SlideShare ist ein Scribd-Unternehmen logo
1 von 28
Downloaden Sie, um offline zu lesen
Analysis of Gene Expression
An overview




Setia Pramana
Outline
•  Biological	
  background	
  
    –  Central	
  Dogma	
  
    –  DNA	
  	
  
    –  Genes	
  
•  Genomics	
  
•  Microarrays	
  
•  Gene	
  Expression	
  data	
  analysis	
  pipeline	
  
•  What’s	
  next	
  ??	
  




                                          Gene	
  expression	
  analysis	
  
Central Dogma




                                                 http://compbio.pbworks.com
            Gene	
  expression	
  analysis	
  
DeoxyriboNucleic Acid (DNA)

•  DNA	
  is	
  the	
  organic	
  molecule	
  that	
  carries	
  the	
  informaBon	
  
                        used	
  by	
  a	
  cell	
  to	
  build	
  the	
  proteins	
  that	
  carry	
  out	
  most	
  of	
  
                        the	
  biological	
  processes	
  in	
  a	
  cell.	
  
•  Double	
  helix	
  
•  Pair:	
  G	
  ≡	
  C,A	
  =	
  T	
  	
  
•  Example	
  sequence:	
  
	
  	
  	
  	
  	
  	
  ATGCTGATCGATGCAGAATCGATC	
                                                                            wikipedia
•  Length	
  of	
  human	
  DNA	
  is	
  about	
  	
  
	
  	
  	
  	
  	
  	
  3	
  ×	
  109	
  base	
  pair	
  (bp)	
  
•  Between	
  us,	
  DNA	
  	
  99.9	
  %	
  the	
  same,	
  
•  Our	
  DNA	
  99	
  %	
  the	
  same	
  chimpanzees.	
  analysis	
      Gene	
  expression	
  

	
  
	
  
Gene
•  The	
  full	
  DNA	
  sequence	
  of	
  an	
  organism	
  is	
  called	
  its	
  
   genome	
  
•  A	
  segment	
  that	
  specifies	
  the	
  sequence	
  of	
  a	
  protein.	
  
•  Length:	
  1000-­‐3000	
  bases	
  	
  
•  Approximately	
  around	
  20,000	
  -­‐25,000	
  genes	
  	
  




                      Gene	
  expression	
  analysis	
  




h(p://www.dna-­‐sequencing-­‐service.com/dna-­‐sequencing/gene-­‐dna/
Genetic Code
•  NucleoBde	
  sequence	
  of	
  a	
  mRNA	
  is	
  translated	
  into	
  the	
  
   amino	
  acid	
  sequence	
  of	
  the	
  corresponding	
  protein.	
  




                                                                Gene	
  expression	
  analysis	
  


	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  hp://www.cs.tau.ac.il/~rshamir/	
  
Genomics
•  Genomics	
  is	
  the	
  study	
  of	
  all	
  the	
  genes	
  of	
  a	
  cell,	
  or	
  Bssue,	
  
   at	
  :	
  
    –  the	
  DNA	
  (genotype),	
  e.g.,	
  GWAS	
  SNP,	
  CNV	
  etc…	
  
    –  mRNA	
  (transcriptomics),	
  	
  Gene	
  expression,	
  
    –  or	
  protein	
  levels	
  (proteomics).	
  

•  FuncBonal	
  Genomics:	
  study	
  of	
  the	
  funcBonality	
  of	
  
     specific	
  genes,	
  their	
  relaBons	
  to	
  diseases,	
  their	
  
     associated	
  proteins	
  and	
  their	
  parBcipaBon	
  in	
  biological	
  
     processes.	
  
	
  
	
                  Gene	
  expression	
  analysis	
  
	
  
Gene Expression
•  Different	
  Bssues	
  in	
  the	
  same	
  human	
  may	
  express	
  different	
  genes,	
  
   according	
  to	
  their	
  role	
  in	
  the	
  human	
  body.	
  
•  The	
  same	
  cell	
  may	
  express	
  different	
  genes	
  under	
  different	
  circumstances	
  
   (stress,	
  nutriBon,	
  etc.).	
  
•  Cells	
  express	
  different	
  genes	
  during	
  lifeBme	
  (for	
  instance,	
  embryonic	
  gene	
  
   expression	
  differs	
  from	
  adult	
  gene	
  expression).	
  
