is to develop analytical technique, bio–diagnostic, and biotherapies
that are assisted by nanoparticles. The primary focus of this report will be Professor
Mirkin's work on bio–therapeutics performed with spherical nucleic acids (SNA's).
A SNA can be defined as a nanoparticle bound with a dense oligonucleotide (a polymer of 13–25
nucleotides) shell. 5 The nanoparticle core (nanocore) can be made from a variety of materials, such
as, gold, silver, cadmium selenide, and ferroferric oxide. The nanocore material maintains its ...
They discovered that SNA's have a high propensity for cellular uptake and are highly stable in
cellular environments. 5 SNA's biological applicability lies in their oligonucleotide shell. Many
diseases can be controlled via gene regulation (RNA interference therapeutics). To regulate gene
expression, oligonucleotides can be introduced into a cell. Oligonucleotides can then bind
complimentary sequence of RNA, inhibiting gene expression. However, free RNA is not easily
transported into the cell.
Furthermore, if RNA does enter a cell it is promptly degraded by nucleases. SNA's offer a solution
to this problem. They are readily transported into the cell via scavenger receptors and are immune to
nuclease degradation. 3 This relationship is observed because of their dense oligonucleotide shells.
An example of a disease that can be treated with RNA interference therapeutics is glioblastoma.
Glioblastoma is a neurodegenerative disease that is primary side effect is the development of brain
tumors. 6 Mirkin and co–worker's objective was to develop a SNA that could simultaneously
regulate oncogenes (genes that code for unregulated cell division) while being fluorescently active.
Two nanocore materials were utilized in this study: gold and gadolinium. The surfaces of these
nanocores were functionalized with a sequence of nucleic acids that was shown to down regulate the
expression of
Bcl2L12–protein, a protein that's overexpression is an indicator of glioblastoma. This

The And Pka Values Of Nucleobases
NUCLEOSIDE TAUTOMERISM AND pKa VALUES
The nucleophilicity of nucleobases (Figure 2.1.1) is dictated by the pKa of the amino and amido
functions and their tautomeric forms. Table 2.1.1 lists the pKa values of nucleobases. The amide–
like nitrogens (N3 of uridine and N1 of guanosine) are acidic in character, whereas the ring
nitrogens are basic. Therefore, at strongly alkaline pH, the proton at N3 of uridine and thymidine
and that at N1 of guanosine are removed. Under acidic conditions (at pH ~3), the sites of
protonation are N1 of adenosine and N3 of cytidine. At more acidic pH, the N7 of guanosine and
adenosine and the O4 of uridine are protonated. Thus, all the bases remain mostly uncharged in the
physiological range of pH 5 to 9 ... Show more content on Helpwriting.net ...
Quite clearly, protecting groups and the protocols for their installation and removal should be
designed to avoid various side reactions.
Nucleobases undergo substitution reactions with electrophilic reagents. For example, both N– and
O–alkylation of the imide and lactam groups occur with alkylating agents. The N7 position of
purines is also a potential site for electrophilic attack (Figure 2.1.5). Because of these competing
reactions, simple alkylation of exocyclic amino function is not a viable protection strategy for
nucleobases. On the other hand, it is possible to chemoselectively acylate the exocyclic amino
group. Thus, acyl–type protecting groups are widely used for the protection of the exocyclic amino
groups of nucleosides (Figure 2.1.7).
The imide/lactam NH of thymidine, uridine (pKa, 9.38), and guanosine (pKa, 9.42) is weakly acidic
and can deprotonate under basic conditions. The resulting nucleophilic anion can react with a variety
of reagents such as activated phosphates, dicyclohexylcarbodiimide (DCC), mesitylene sulfonyl
chloride, 1–(mesitylene–2–sulfonyl)–3–nitro–1,2,4–triazole (MSNT), acid chlorides,
phosphitylating reagents, and electrophilic reagents that are employed during coupling reactions.
These side reactions result in nucleobase–derived N– and O–products.
Nucleosides also react with a variety of nucleophilic reagents. For example,

Optimization of Asymmetric PCR for Generation of a Single...
Aptamers are short DNA or RNA oligonucleotides with high, specific affinity to a special target.
The name was originated from aptus that means "to fit" and meros that shows the polymer identity
of oligonucleotides (1, 2). Aptamer characteristics provide prominent potential applications in
multiple fields.These nucleic acid ligands are completely generated through in vitro process for a
wide range of targets from small molecules and ions to large proteins and cells and even whole
organism or tissue. Their chemical modifications could be easily performed to improve the intended
specificity. Meanwhile, they keep their stability against various conditional stresses and show lower
toxicity and immunogenicity than other specific ligands e.g. monoclonal antibodies. Because of the
high specificity, adaptability, and ease of modification, aptamers have been used in a broad range of
applications, including affinity purification, drug discovery, high–throughput screening, drug
delivery, medical diagnostics and biosensors (3–5).
In molecular biology, there are several methods that could help researchers for in vitro evolution of
single stranded oligonucleotide pools to high affinity ligands like aptamers. In vitro evolution is the
experimental process in which large random–sequence pools of RNA or DNA are used as the
starting point and particular nucleic acid sequences with higher affinity to an intended target are
identified as aptamers. This type of selection and evolution is termed

How Mongersen Is Increase Anti Inflammatory Cell Signaling...
–1. Sketch how mongersen is expected to increases anti–inflammatory cell signaling. (10%) Since
gut inflammation of Crohn's disease is characterized by abnormal decreases in the activity of the
immunosuppressive cytokine transforming growth factor (TGF)–β1, which is induced by the
increased level of SMAD7 protein, because it would prevent TGF–β1–associated and SMAD–
associated signaling.[1] The formulation of Mongersen (formerly GED–0301) contains a 21–base
single–strand phosphorothioate oligonucleotide, which would hybridize to the human SMAD7
messenger RNA (mRNA) complementary and then facilitate RNase H–mediated RNA
degradation[1], thus it would reduce the translation product and help maintain the level of SMAD7
protein in the normal range. –2. Find the structure of mongersen: ––what is the "backbone" of
mongersen? (5%) Mongersen is a 21–base phosphorothioate oligonucleotide with the sequence 5′–
GTC GCC CCT TCT CCC CGC AGC–3′.[1] The nonbonding oxygen in each internucleotide
linkage of phosphodiesters is replaced by a sulfur atom(shows as Fig1). Also, the cytosine residues
at nucleotide positions 3 and 16 are modified by 5–methylation.[1] Fig 1. The difference between
phosphodiester linkage and phosphorothioate linkage. ––why might the developers have chosen this
backbone over other possibilities for antisense or siRNA molecules? (5%) The oligonucleotide
antisense matches complementary to the region 107–128 of the human Smad7 mRNA sequence, and
its