•  Technologies	
  for	
  measuring	
  mRNA	
  assume:	
  
    –  The	
  level	
  of	
  mRNA	
  in	
  the	
  cell	
  is	
  an	
  indicaBon	
  of	
  the	
  protein	
  level	
  in	
  the	
  
       cell,	
  since	
  the	
  major	
  regularity	
  is	
  on	
  the	
  subscripBon	
  process,	
  and	
  not	
  
       the	
  transcripBon	
  process.	
  
    –  Genes	
  are	
  expressed	
  only	
  when	
  needed.	
  

                                                    Gene	
  expression	
  analysis	
  
Microarrays




              Gene	
  expression	
  analysis	
  
Microarray Technologies
•  Two	
  type	
  of	
  microarray	
  technologies:	
  	
  
    –  Single	
  channel	
  	
  
    –  Dual	
  channel	
  	
  
•  Plaforms:	
  	
  
    –  Affymetrix,	
  	
  
    –  Illumina,	
  	
  
    –  Agilent	
  




                                            Gene	
  expression	
  analysis	
  
Microarrays Applications
•  Gene	
  expression	
  profiling	
  (our	
  focus)	
  
•  SNP	
  arrays	
  for	
  studying	
  single	
  nucleoBde	
  polymorphisms	
  (SNP)	
  and	
  copy	
  
   number	
  variaBons	
  (CNV)	
  such	
  as	
  deleBons	
  or	
  inserBons.	
  
•  Etc:	
  	
  
    –  ChIP	
  on	
  chip	
  for	
  invesBgaBng	
  protein	
  binding	
  site	
  occupancy,	
  
    –  Exon	
  arrays	
  to	
  search	
  for	
  alternaBve	
  splicing	
  events	
  
    –  Tiling	
  arrays	
  for	
  idenBfying	
  novel	
  transcripts	
  that	
  are	
  either	
  coding	
  or	
  
        non-­‐coding.	
  




                                              Gene	
  expression	
  analysis	
  
Microarrays Applications: MammaPrint
•  MammaPrint-­‐	
  test,	
  can	
  determine	
  the	
  likelihood	
  of	
  breast	
  cancer	
  
   returning	
  within	
  10	
  years	
  aher	
  treatment.	
  
•  First	
  FDA-­‐approved	
  molecular	
  test	
  that	
  is	
  based	
  on	
  microarray	
  technology.	
  
•  Predict	
  whether	
  exisBng	
  cancer	
  will	
  metastasize.	
  	
  
•  InvesBgate	
  the	
  paerns	
  and	
  behavior	
  of	
  large	
  numbers	
  of	
  genes.	
  	
  
•  The	
  recurrence	
  of	
  cancer	
  is	
  partly	
  dependent	
  on	
  the	
  acBvaBon	
  and	
  
   suppression	
  of	
  certain	
  genes	
  located	
  in	
  the	
  tumor.	
  
•  MammaPrint	
  can	
  measure	
  the	
  acBvity	
  of	
  those	
  genes,	
  then	
  it	
  can	
  predict	
  	
  
   paBents’	
  odds	
  of	
  the	
  cancer	
  spreading.	
  



                                             Gene	
  expression	
  analysis	
  
The Pipeline
•  Experiment	
  design	
  à	
  Lab	
  work	
  à	
  Image	
  processing	
  	
  	
  
•  à	
  Background	
  correcBon	
  
•  à	
  NormalizaBon	
  	
  
•  à	
  Signal	
  summarizaBon	
  (GCRMA,	
  FARMS)	
  (for	
  affymetrix	
  plaform)	
  
•  à	
  Data	
  Analysis:	
  	
  
    –  DifferenBally	
  Expressed	
  genes	
  
    –  Clustering	
  
    –  ClassificaBon	
  
    –  Etc.	
  
•  à	
  Network	
  /	
  Pathways	
  	
  analysis	
  (GSEA	
  etc..)	
  	
  
•  à	
  Biological	
  interpretaBons	
  
                                       Gene	
  expression	
  analysis	
  
Image Processing




                                        http://isda.ncsa.uiuc.edu/Microarrays/
            Gene	
  expression	
  analysis	
  
Log2 Intensity
•  Response:	
  log2	
  Intensity	
  …….	
  	
  why?	
  
•  StaBsBcs:	
  Log-­‐transforming	
  the	
  data	
  makes	
  the	
  intensity	
  distribuBon	
  more	
  
   symmetric	
  and	
  bell-­‐shaped,	
  i.e.,	
  a	
  normal	
  distribuBon	
  
•  Biology:	
  The	
  biological	
  processes	
  in	
  whole	
  individuals	
  presumably	
  act	
  in	
  a	
  
   mulBplicaBve	
  way.	
  Log-­‐transformaBon	
  exactly	
  makes	
  the	
  intensiBes	
  and	
  
   the	
  expression	
  levels	
  behave	
  in	
  a	
  mulBplicaBve	
  way.	
  




                                            Gene	
  expression	
  analysis	
  
Normalization
•  Process	
  to	
  remove	
  systemaBc	
  errors	
  which	
  can	
  cause	
  
   considerable	
  biases.	
  	
  
•  SystemaBc	
  errors	
  are	
  due	
  to:	
  
    –  Different	
  incorporaBon	
  efficiencies	
  of	
  dyes.	
  	
  
    –  Different	
  amounts	
  of	
  mRNA	
  in	
  the	
  tested	
  sample,	
  
       causing	
  different	
  expression	
  levels.	
  
    –  Difference	
  in	
  experimenter	
  or	
  protocol	
  (if	
  data	
  were	
  
       gathered	
  in	
  different	
  labs).	
  
    –  Different	
  scanning	
  parameters	
  
    –  Differences	
  between	
  chips	
  created	
  in	
  different	
  
       producBon	
  batches.	
  
•  Example:	
  QGene	
  expression	
  analysis	
  
                     uanBle	
  normalizaBon	
  
Normalization




Gene	
  expression	
  analysis	
  
Microarrays, Data structure




                                                  http://www.ebi.ac.uk
             Gene	
  expression	
  analysis	
  
Microrrays, Applications

•  IdenBfy	
  diseases	
  related	
  genes	
  	
  
•  ClassificaBon,	
  example	
  Mamaprint	
  	
  
•  Cluster	
  genes	
  
•  Clusters	
  the	
  samples	
  (disease	
  stages,	
  Bssues)	
  :	
  class	
  
   discovery	
  
•  Clusters	
  genes	
  and	
  samples	
  	
  

•  Pharmacogenomics:	
  
    –  Personalized	
  medicine:	
  individualize	
  therapies	
  
    –  Target	
  based	
  medicine:	
  More	
  effecBve	
  but	
  less	
  side	
  
       effect	
  dGene	
  expression	
  analysis	
  
                 rugs.	
  

	
  
Data Analysis Challenges
•  The	
  curse	
  of	
  high-­‐dimensionality:	
  
•  Obstacle	
  in	
  the	
  soluBon	
  of	
  classificaBon	
  and	
  clustering	
  problems	
  
•  Problem	
  of	
  mulBple	
  tesBng	
  problem:	
  the	
  problem	
  of	
  having	
  an	
  increased	
  
   number	
  of	
  false	
  posiBve	
  results	
  because	
  the	
  same	
  hypothesis	
  is	
  tested	
  
   mulBple	
  Bmes.	
  
•  MulBple	
  tesBng	
  correcBon:	
  	
  
    –  FWER:	
  Bonferroni,	
  Holm.	
  	
  
    –  FDR:	
  BH,	
  BY	
  




                                           Gene	
  expression	
  analysis	
  
Identification of Differential Genes
•  Discover	
  genes	
  with	
  different	
  expression	
  in	
  two	
  or	
  more	
  different	
  Bssues/
   condiBons.	
  
•  Fold	
  change	
  
•  t-­‐type	
  test:	
  
     –  t-­‐	
  test	
  
     –  Modified	
  t-­‐test:	
  Significance	
  	
  
                                 	
  Analyss	
  of	
  Microarray	
  (SAM),	
  
     	
  	
  	
  	
  	
  	
  	
  	
  t	
  -­‐	
  LIMMA	
  

•  Linear	
  Models	
  for	
  Microarray	
  Data	
  
        	
  (LIMMA)	
  
                                          Gene	
  expression	
  analysis	
  
Clustering
•  Clustering	
  genes	
  or	
  condiBons	
  or	
  both.	
  