What Is The Role Of FXI As A Therapeutic Strategy For...
FXI play a crucial role in coagulation, thromboembolism, and peripheral vascular disease mediated
by venous thrombus growth in an endothelial denudated vessel and/or blood stasis. Promotion of the
platelet aggregation and fibrin formation at low shear stress by the interaction of FXI and thrombin
signify the role of FXI in thromboembolism [47]. Further, reduction in the thrombus formation in a
denuded vessel with anti–FXI antibody indicates FXI to be a promising target in coagulation
cascade to prevent thromboembolic events [47,48]. Many studies has demonstrated the reduced
thrombus formation without increasing the risk of bleeding with antisense oligonucleotide (ASO)
along with increased number of fluorescent platelets shed from the ... Show more content on
Helpwriting.net ...
Factor XII inhibition and atherothrombosis
The role of FXII and FXIIa in atherothrombosis and inflammation has been documented in various
studies. Since inflammation does play a role in the pathogenesis of plaque formation and plaque
rupture resulting in thrombus formation, inhibiting FXII/FXIIa might abrogate the ongoing
inflammation and thrombus formation [7,29]. The findings of substantially less infarcted brain
without an increase in infarct–associated hemorrhage in FXII–deficient and FXII inhibitor treated
mice after transient middle cerebral artery occlusion suggest FXII to be dispensable for hemostasis
but instrumental in fibrin formation. This effect was due to impaired pathological fibrin formation
after FXII inhibition without increased bleeding [53]. Additionally, minimized trauma–induced
microvascular thrombus formation and ischemic injury with factor XII inhibitor rHA–Infestin–4 in
mice signify the thromboprotective effect of FXII inhibition [54] (Figure 2). These studies support
that FXII inhibition might be a safe and selective thromboprotective strategy [15].
To date, several classes of inhibitors of FXII and FXIIa including antibodies, biological inhibitors,
recombinant proteins, synthetic peptides, and antisense oligonucleotides along with their mode of
action, concurrent side–effects and the animal models in which

The Structural Domains And Mechanism Of Action Of Ribozymes
1) Describe the structural domains and mechanism of action of ribozymes. How can ribozymes be
useful as therapeutic agents? (10 points)
RNA molecules that act as enzymes are called ribozymes. They are capable of catalyzing the
cleavage of their own RNA or other RNA substrates (Missailidis, 2008). Ribozymes are involved in
viroid replication, RNA splicing and protein synthesis. (Clark & Russel, 2005) The structure of
ribozymes consist of a catalytic domain and a substrate binding domain. (Ebrahimian, 2015)
The substrate binding domain has a specific sequence antisense to the target mRNA. This sequence
recognizes and hybridizes specifically to its substrate. (Missailidis, 2008). Alteration of the substrate
binding domain can be done so that the substrate specifically cleaves any mRNA sequence. The
RNA catalytic domain cleaves the substrate at a target site recognized by the ribozyme (Glick
&Pasternak, 2003). The resultant products are then degraded by ribonucleases and the ribozyme
dissociates itself from the RNA products and binds to another mRNA to be cleaved. (Missailidis,
2008)
Therapeutic ribozymes can be designed to target almost any RNA sequence and decrease the amount
of a particular protein that is synthesized (Glick & Pasternak, 2003). This can be done by
incorporating the catalytic domain of ribozyme into short oligonucleotides antisense to the target
mRNA (Missailidis, 2008). Ribozymes can be used to identify specific sites and introduced into the
system to

Disadvantages Of Oculocutaneous Albinism
ALBINISM, OCULOCUTANEOUS, TYPE II; OCA2
Referance: PubMed: #8723691 Oculocutaneous albinism is set of disorders that affect pigmentation
of the skin, hair, eyes; owing to autosomal recessive inheritance of derangement of melanin
biosynthesis. There are 4 varieties of oculocutaneous albinism including type I, type II, type III, type
IV. Second type of oculocutaneous occurs in the presence of mutations in the OCA2 gene as known
as BOCA, Pink–eyed dilution protein homolog, P gene. OCA2 encodes P protein that takes the role
of the passage of tyrosine which is the precursor of melanin, whereat we can reach the fact that
OCA2 involves melanin synthesis process, therefore flaws in OCA2 causes disorders associated
with melanin metabolism. The main characteristics of oculocutaneous albinism type II are
nystagmus, reduced iris pigment with iris transillumination, reduced retinal pigment with
visualization of the choroidal blood vessels, foveal hypoplasia1 and common ocular alterations seen
in the every type of albinism. Additionally some of the OCA2 patients can obtain small amounts of
melanin with age, consequently there could be ... Show more content on Helpwriting.net ...
OCA2 is aoutosomal disorder that has been associated with partial deletion in 15q11–q13 segments
which makes some flaws in P protein metabolism, OCA2 is the most prevalent form of the OCA.2
OCA2 found more frequently in people from sub–Saharan Africa and African Americans (OCA2
found in 0.1 percent of African Americans which is almost 4 times prevalent

Personalised Medicine: A Case Study
Why does the European commission get involved with introducing such measures? For the most
part it's to protect certain aspects of the industry like personalised medicine. Personalised medicine
or targeted therapy can be described as medical exemplary using molecular caricature technologies
to tailor the right curative design for the right individual at the right time. (European Commission,
2010) There may be some challenges that face the current European pharmaceutical regulatory
system that are likely to arise from development of anti–sense oligonucleotides for example,
(Johnston et al. 2014) will companies be able to fund proper research into clinical trials in order to
customize anti–sense oligonucleotides for boys suffering from Duchenne

Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover therapeutic aptamers for VEGF165 and EGFR by high–fidelity pentamer condon set Dehui
Kong, Department of Chemistry, University of Georgia Introduction Aptamers are ssDNA or RNA
oligonucleotides with very high affinity for their target. They bind to their target with high
selectivity and specificity because of their well–defined tertiary structures. Researchers speculate
that aptamers have the potential to replace antibodies as high–affinity reagents in medical
diagnostics and therapy. SELEX (Systematic evolution of ligands by exponential enrichment) is
often used in evolve aptamers for various molecular targets[1]. The concept of using aptamers as
therapeutic agents was first envisioned in the 1990s[2], with recent advances enabling their
translation into the clinic[3]. In 2005, the first aptamer therapeutic was approved by the FDA to treat
the wet form of age–related macular degeneration[4]. Aptamers have impressive advantages over
antibodies[5]: (i) the in vitro selection process does not require the use of animals or cell culture
which enables toxic or non–immunogenic targets aptamer selection;(ii) their generation through in
vitro selection enables ready tuning of binding and specificity properties; (iii) their active structure
can be reversibly formed by thermal denaturation and cooling; (iv) they exhibit excellent chemical
stability and shelf–life; (v) their chemical synthesis is predictable and scalable. Fig.1
Antibody/Aptamer– protein

Exam 2 Answers Essay example
Biol 385: Biotech. and Gen. Eng. Name ___________________________
Exam #2 – 100pts 06 April 2012 G # _____________________
=======================================================================
If necessary, use the back of the exam pages for the rest of your answers. Do not use other sheets of
paper. Please write legibly; if I cannot read your answer, I will count it wrong. * BY TAKING THIS
EXAM, YOU HAVE AGREED TO ABIDE BY THE SPIRIT AND THE LETTER OF THE
HONOR CODE OF GEORGE MASON UNIVERSITY. INITIAL HERE
=======================================================================
1. (6pts) Expression of eukaryotic proteins in prokaryotic cells occasionally results in instability or
... Show more content on Helpwriting.net ...
Draw a schematic of the vector and include all of the genetic loci that will permit this two–gene
vector to function as a shuttle vector between human cells and E.coli cells. (For your convenience, I
have put the A and B polypeptide coding regions on the two–gene vector schematic.)
See Figure 7.20 on page 184, Chapter 07 of the text.
A two gene vector will have a two promoters and two polyA sites to permit expression of both
coding regions, which will be on two mRNAs. As a shuttle vector it will also have an E.coli ori and
selectable marker, and a eukaryotic selectable marker and either a eukaryotic ori or sequences to
permit homologous recombination into the chromosome.
7. (3pts) A technician from the BIOtique, Ltd. Protein Engineering Group comes to you for advice
regarding her protein of interest. She needs to improve the enzyme in order for Biotique, Ltd. to
compete effectively in a new commercial market area. What are three properties of her enzyme that
you could suggest that might be useful to change by directed mutagenesis in order to improve her
enzyme?
1) kinetic property – Vmax kinetic property – Km Thermal stability pH optimum
2) altered allosteric regulation increased resistance to degradation removal of co–factor requirement
increased reactivity in non–aqueous solvent
3) altered specificity of substrate binding
8. (6pts) BIOtique, Ltd.'s Molecular Genetic Diagnostics