•  Deducing	
  funcBons	
  of	
  unknown	
  genes	
  from	
  known	
  genes	
  with	
  similar	
  
     expression	
  paerns.	
  
•  IdenBfying	
  disease	
  profiles	
  -­‐	
  Bssues	
  with	
  similar	
  pathology	
  should	
  yield	
  
     similar	
  expression	
  profiles.	
  	
  
•  Co-­‐expression	
  of	
  genes	
  may	
  imply	
  co-­‐regulaBon.	
  	
  
•  ClassificaBon	
  of	
  biological	
  condiBons.	
  	
  
•  Drug	
  development	
  
	
  



                                             Gene	
  expression	
  analysis	
  
Clustering
Statistical Methods: Hierarchical
clustering, K-means, CLICK (CLuster
Identification via Connectivity Kernels),
Biclustering, etc.
More:
http://www.bioconductor.org/help/course-
materials/2002/Seattle02/Cluster/
cluster.pdf




                                 Gene	
  expression	
  analysis	
  
Classification

•  Classification of tumor malignancies into
   known classes : supervised learning;
•  Identification of marker genes that
   characterize the different tumor classes:
   feature selection.




Genes distinguishing ALL from AML (two
types of leukemia).
                                   Gene	
  expression	
  analysis	
  
Classification

•  Methods:	
  
    –  Discriminant	
  analysis	
  :	
  LDA,	
  K	
  nearest	
  neighbor.	
  
    –  ClassificaBon	
  Tree	
  
    –  LogisBc	
  regression,	
  penalized	
  LR:	
  LASSO.	
  
    –  Neural	
  network	
  
    –  Support	
  vector	
  machines	
  (SVM)	
  
    –  Random	
  forest,	
  etc…..	
  
    A	
  survey	
  of	
  these	
  methods:	
  
    hp://www.ibiostat.be/publicaBons/phd/suzyvansanden.pdf	
  
    hp://www.stat.cmu.edu/~jiashun/Research/sohware/Data/papers/
    dudoit.pdf	
                          Gene	
  expression	
  analysis	
  

    	
  
Pathways Analysis
•  We	
  discover	
  DE	
  genes,	
  
   what's	
  next?	
  
•  IdenBfy	
  which	
  pathways	
  
   (e,g,.	
  GO	
  KEGG)	
  terms	
  are	
  
   most	
  commonly	
  associated	
  
   with	
  the	
  	
  DE	
  genes.	
  
•  Methods:	
  GEA,	
  GSEA,	
  NEA,	
  
   etc.	
  




                                               Gene	
  expression	
  analysis	
  
What’s next
•  Next-­‐generaBon	
  sequencing	
  
    +	
  No	
  need	
  to	
  know	
  the	
  sequence	
  of	
  the	
  transcript.	
  
    +	
  There	
  are	
  no	
  arBfacts	
  due	
  to	
  cross-­‐hybridizaBon	
  
    +	
  Beer	
  quanBtaBon	
  of	
  low	
  abundance	
  transcripts.	
  
    -­‐	
  New	
  data	
  types	
  and	
  huge	
  data	
  volumes.	
  
    -­‐	
  Quality	
  
•  EpigeneBcs	
  
    –  The	
  study	
  of	
  heritable	
  changes	
  in	
  genome	
  funcBon	
  
            that	
  occur	
  without	
  a	
  change	
  in	
  DNA	
  sequence	
  (
            hp://epigenome.eu/en/1,1,0	
  ).	
  	
  
    –  DNA	
  methylaBon	
  
                    Gene	
  expression	
  analysis	
  
Reference
•  Gohlmann,,	
  H.	
  and	
  Talloen,	
  W,	
  Gene	
  Expression	
  Studies	
  Using	
  Affymetrix	
  
     Microarrays,	
  Chapman	
  &	
  Hall/CRC	
  MathemaBcal	
  &	
  ComputaBonal	
  
     Biology,	
  2009.	
  
•  hp://www.cs.tau.ac.il/~rshamir/ge/09/	
  
	
  
Other	
  useful	
  books:	
  
•  Gentleman	
  R,	
  Carey	
  V,	
  Huber	
  W,	
  Irizarry	
  R,	
  Dudoit	
  S,	
  editors:	
  
     BioinformaBcs	
  and	
  computaBonal	
  biology	
  soluBons	
  using	
  R	
  and	
  
     Bioconductor	
  .	
  Springer	
  Science,	
  New	
  York,	
  2005.	
  