Western Blotting Of Camkii Œí And T 287
Western blotting of CaMKIIβ and T–287 phosphorylated CaMKIIβ Western blotting was performed
as described previously (Chapter 3). In short, Proteins were extracted from OLs using RIPA buffer
with protease and phosphatase inhibitors. The concentration of extracted proteins was assessed using
the BCA assay. Target proteins were probed with primary antibodies for CaMKIIβ (1:1000, Life
Technologies) and phosphor–CaMKIIβ (T287) (1:1000, Abcam) at 4°C overnight. Membranes were
incubated with appropriate IRDye secondary antibodies (1:3000, Li–COR, Lincoln, NE) for 1 h at
room temperature, and imaged using an Odyssey Imager (Li–COR). Protein bands were quantified
using Li–COR image studio software. RT–PCR analysis of CaMKII transcription RNAs were
extracted from OLs or cerebral cortex of P2 ICR mice using the miRNAeasy Mini Kit (QIAGEN
Inc. Valencia, CA). Concentration of RNAs from each sample was determined using NanoDrop
ND–1000 spectrophotometer (Thermo Scientific). Equal amount of RNAs were then used as
template to transcribe cDNA using a High capacity cDNA reverse transcription kit (Life
Technologies). Gene–specific primer pairs were designed using NCBI Gene database and primer
design web tool (http://www.ncbi.nlm.nih.gov). The web tool generates a series of primer sets that
fit the parameters defined by users. These parameters include size of the final product and the
primers, whether primers span the junctions between exons, GC contents of the primer etc. For each
isoform

An Analysis Of The Stanford Understudy Space Activity
OSM remains for Oligonucleotide Synthesizer intended for use in Microgravity, implying that it's a
gadget that makes discretionary DNA strands (of direct length) in space. Cool eh? I've been taking a
shot at this venture throughout the previous eight months with a brilliant group of kindred
programmers as a feature of the Stanford Understudy Space Activity, and I'd get a kick out of the
chance to share what we're doing, what we've effectively done, and where we're going. Why space?
All things considered, above all else, space is cool. Be that as it may, all the more genuinely, access
to self–assertive DNA in space could quicken investigate in a plenty of fields, and the capacity to
hereditarily design microbes to create substances (say ... Show more content on Helpwriting.net ...
What's more, one more note: DNA has two distinct finishes: a three prime (3′) end and a five prime
end (5′). Oligonucleotide (Ah–li–go–new–klee–o–tide) Oligonucleotides are short DNA or RNA
atoms and are super valuable when all is said in done research, hereditary testing, and
bioengineering. The length of an oligo (short for oligonucleotide) is generally indicated as 30–mer
or d30 on account of an oligo with 30 bases. How short does a strand of DNA must be to be viewed
as an oligo? All things considered, back when we were... suppose not very great at DNA union,
oligonucleotides were immovably in the 2–50 territory. Be that as it may, with the appearance of
phosphoramidite (an inorganic DNA union technique), oligonucleotides can run from 2–1000+
bases long. Homopolymer An oligonucleotide included just a single sort of base (eg AAAAAA
instead of AGTCTG) is known as a homopolymer. Terminal Deoxynucleotidyl Transferase (TdT)
Terminal Deoxynucleotidyl Transferase, ordinarily shortened to TdT, is a polymerase–like protein
that can add self–assertive nucleotides to the 3′ end of a DNA strand when certain conditions are
met. TdT can affix each of the four nucleotides however demonstrates an inclination for guanine (G)
and cytosine (C). TdT can be discovered normally in youthful, pre–B, and pre–T lymphoid cells
where it performs hereditary enhancement for our invulnerable frameworks by including bases onto
the 3′ (three prime) end of

Exploring Antisense Based Therapeutics 's Therapeutic...
This research project will aim to explore antisense–based therapeutics in two key areas, it's
therapeutic potential and it's utility as a research tool. Antisense technology uses a single stranded
molecule that is complementary to a specific sequence and binds to that sequence to ultimately
silence it. With two antisense based therapies being approved by the FDA, antisense based
therapeutics have been shown to hold potential in both research development and therapeutics. A
literature search will be undertaken comprising of books, journals, review articles, news articles and
clinical trials. The evidence will then be categorised against the aims of the project. The evidence
will be assimilated through critical analysis using research methodology assessing the quality of
research papers and systematic reviews using tools such as PRISMA. A descriptive summary and
tables will be used to present the evidence using objective statistical tools where possible and meta–
analysis will be applied if the data is homogeneous. The project aims to critically evaluate the
available evidence highlighting the therapeutic potential of antisense treatments in specific disease
areas as well as its future potential. The research potential of antisense as a tool will also be
evaluated using an evidence based approach. Background Antisense–based therapeutics have
attracted much interest as a novel class of agents for the treatment of 'viral infections, cancers and
genetic disorders due to their

The Method Of Detection Of Dna
1. Primer Annealing – temperature is lowered so that primers attach to DNA strands
2. Extension – DNA polymerase (e.g. Taq) helps to make new DNA strands.
The PCR cycle continues as DNA is copied exponentially. The original PCR methods allowed
detection of DNA growth at the end of the process; however the introduction Real Time–PCR (RT–
PCR) has allowed DNA amplification progress to be monitored throughout the assay (6).
RT–PCR is often confused with reverse–transcriptase PCR (rt–PCR), however rt–PCR is a method
of detecting RNA by utilising reverse transcriptase to synthesise cDNA by. cDNA is then amplified
and detected by PCR techniques (6).
RT–PCR has now advanced so that assays can now screen several viral DNA/RNA at once
(Multiplex PCR). The Roche – Cobas TaqScreen MPX Test v2.0 encompasses an rt–PCR stage to
allow detection of:
HIV–1 Group M (RNA)
HIV–1 Group O (RNA)
HIV–2 (RNA)
HCV (DNA)
HBV (DNA)
(5)
MPX PCR uses several gene specific primers (forward and reverse strands) within a reaction mix.
Internal controls are present within the testing kit, making the process highly efficient. By
combining several tests on one platform, this is a very lean method testing; however there is a small
risk of cross–hybridisation due to the volume of different primers used (5,6).
An added benefit of using RT–PCR to screen viral targets is that they shorten the detection window
period of some viruses. This means, even if a viral marker can be detected serologically

Creating an E. Coli Strain to Produce Antivenom Essay example
Background Each year snakes envenomate 421,000 people, 20,000 of whom die. These injuries are
especially concentrated in developing countries, where snake bites are an occupational hazard.
(Kasturiratne et al. 2008). The negative impact of this could be alleviated by the creation and
production of a low–cost, human–compatible universal antivenom. Lethal Toxin Neutralizing
Factor, henceforth LTNF, is a substance that has been isolated from opossum (Didelphis virginiana)
serum, liquid component of blood. LTNF can neutralize nearly all venoms, by a mechanism not yet
understood, including those never before encountered by the opossum (Menchaca & Perez 1981,
Shier 2008). The active site of LTNF has been isolated into a 15 amino acid–long ... Show more
content on Helpwriting.net ...
Currently, antivenoms are produced by injecting non–lethal doses of the venom into other animals,
typically large mammals, and collecting the antibodies produced in response (Domont et al. 1991).
In contrast, our project produces LT–15 using genetically manipulated E. coli. There are immense
benefits to our project. Primarily, the benefits derive from the use of LT–15 as a universal antivenom
in medical settings. With LT–15, medical facilities can carry fewer venom–specific antivenoms and
more LT–15, reducing storage costs. Additionally, LT–15 could be used as an initial or booster
antivenom, for when the active venom cannot be immediately identified. Furthermore, use of LT–15
could decrease the per–unit cost of antivenom. Because production of antivenom has high fixed
costs but low variable costs, economies of scale exist and the average cost falls as production
quantity rises. Since LT–15 could be used universally, we anticipate a large demand for it, leading to
a lower cost for per–unit of LT–15 than for each antivenom it replaces (Chen et al. 1995). Finally,
the use of an E. coli to produce antivenom would nearly eliminate the allergic reactions many
patients experience with antivenoms produced in large mammals (Lipps 2000). Current antivenom
production yields a large quantity of animal serum with many antibodies, only some of which are
venom–specific. In order to achieve adequate levels of specific antivenom in the bloodstream, a
large

Origin Of Replication Is The Starting Point Of Dna...
BME–603 Exam 2 – Tao Xu (Nov–9–2016)
Origin of replication is the starting point of DNA replication. It cannot replicate in the host cells
without this site.
Antibiotic resistance gene can be served as a select agent to find the right clone and then improve
the plasmid transformation efficiency. Antibiotic resistance gene can also give the bacteria a
pressure to have the plasmid, because the bacteria would use more energy to replicate both the
plasmid and its own DNA.
(1) The protein needs complex eukaryotic post–translational modifications for structure.
(2) The eukaryotic proteins are not well folded in E. coli and form insoluble aggregates.
(3) Proteins are secreted, membrane or intracellular.
cDNA library is usually used to expressing eukaryotic gene in prokaryotes. There are no introns in
E. coli DNA, so it does not have enzymes which could cut it out in the transcription procedure. In
cDNA library, there are no introns, so it could be expressed in E. coli cells.
Genomic DNA library have the non–coding and regulatory sequence while cDNA library doesn't,
but genomic DNA library is hard to make and maintain.
(1) 2–10 kb fragments: Plasmid
Reason: Plasmid is autonomous and self–replicating circular extra–chromosomal DNA molecule.
The plasmid–based vectors is usual used to clone small DNA inserts up to 15 kb.
(2) 15–20 kb fragments: Bacteriophage lambda
Reason: Bacteriophage λ is an E. coli virus. Insertion vector is usual used to clone inserts from 5–11
kb, while

Are Antisense Oligonucleotides and Effective Trearment for...
Introduction The concept of an Antisense oligonucleotide (an ASO) was first introduced by
Stephenson and Zamecnik, who used an antisense nucleotide to stop viral replication in cell
culture[1]. The effectiveness of ASOs as treatments has already been seen in other disease, such as
Vitravene (or Fomivirsen), which was the first ASO made publicly available, and is used to treat
cytomegalovirus retinitis, as well as Isis 3521 which when given to lung cancer patients in addition
to combination chemotherapy has been seen to raise life expectancy by as much as 50%[2]. From
these past successes, many have hypothesised that they might make an effective treatment for
Huntington's disease (HD) as well, which currently we are only able to treat the ... Show more
content on Helpwriting.net ...
From the effectiveness of the application of antisense oligonucleotides in other disease of a similar
pathology, it stands to reason that ASOs should be a viable therapeutic for treating Huntington's
disease. Issues with the use of ASOs as therapeutics While a promising target, the use of antisense
oligonucleotides in treating Huntington's disease has not been without its issues. The first issue that
using ASOs in the treatment of HD that we face is the lack of stability found in ASOs in their
normal state. Without modification, most ASOs are broken down immediately upon entrance into
the host body by intracellular endo and exonucleases. This is a huge fault in therapeutics, as if the
ASO is broken down it will be unable to produce its desired effects, but also as one of the by–
products created by its degradation– dNMP2 mononucleotides– is cytotoxic and so could cause
further potential harm to the patient [2]. This problem has been resolved in many cases through
modifications to the structure of the ASOs. One such modification is it's methylation to form a
methylphosphonate backbone, which has a far superior stability to the original ASO, but has itself
faced issues due to the reduction in charge that occurs after methylation, which reduces the ASOs
stability in the body. Another, far more widely used modification in

A Short Note On The And Its Effects On Breast Cancer Tissue
3.1. MiR–206 was prominently downregulated in TNBC tissues and inversely correlated with VEGF
Quantitative RT–PCR results show that expression levels of miR–206 are obviously lower in TNBC
cell lines than those in non–TNBC cell lines (Fig. 1A). Similarly, TNBC tissues express prominently
lower levels of miR–206 compared to non–TNBC tissue samples and normal breast tissues (Fig.
1B). It is worth noting that non–TNBC tissues expressed lower miR–206 compared to normal breast
tissues but miR–206 levels in non–TNBC tissues were higher than those in TNBC tissues (Fig. 1B).
Furthermore, we analyzed the expression levels of VEGF protein determined by
immunohistochemical staining in breast cancer tissue samples. VEGF expression levels were
inversely correlated with those of miR–206 in breast cancer tissues (Fig. 1C). These results
demonstrate that expression levels of miR–206 are predominantly downregulated in TNBC tissues
in comparison to non–TNBC tissues and normal breast tissue samples inversely correlated with the
levels of VEGF.
3.2. MiR–206 mimics predominantly inhibit the invasion of TNBC cells in vitro
To investigate whether miR–206 mimics block the invasion of TNBC cells, miR–206 mimics or
control oligonucleotides were transfected into TNBC MDA–MB–231 and non–TNBC MCF–7 cells.
The invasive cells from treated groups were determined and compared to their controls by Matrigel
invasion assay. Fig 2A shows representatives of invasive cell photographs from