•  Amaratunga	
  D,	
  Cabrera	
  J:	
  ExploraBon	
  and	
  Analysis	
  of	
  DNA	
  Microarray	
  and	
  
     Protein	
  Array	
  Data.	
  Wiley-­‐Interscience,	
  2004.	
  

                                           Gene	
  expression	
  analysis	
  

Weitere ähnliche Inhalte

Was ist angesagt?

Was ist angesagt? (20)

Genome annotation
Genome annotationGenome annotation
Genome annotation
 
Express sequence tags
Express sequence tagsExpress sequence tags
Express sequence tags
 
SAGE (Serial analysis of Gene Expression)
SAGE (Serial analysis of Gene Expression)SAGE (Serial analysis of Gene Expression)
SAGE (Serial analysis of Gene Expression)
 
Comparative genomics
Comparative genomicsComparative genomics
Comparative genomics
 
DNA Sequencing
DNA SequencingDNA Sequencing
DNA Sequencing
 
Electrophoretic mobility shift assay
Electrophoretic mobility shift assay Electrophoretic mobility shift assay
Electrophoretic mobility shift assay
 
Restriction Fragment Length Polymorphism (RFLP)
Restriction Fragment Length Polymorphism (RFLP)Restriction Fragment Length Polymorphism (RFLP)
Restriction Fragment Length Polymorphism (RFLP)
 
Pyrosequencing
PyrosequencingPyrosequencing
Pyrosequencing
 
Next generation sequencing methods (final edit)
Next generation sequencing methods (final edit)Next generation sequencing methods (final edit)
Next generation sequencing methods (final edit)
 
Functional genomics
Functional genomicsFunctional genomics
Functional genomics
 
Transfection methods (DNA to host cell)
Transfection methods (DNA to host cell) Transfection methods (DNA to host cell)
Transfection methods (DNA to host cell)
 
Transcriptome Analysis & Applications
Transcriptome Analysis & ApplicationsTranscriptome Analysis & Applications
Transcriptome Analysis & Applications
 
Restriction mapping
Restriction mappingRestriction mapping
Restriction mapping
 
DNA microarray
DNA microarrayDNA microarray
DNA microarray
 
S1 Mapping
S1 Mapping  S1 Mapping
S1 Mapping
 
Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)
Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)
Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
An Introduction to Genomics
An Introduction to GenomicsAn Introduction to Genomics
An Introduction to Genomics
 
Differential gene profiling methods
Differential gene profiling methodsDifferential gene profiling methods
Differential gene profiling methods
 
Shotgun and clone contig method
Shotgun and clone contig methodShotgun and clone contig method
Shotgun and clone contig method
 

Andere mochten auch

Ch 11 gene expression lecture presentation
Ch 11 gene expression lecture presentationCh 11 gene expression lecture presentation
Ch 11 gene expression lecture presentation
tas11244
 
Analysis of gene expression
Analysis of gene expressionAnalysis of gene expression
Analysis of gene expression
Tapeshwar Yadav
 

Andere mochten auch (20)

Gene expression
Gene expressionGene expression
Gene expression
 
Ch 11 gene expression lecture presentation
Ch 11 gene expression lecture presentationCh 11 gene expression lecture presentation
Ch 11 gene expression lecture presentation
 
Slides5
Slides5Slides5
Slides5
 
Gene expression
Gene expressionGene expression
Gene expression
 
Chap11 studyppt
Chap11 studypptChap11 studyppt
Chap11 studyppt
 
Ch09 combinatorialpatternmatching
Ch09 combinatorialpatternmatchingCh09 combinatorialpatternmatching
Ch09 combinatorialpatternmatching
 
Genotyping a deletion mutation in C. elegans via PCR
Genotyping a deletion mutation in C. elegans via PCRGenotyping a deletion mutation in C. elegans via PCR
Genotyping a deletion mutation in C. elegans via PCR
 
Dna replication
Dna replicationDna replication
Dna replication
 
PRML 13.2.2: The Forward-Backward Algorithm
PRML 13.2.2: The Forward-Backward AlgorithmPRML 13.2.2: The Forward-Backward Algorithm
PRML 13.2.2: The Forward-Backward Algorithm
 
Use of Rasmol and study of proteins
Use of Rasmol and study of proteins Use of Rasmol and study of proteins
Use of Rasmol and study of proteins
 
DNA Replication & Repair.
DNA Replication & Repair.DNA Replication & Repair.
DNA Replication & Repair.
 