What Are The Significance Of Long Non-Coding Rnas In...
1. Beermann J, Piccoli M–T, Viereck J, Thum T. Non–coding RNAs in development and disease:
background, mechanisms, and therapeutic approaches. Physiological reviews. 2016;96(4):1297–325.
2. Chandra Gupta S, Nandan Tripathi Y. Potential of long non‐coding RNAs in cancer patients:
From biomarkers to therapeutic targets. International journal of cancer. 2017;140(9):1955–67.
3. Dykes I, Emanueli C. Transcriptional and Post–transcriptional Gene Regulation by Long Non–
coding RNA. Genomics, Proteomics & Bioinformatics. 2017.
4. Chen Z–H, Wang W–T, Huang W, Fang K, Sun Y–M, Liu S–R, et al. The lncRNA HOTAIRM1
regulates the degradation of PML–RARA oncoprotein and myeloid cell differentiation by enhancing
the autophagy pathway. Cell Death & ... Show more content on Helpwriting.net ...
Genomic classification and prognosis in acute myeloid leukemia. New England Journal of
Medicine. 2016;374(23):2209–21.
13. Zeng C, Yu X, Lai J, Yang L, Chen S, Li Y. Overexpression of the long non–coding RNA PVT1
is correlated with leukemic cell proliferation in acute promyelocytic leukemia. Journal of
hematology & oncology. 2015;8(1):126.
14. Bassett AR, Akhtar A, Barlow DP, Bird AP, Brockdorff N, Duboule D, et al. Considerations
when investigating lncRNA function in vivo. Elife. 2014;3:e03058.
15. Cheetham S, Gruhl F, Mattick J, Dinger M. Long noncoding RNAs and the genetics of cancer.
British journal of cancer. 2013;108(12):2419–25.
16. Yao Y, Li J, Wang L. Large intervening non–coding RNA HOTAIR is an indicator of poor
prognosis and a therapeutic target in human cancers. International journal of molecular sciences.
2014;15(10):18985–99.
17. Castanotto D, Lin M, Kowolik C, Wang L, Ren X–Q, Soifer HS, et al. A cytoplasmic pathway
for gapmer antisense oligonucleotide–mediated gene silencing in mammalian cells. Nucleic acids
research. 2015;43(19):9350–61.
18. Soifer HS, Koch T, Lai J, Hansen B, Hoeg A, Oerum H, et al. Silencing of gene expression by
gymnotic delivery of antisense oligonucleotides. Functional Genomics: Methods and Protocols.
2012:333–46.
19. Fazil MHUT, Ong ST, Chalasani MLS, Low JH, Kizhakeyil A, Mamidi A, et al. GapmeR
cellular internalization by macropinocytosis induces

Eukaryotic Genome Editing
INTRODUCTION
With the development of biological technologies, a new era of making and manipulating DNA
sequences has come. Molecular biologists have gained the ability to delete, insert, isolate DNA
sequences and gene fragments, as well as to make targeted modifications to the genome in vitro, in
cells, and in model organisms. These technologies have made it possible to study genes and DNA
fragments by dissecting the functions of complex genes and specific regulatory elements. For
biological research, powerful genome editing tools will contribute to the understanding of genes,
proteins, and biological systems networks. The genome engineering also benefits a broad range of
applications, such as: stimulating new generations of drug development and medical therapeutics,
increasing agricultural crop products.
Ever since the discovery of DNA double helix structure, Eukaryotic organisms genome editing has
attracted widespread attention, and biologists have been attempting different techniques to introduce
site–specific modifications to the genomes of cells and model organisms. However, it is difficult to
manipulate Eukaryotic genomes as they usually contain billions of DNA base pairs. Different
genome editing methods, including specific designed oligonucleotides or cross linking reagents (1),
peptide nucleic acids ... Show more content on Helpwriting.net ...
This easy–to–use technique will facilitate understanding genome functions and their relationships. It
has sparked a revolution in genome engineering field since 2012. Below we review the history of
CRISPR–Cas9 system development, reveal its underlying molecular mechanism and discuss its
applications, challenges and future avenues of this novel

Site Directed Mutagenesis ( Sdm ) Technique
Site–directed mutagenesis (SDM) technique is commonly used to induce desired change in DNA
plasmid sequence by mutation, insertion or deletion with oligonucleotide primers (1). This SDM
usually cooperate with ploymerase chain reaction (PCR) as to amplify the concentration of mutated
template (2). PCR, a temperature–based cycle reaction, is completed with three initial steps
including denaturing the DNA template, anneal the mutated oligonucleotide primers and elongating
the mutated primer with ploymerase (1). One of the special comment in the PCR–based SDM is the
DnpI endonuclease (restriction enzyme for digest meth ylated DNA) digestion that is removing
parent DNA templates which are methylated (1). Following, the step is transformation of the
mutated DNA into bacterial system which allows the gene undergo nick repair, and further the
antibiotic selection with ampicillin resistance (1). The antibiotic resistance aims to select the the
bacterial that are successfully transformed with desired mutated DNA (shown in Figure 1) (1). After
being transformed into bacterial system and grow overnight, the mutated plasmid needs to be isolate
from the system which is based on the different denatured stage of bacterial genome and mutated
plasmid DNA (3). With this step, the first centrifugation allows the separation of the growth media
and bacterial cells; the added lysis solution is able to denature the bacterial genome and mutated
plasmid DNA; the neutralization solution is

A summary analysis of the article “Microarray detection of...
Introduction:
In the field of public health, food–borne illnesses are a major concern because it has been estimated
that each year 76 million cases occur in the United States causing 5,000 deaths (Suo et al., 2010). In
2008, the Center for Disease Control and Prevention's FoodNet surveillance program reported over
18 thousand cases of food–borne illnesses occurred in 10 states (Center for Disease Control and
Prevention [CDC], 2008). According to estimates from the CDC (2011), the most common food–
borne pathogens that maybe seen in the United States are Norvovirus (58%), Clostridium
perfringens (10%), Salmonella (11%), Campylobacter spp. (9%), and Staphylococcus aureus (3%).
Among the other 9% (not published) include Escherichia coli ... Show more content on
Helpwriting.net ...
The emergence of DNA based technologies such as the polymerase chain reaction (PCR) and
microarray analysis have been utilized in the rapid detection and identification of many pathogenic
bacteria (Mothershed & Whitney, 2006; Versalovic & Lupski, 2002). The expansion of these
technologies has significantly enhanced the sensitivity, specificity and the rapid detection of
microorganisms (Suo et al., 2010). Microarray technologies have the potential to perform high–
throughput detection of multiple pathogens. Recent work with specific oligonucleotide probes
suggests that pathogen detection can be performed on a sample that contains a mixed culture of
bacteria (Kim et al., 2008). This paper will
Purpose of Research:
Previous work with DNA based technologies to accurately detect and identify human pathogens has
been demonstrated. Furthermore, three methods have been utilized: 1) amplification of one or more
universal genes (16S rRNA and 23S rRNA) through PCR, 2) amplification of pathogen–specific
markers (toxins, virulence factors) using multi–plex PCR and 3) amplification of random DNA
fragments (Kim et al., 2008). Kim et al. (2008) state that the first two methods is flawed due to the
limited number of probes utilized and that the amplification of universal genes would not
discriminate below species level due to the fact that these genes are highly conserved within the
genus. On the other hand, Kim et al. (2008) reported that

Anti Sense Therapy ( Lnp ) Essay
1) Abstract: Although Anti–sense Therapy has limitations related to targeted drug delivery, it is still
considered as one of the promising technology for treating most of the Rare and Inherited disorders,
being categorized as precision medicine has advanced very much with recent advances in drug
delivery technologies like lipid nanoparticle (LNP) formulations, cell–targeting technologies. Anti–
sense drugs are seen as most potential drugs for treating debilitating conditions with more targeted
approach. The journey of Anti–sense oligonucleotides from the state of highly potential drug
candidates to a sudden debacle with limitations in drug delivery and toxicity and the resume of these
candidates with technological advancements will be reviewed with a special focus on application of
this technology for the treatment of Huntington's disease and spinal muscular atrophy. The most
recently accepted application of Nusinersen, an anti–sense oligonucleotide drug for spinal muscular
atrophy by US FDA and EMA and many candidates in late stage clinical trials proves the viability
and glory of these candidates as potential drugs for treatment of rare diseases and conditions that
need more targeted approach.
2) Anti–Sense Therapy:
a) Definition: Anti–sense therapy involves the use of antisense DNA or RNA for the inhibition of
transcription or translation of a specific gene or gene product for therapeutic purposes. Anti–Sense
oligonucleotides are small pieces of DNA or RNA that can

Solid Phase Peptide Synthesis And Solid-3 Synthesis Of A...
In this essay, solid phase peptide synthesis and solid phase synthesis of a primer will be compared
and contrast. Solid phase peptide synthesis is the production of peptides, whereas the solid phase
synthesis of a primer involves the production of oligonucleotides. A brief summary of each will be
discussed in this essay. With understanding the processes involves, there are two similarities and
differences that will also be discussed in this essay.
In the solid phase peptide synthesis, a protected amino acid with a tert–Butyloxycarbonyl protecting
group is anchored to a chlorinated reactive resin. Afterwards, the amino acid is deprotected with
trifluoroacetic acid. After this is done, another protected amino activated with DCC is coupled to the
last amino acid at the N–terminal. Whenever all of the amino acids are done being added, the
peptide is released from the resin using hydrofluoric acid.
In the solid phase synthesis of primers, a ß–cyanoethyl (ßCE) group is added to the 3'–phosphoryl
oxygen atom, while a dimethoxytrityl (DMT) protecting group is attached to the 5'–oxygen atom.
Moreover, the 3' amine group of the activated monomer is coupled to the 5' hydroxyl group of a
nucleotide base attached to resin, creating a phosphite trimester intermediate. Next, the molecule is
oxidized with I2, adding a carbonyl oxygen atom to the phosphoryl group. Lastly, the molecule is
deprotected with dichloroacetitc acid, which helps remove the DM, but leaves the ßCE intact.
To begin,

The Viological Structure Of G-Protein Coupled Receptorss
INTRODUCTION
G–protein coupled receptors (GPCRs) are highly specialised proteins responsible for the
transmission of signals across the cell membrane. They sense signaling molecules such as hormones
and neurotransmitters, and thus play a very important physiological role in the human body
(Venkatakrishnan et al., 2017). GPCRs are also known as metabotropic receptors, which indicates
that they are involved in intracellular signaling.
Scientific Background
The results from numerous research were combined to create a model for the structure of GPCRs
and the heterotrimeric G protein, which aided our understanding of the molecular nature of GPCRs
and its functions. GPCRs are proteins that span the plasma membrane 7 times, hence the name "7 ...
De Lean and Lefkowitz carried out competitive binding experiments to investigate the interaction
between extracellular ligands (both antagonist and agonist), GPCRs and X – a membrane
component.
Method
The antagonist [3H]DHA and the agonist [3H]HBI were incubated with freshly prepared plasma
membranes and appropriate unlabeled ligand for 60 minutes at 25oC. The reaction was stopped by
the addition of ice–cold buffer, and filtered on glass fibre filters. After additional washings with 5ml
of buffer, the concentration of radioactive ligands (antagonists / agonists) trapped on the filters was
measured. Agonist binding is reversible, thus the regular incubation period (60 minutes) was
doubled to ensure that the conditions were compatible with true equilibrium. The binding of
[3H]DHA and [3H]HBI to the frog erythrocyte β–Adrenergic receptor were plotted in saturation and
competition curves.
Results
It had been observed that the binding competition curve for antagonists are steep, and express low
affinity, On the other hand, binding competition curves for agonists are shallow, showing 2 distinct
binding states: high and low affinity state. They discovered that the addition of guanine receptors
could convert the high affinity state to low. This observation was also described in numerous other
GPCRs, such as

Polymerase Chain Reaction Lab Report
Polymerase Chain Reaction (PCR) is a process that uses primers to amplify specific cloned or
genomic DNA sequences with the help of a very unique enzyme. In this experiment, PCR was used
to amplify the cDNA inserts from three purified DNA plasmids, taking into consideration that the
cDNAs were all different in size, as predicted in the previous study, so there would be different
sized DNA bands on agarose gel as well. In PCR, a primer and dNTPs are added along with a DNA
template and the Taq DNA polymerase. The original template is melted (at 94oC), the primers
anneal (45–55oC) and the polymerase makes two new strands (72oC), doubling the amount of DNA
present. This provides 2 new templates for the next cycle. The DNA is again melted, primers anneal,
and the Taq makes 4 new strands. The result is a dramatic amplification of the DNA that exists
between the primers. These cycles are repeated several times. The reaction is performed in a
thermocycler, which is programmable heating block that will cycle between melting, annealing ...
This technique is essential to resolve the PCR products and analyze them. The DNA is determined in
the gel by addition of ethidium bromide, which is mutagenic, or non–mutagenic dyes such as
GelRed. When these two bound to DNA fluoresce, meaning that they absorbe UV light. Therefore,
DNA images are available after gel is exposed to UV light from a UV transilluminator. Negatively
charged DNA will move towards the positively charged anode through the agarose gel, while the
migration of DNA is dependent of molecular DNA size, agarose concentration, DNA conformation
and applied current. Plasmid DNA extracted from bacterial cells can exist in three different
conformations of molecular size and will migrate at different rates. The mobility of these forms will
be influenced by agarose concentration and the strength of applied

Gel Electrophoresis Lab Report
Gel electrophoresis is a simple technique that allows us to determine the charges and molecular
weights of all sorts of macromolecules. The basic theory is a simple one: more negatively charged
molecules will migrate in an electric field, toward the positively charged cathode. A matrix (such as
agarose or polyacrylamide) must be used to conduct heat evenly and provide an extra sieving effect.
In particular, agarose gel electrophoresis is generally used to separate DNA (single–stranded,
double–stranded, and supercoiled) and RNA. Since DNA is negatively charged, it migrates in an
electric field toward the positively charged cathode. The agarose matrix retards DNA migration
roughly proportionally to DNA length. Longer oligonucleotides have a harder time traveling through
the matrix, while shorter oligonucleotides breeze right through it. The concentration of agarose in
the gel can be fine–tuned to achieve optimal separation for a specific range of sizes. The higher the
concentration of the gel, the lower the pore size will be. So, when the target DNA size is small,
higher concentration of agarose gel is used. Usually 1 to 2% gels are used for detecting plasmids
(several kb long) or their fragments (i.e. from digestions). For ... Show more content on
Helpwriting.net ...
This buffer contains chaotropic salts which remove all DNA binding proteins and nonspecific DNA
strands from PCR products. This is done through disruption of protein structure by destabilizing
hydrophobic interactions. High salt existence decreases the negativity of DNA and increases binding
affinity and stronger interaction with the column membrane. Ethanol added washing buffer
efficiently removes dNTPs, primer dimers, salt, buffer or anything except DNA from the column.
For complete removal of residual ethanol, extra centrifugation is done. Finally, DNA is eluted
utilizing nuclease free water as binding affinity of DNA with nuclease free water is