Analysis of gene expression
Analysis of gene expressionAnalysis of gene expression
Analysis of gene expression
 
Assembly: before and after
Assembly: before and afterAssembly: before and after
Assembly: before and after
 
1. vectors
1. vectors1. vectors
1. vectors
 
Cloning and expression vectors
Cloning and expression vectorsCloning and expression vectors
Cloning and expression vectors
 
Studying gene expression and function
Studying gene expression and functionStudying gene expression and function
Studying gene expression and function
 
Polymerases,
Polymerases,Polymerases,
Polymerases,
 
Experession vectores ppt bijan zare
Experession vectores ppt bijan zareExperession vectores ppt bijan zare
Experession vectores ppt bijan zare
 
Artificial neural network model & hidden layers in multilayer artificial neur...
Artificial neural network model & hidden layers in multilayer artificial neur...Artificial neural network model & hidden layers in multilayer artificial neur...
Artificial neural network model & hidden layers in multilayer artificial neur...
 
Immune response to viruses
Immune response to virusesImmune response to viruses
Immune response to viruses
 

Ähnlich wie Gene expression introduction

Genomics and bioinformatics
Genomics and bioinformatics Genomics and bioinformatics
Genomics and bioinformatics
Senthil Natesan
 
Microarray and dna chips for transcriptome study
Microarray and dna chips for transcriptome studyMicroarray and dna chips for transcriptome study
Microarray and dna chips for transcriptome study
Bia Khan
 
SNPs Presentation Cavalcanti Lab
SNPs Presentation Cavalcanti LabSNPs Presentation Cavalcanti Lab
SNPs Presentation Cavalcanti Lab
jsrep91
 

Ähnlich wie Gene expression introduction (20)

Functional genomics
Functional genomicsFunctional genomics
Functional genomics
 
Comparative and functional genomics
Comparative and functional genomicsComparative and functional genomics
Comparative and functional genomics
 
20170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_10120170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_101
 
microarrary
microarrarymicroarrary
microarrary
 
Genomics and bioinformatics
Genomics and bioinformatics Genomics and bioinformatics
Genomics and bioinformatics
 
Genomics(functional genomics)
Genomics(functional genomics)Genomics(functional genomics)
Genomics(functional genomics)
 
2017 molecular profiling_wim_vancriekinge
2017 molecular profiling_wim_vancriekinge2017 molecular profiling_wim_vancriekinge
2017 molecular profiling_wim_vancriekinge
 
THE human genome
THE human genomeTHE human genome
THE human genome
 
Microarray and dna chips for transcriptome study
Microarray and dna chips for transcriptome studyMicroarray and dna chips for transcriptome study
Microarray and dna chips for transcriptome study
 
Transcriptomics,techniqes, applications.pdf
Transcriptomics,techniqes, applications.pdfTranscriptomics,techniqes, applications.pdf
Transcriptomics,techniqes, applications.pdf
 
Experimental methods and the big data sets
Experimental methods and the big data sets Experimental methods and the big data sets
Experimental methods and the big data sets
 
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
 
SNPs Presentation Cavalcanti Lab
SNPs Presentation Cavalcanti LabSNPs Presentation Cavalcanti Lab
SNPs Presentation Cavalcanti Lab
 
1.introduction to genetic engineering and restriction enzymes
1.introduction to genetic engineering and restriction enzymes1.introduction to genetic engineering and restriction enzymes
1.introduction to genetic engineering and restriction enzymes
 
Genomics seminar copy
Genomics seminar   copyGenomics seminar   copy
Genomics seminar copy
 
SNPs analysis methods
SNPs analysis methodsSNPs analysis methods
SNPs analysis methods
 
Single-cell RNA-seq tutorial
Single-cell RNA-seq tutorialSingle-cell RNA-seq tutorial
Single-cell RNA-seq tutorial
 
Tecnologías con DNA
Tecnologías con DNATecnologías con DNA
Tecnologías con DNA
 
Genomics: Organization of Genome, Strategies of Genome Sequencing, Model Plan...
Genomics: Organization of Genome, Strategies of Genome Sequencing, Model Plan...Genomics: Organization of Genome, Strategies of Genome Sequencing, Model Plan...
Genomics: Organization of Genome, Strategies of Genome Sequencing, Model Plan...
 