The Discovery Of Site Directed Mutagenesis
Site–directed mutagenesis, also known as oligonucleotide–directed mutagenesis, is a technique that
is used to intentionally modify a DNA sequence of a gene by introducing a site–specific mutation.
The general method for producing the defined oligonucleotide mutation was developed from a
combination of observations on nucleic acids, and it was in the 1978s where enzymatic extension
was used as an approach to SDM, using oligonucleotides as primer (Hutchinson, et al., 1978). Since
then, this technique has then been improved in efficiency in later studies which has stemmed from
this initial mutagenesis experiment, and thus novel methods of inducing site–specific mutagenesis
has been improved in later years.
The discovery of site–directed mutagenesis has played a significant role in scientific research
because its ability to change regions of DNA sequences enables precise molecular studies of genes
and proteins whose function is not yet known. In the past, UV (Scott, et al., 1976) and chemical
methods were used in biological research to induce mutations in attempt to study biological
processes. However, such methods were not site–specific in producing the mutations.
In this essay, I will be describing about the approaches and development of site–directed
mutagenesis over the years and also mention about its role in molecular research as well as its
importance in industry.
General method for site–directed mutagenesis
The general method for producing a defined point mutation

Crvical Cancer Essay
In Cytology the majority of the samples received are part of the NHS (National Health Service)
cervical screening programme. This programme facilitates the screening of cervical smears slides,
looking for abnormal cells in a woman's cervix, that may go on to form cervical cancer. 99.7 % of
cervical cancers are caused by a sexually transmitted infection called Human Papilloma Virus
(HPV). There are over a hundred different types of the HPV virus and certain ones are counted as
more 'high risk'. 80% of the population will have HPV at some point in their lives and in most cases
their immune system will get rid of it within a couple of years. Scientists still don't understand why
some women are able to clear the infection, while in others the ... Show more content on
Helpwriting.net ...
The pot and the tube are then put into the output section ready to be transferred onto the Panther by
a member of staff (Tomcat Instrument 2014). Gloves are always worn as you are unable to touch the
tube as you may transfer your DNA onto it and it may contaminate the test.
The second machine the Panther uses Real time TNA technology to identify pathogens like HPV by
their unique genetic sequencing. For HPV testing the Panther is testing for two of the hundred types
of HPV, 16 and 18 as these are the two types that are counted as high risk (Cervical screening 2016).
They are present when the HPV is less likely to regress and also therefore more likely to cause cell
abnormalities. The specific oligonucleotide and the T7 primers hydrolyse in the Panther are
specialised to only bind to HPV 16 and 18.
The Panther is loaded with the tray of the sample vials after they have been processed on the
Tomcat. The Panther is a fully automated system and can perform 275 tests per 8–hour shift and up
to 750 tests in 16 hours. . There are three main steps starting with the capture of targeted sequences.
Stage one the DNA in the pathogens is first transcribed into RNA so that is can be used, as a single
strand is needed. Then the pathogens are lysed to expose the nucleic acids and a specific
oligonucleotide hydrolyses to the

A Study On Using Enhanced Efficeincy
In order to improve photolytic deprotection with enhanced efficeincy, several other photoremovable
groups have been developed. Figure X.X.X shows o–nitrobenzyl protecting group together with
other common photolabile protecting groups such as 1–(o–nitrophenyl)ethyl (NPE), 2–(o–
nitrophenyl)–propyl (NPP), 6–nitroveratryloxycarbonyl (NVOC), 2,2–bis(2–
nitrophenyl)ethoxycarbonyl (diNPEOC), 4–N–[2–(2–nitropehnyl)–propoxy]carbonyl (NPPOC), 1–
(3–nitrodibenzofuran–1–yl)ethyl (NDBF), 6–nitropiperonyloxymethyl (NPOM), p–
hydroxyphenacyl (pHP), 7–(diethylaminocoumarin–4–yl)methoxy carbonyl (DEACM), and 6–
bromo–7–hydroxycoumarinyl–4–yl–methyl (Bhcmoc) and 6–bromo–7–methoxycoumarinyl–4–yl–
methyl (Bmcmoc). A combination of NPOM and NDBF caging group ... Show more content on
Helpwriting.net ...
Rodrigues–Correia et al., 2013 and 2014
Ohtsuki et al., 2016 R = H, 6–bromo–7–hydroxycoumarinyl–4–yl–methyl (Bhcmoc)
R = Me, 6–bromo–7–methoxycoumarinyl–4–yl–methyl (Bmcmoc) C(N4)
A(N6) Furuta et al., 2007 and references therein 1–(3–nitrodibenzofuran–1–yl)ethyl (NDBF) T(N3)
UV irradiation at 365 nm Lusic et al., 2010
Figure X.X.X. Photolabile nucleobase protection.
Photolabile nucleobase protection has been used to achieve exquisite control over biological
processes through light regulation, also referred as photocaging. The concept was introduced by
Engels (Engels and Schlaeger, 1977; Engels and Reidys, 1978) and independently by Hofmann
(Kaplan et al., 1978). Watson–Crick base pairing is blocked by caging groups, completely
preventing oligonucleotide duplex formation. Duplex formation is restored when irradiated by the
light at specfic wavelength. Photolabile groups when introduced at specific locations render the
molecule inactive; however, upon irradiation with light at particular wavelength, the molecules can
be activated (See detailed review by Shao and Xing, 2010; Tang et al. 2013; Liu and Deiters, 2014).
Caging groups can also be introduced at phosphate, 2–OH, and nucleobases (Tang et al., 2013);
however, nucleobase caging has been of particular interest.
Oligonucleotides containing NVOC protecting groups have used as the photocleavable protecting
group at the N3 position of

Lab Report
RESULTS
Airway epithelial cell PPARγ knockdown aggravates AAD induced lung resistance and
inflammatory cell infiltration.
Previously we have shown that PPAR gamma activation in lung .......
To test whether airway epithelial cell PPARγ knockdown exaggerates AAD induced airway
remodeling and inflammation, we have developed airway epithelial cell specific PPARγ knockout
mice (AEC–PPARγ–/–) and produced AAD with OVA sensitization and challenge as described
previously (PMID: 22617759 and PMID: 23913958).
To determine airway epithelial cell specific PPARγ knockdown resulted in pulmonary resistance, we
obtained respiratory resistance (R) measurements both at baseline and in response to increasing
doses of inhaled methacholine. The AEC–PPARγ–/– mice ... Show more content on Helpwriting.net
...
Histological examination of lung sections from AEC–PPARγ–/– mice showed focal bronchiolar
epithelial cell hyperplasia and sub epithelial fibrosis (Fig. 2A, red arrow head). This epithelial cell'
hyperplastic change was often accompanied by goblet cell hyperplasia. To investigate the changes in
goblet cell hyperplasia, we have stained the lung sections with periodic acid Schiff (PAS) stain. We
have observed the goblet cell hyperplasia and airways with PAS positive cells in both mice groups
with AAD. Airways containing goblet cells and mucus plugs were profuse in AEC–PPARγ–/– mice
than those of AEC–PPARγ+/+ mice (Fig. 2B).
Airway epithelial cell PPARγ regulates inflammatory cytokines
Figure 3
Airway epithelial cell PPARγ regulates inflammatory gene expression
Figure 4
The Muc5AC promoter contains a novel PPREs responsive to PPARγ
The possibility of Muc5AC regulation by PPARγ at the level of gene expression might be an
important event of PPARγ in epithelial cells along with its anti–inflammatory activities. To
investigate the basis for Muc5AC repression by PPARγ, we analyzed the MUC5AC promoter for the
presence of putative PPARγ transcription factor binding elements that may mediate this response. As
shown in schematic representation, our analysis identified a novel PPARγ response elements (PPRE)
between –3834 and –3821 bp (PPRE1: TGTTCAGAGGTCAA) and between –1207 and –1194 bp
(PPRE2: AGGACAAAGGGCC) in the MUC5AC

Hepg2 / C3a Cells : The Choice Of Cell Lines
The choice of cell lines
HepG2 / C3A cells: HepG2 / C3A cells are a hepatocellular carcinoma cell line provided by Baylor
College of Medicine, maintained by ATCC (American Type Cell Culture) in the United States.
HepG2 / C3A strongly express telomerase and secrete almost all proteins normally found in normal
serum and also the AFP. These cells are cultured in our laboratory as recommended by ATCC
(American Type Cell Culture). Indeed, HepG2 / C3A are cultured in DMEM + 10% FBS (Fetal
bovine serum) + 1% P / S (penicillin / streptomycin) + 1% NEAA (Non Essential amino acids) and
incubated at 37 ° in an incubator at 5% CO2PLC / PRF / 5 cells: PLC / PRF / 5 cell line is another
hepatocellular carcinoma maintained by the ATCC in the USA. PLC / ... Show more content on
Helpwriting.net ...
Cell viability test
Cell viability was determined using the tetrazolium salt 3– (4,5–dimethylthiazol–2–yl) –5– (3–
carboxymethoxyphenyl) –2– (4–sulfophenyl) –2H as reported by the manufacturer's instructions
(Sigma–Aldrich, USA ). The tetrazolium salt is cleaved to formazan by succinate– reductase, an
enzyme that exists only in the mitochondrial respiratory chain and is active only in viable cells.
Formazan production is proportional to the number of living cells in culture. Briefly, HepG2 / C3A
and PLC / PRF / 5 were seeded at 104 cells per well in 96 well plates. At 80% confluence, the cells
were treated with IL–6, PI3K/Akt/mTOR or telomerase inhibitor for 48 h. After treatment, 10 ul of
tetrazolium salt were added to 100 uL of culture medium, and the plate was incubated for 45 min at
37ºC. Absorbance was then measured using an ELISA reader at 450 nm.
RNA extraction and RT–PCR
Total RNA from HepG2 / C3A and PLC / PRF / 5 was extracted using the kit "GenElute Mammalian
Total RNA Kit" from Sigma–Aldrich (USA) according to manufacturer's instructions. The cDNA
was synthesized from 1 ug of RNA using the kit "iScript cDNA Synthesis" (Bio–Rad, USA).
Quantitative PCR was performed using the kit REDTaq Ready Mix PCR Reaction Mix (Sigma–
Aldrich, USA). The PCR primers have the following sequences:
AFP forward 5'–ACCCTGGTGTTGGCCAGT'–3'; AFP reverse 5'–
GCAGCGCTACACCCTGAGT–3'; hTERT forward 5'–TGAACTTGCGGAAGACAGTGG –3 '
hTERT reverse

Dr Lab Report
Introduction
Maintenance of genomic integrity is crucial for cell survival in resistance to endogenous and
exogenous environmental insults to the genetic material. Multiple DNA repair pathways coordinate
the response to such genotoxins and protect our genome [1]. Endogenous insults may be generated
as a byproduct of cellular metabolism in the form of reactive oxygen species or during physiological
processes such as meiotic recombination, mating–type switching in yeasts, V(D)J recombination and
DNA replication–transcription collision [2–5]. Exogenous stresses include hypoxia, radiation and
dietary carcinogens [6, 7]. Depending on the nature of damage to the DNA structure which, may
range from breaks in phosphodiester bonds such ... Show more content on Helpwriting.net ...
NER is a highly conserved DNA repair pathway that is the primary pathway responsible for the
removal of bulky DNA lesions i.e., helix–distorting lesions such as UV– induced photoproducts,
environmental mutagens, and some chemotherapeutic agents. NER has two distinct subtypes: global
genome repair (GG–NER), which can occur anywhere in the genome and transcription–coupled
repair (TC–NER), which removes distorting lesions that obstruct transcription [20, 21]. Following
lesion recognition, the damage–containing oligonucleotide is excised from DNA by a dual enzyme
incision step mediated by ERCC1–XPF, which makes the first incision and XPG which incises the 3'
end of single/double strand junction [22]. This results in the release of lesion–containing
oligonucleotide with TFIIH bound to it [23]. The gap–filling step in NER relies on the concerted
action of DNA ligase and its cofactors DNA polymerases δ and ε, the sliding clamp PCNA, the
clamp loader RFC and RPA [24]. MMR is a is a highly conserved post–replication repair pathway
that corrects DNA mismatches generated during DNA replication that escapes the proofreading
function of DNA polymerases thereby preventing mutations and tumorigenesis [25–27]. MutSα
recognizes the mismatches and MutLα forms nicks at the 3′– or 5′–end of the mismatched base that
are substrates for the EXOI exonuclease that excises resulting DNA segment is excised by the
EXO1 exonuclease in association with the single–stranded

Tomato Production Essay
Tomato production is affected by various bacterial, fungal and viral diseases which resulted in
considerable yield losses. Among those diseases, damping off, early blight, late blight, powdery
mildew, bacterial leaf spot, bacterial canker, buck eye rot, fusarium wilt, tomato spotted wilt, tomato
big bud, tomato bunch top , tomato mosaic and tomato leaf curl affect tomato production. Among all
the diseases of tomato, leaf curl disease of tomato (ToLCD) is the most devastating one as its
incidence and severity is increasing worldwide. A review suggested that there are more than 55
tomato–infecting geminiviruses throughout the world (Fauquet et al., 2008). ToLCD is caused by
viruses belonging to the genus begomovirus within the family Geminiviridae. In India also, ToLCD
is the major constraint to tomato production and causes serious yield loss (Vasudeva and Samraj,
1948; Banerjee and Kalloo, 1987; Saikia and Muniyappa, 1989; Rataul and Barar 1989; Varma and
Malathi, 2003; Chakraborty, 2008; Borah and Dasgupta, 2012; Kanakala et al., 2013). Infected
tomato plants infected exhibit severe reduction in leaf size, upward and downward curling of leaves,
crinkling of interveinal areas, interveinal and marginal chlorosis and in some cases purple
discolouration of the abaxial surface of the leaves. The disease induces severe stunting, development
of small branches that causes bushy growth, reduced fruiting or partial to complete sterility if
infection takes place at early stage of

Nucleic Acid Measurements

Empfohlen

Empfohlen

Weitere ähnliche Inhalte

Ähnlich wie Nucleic Acid Measurements

Ähnlich wie Nucleic Acid Measurements (16)

Mehr von Liz Sims

Mehr von Liz Sims (20)

Kürzlich hochgeladen

Kürzlich hochgeladen (20)

Nucleic Acid Measurements