Genomics types
Genomics typesGenomics types
Genomics types
 

Mehr von Setia Pramana

Multivariate data analysis
Multivariate data analysisMultivariate data analysis
Multivariate data analysis
Setia Pramana
 
Gene sebuah nikmat Allah
Gene sebuah nikmat AllahGene sebuah nikmat Allah
Gene sebuah nikmat Allah
Setia Pramana
 

Mehr von Setia Pramana (20)

Big data for official statistics @ Konferensi Big Data Indonesia 2016
Big data for official statistics @ Konferensi Big Data Indonesia 2016 Big data for official statistics @ Konferensi Big Data Indonesia 2016
Big data for official statistics @ Konferensi Big Data Indonesia 2016
 
Resampling methods
Resampling methodsResampling methods
Resampling methods
 
Introduction to Computational Statistics
Introduction to Computational StatisticsIntroduction to Computational Statistics
Introduction to Computational Statistics
 
Bioinformatics I-4 lecture
Bioinformatics I-4 lectureBioinformatics I-4 lecture
Bioinformatics I-4 lecture
 
Correlation and Regression Analysis using SPSS and Microsoft Excel
Correlation and Regression Analysis using SPSS and Microsoft ExcelCorrelation and Regression Analysis using SPSS and Microsoft Excel
Correlation and Regression Analysis using SPSS and Microsoft Excel
 
Pengalaman Menjadi Mahasiswa Muslim di Eropa
Pengalaman Menjadi Mahasiswa Muslim di EropaPengalaman Menjadi Mahasiswa Muslim di Eropa
Pengalaman Menjadi Mahasiswa Muslim di Eropa
 
Multivariate data analysis
Multivariate data analysisMultivariate data analysis
Multivariate data analysis
 
The Role of The Statisticians in Personalized Medicine: An Overview of Stati...
The Role of The Statisticians in Personalized Medicine:  An Overview of Stati...The Role of The Statisticians in Personalized Medicine:  An Overview of Stati...
The Role of The Statisticians in Personalized Medicine: An Overview of Stati...
 
Introduction to R
Introduction to RIntroduction to R
Introduction to R
 
High throughput Data Analysis
High throughput Data AnalysisHigh throughput Data Analysis
High throughput Data Analysis
 
Research Methods for Computational Statistics
Research Methods for Computational StatisticsResearch Methods for Computational Statistics
Research Methods for Computational Statistics
 
Survival Data Analysis for Sekolah Tinggi Ilmu Statistik Jakarta
Survival Data Analysis for Sekolah Tinggi Ilmu Statistik JakartaSurvival Data Analysis for Sekolah Tinggi Ilmu Statistik Jakarta
Survival Data Analysis for Sekolah Tinggi Ilmu Statistik Jakarta
 
The Role of Statistician in Personalized Medicine: An Overview of Statistical...
The Role of Statistician in Personalized Medicine: An Overview of Statistical...The Role of Statistician in Personalized Medicine: An Overview of Statistical...
The Role of Statistician in Personalized Medicine: An Overview of Statistical...
 
“Big Data” and the Challenges for Statisticians
“Big Data” and the  Challenges for Statisticians“Big Data” and the  Challenges for Statisticians
“Big Data” and the Challenges for Statisticians
 
Getting a Scholarship, how?
Getting a Scholarship, how?Getting a Scholarship, how?
Getting a Scholarship, how?
 
Kehidupan sehari-hari dengan Personnummer atau SIN Single Identity Number
Kehidupan sehari-hari dengan Personnummer atau SIN Single Identity NumberKehidupan sehari-hari dengan Personnummer atau SIN Single Identity Number
Kehidupan sehari-hari dengan Personnummer atau SIN Single Identity Number
 
Research possibilities with the Personal Identification Number (person nummer...
Research possibilities with the Personal Identification Number (person nummer...Research possibilities with the Personal Identification Number (person nummer...
Research possibilities with the Personal Identification Number (person nummer...
 
Developing R Graphical User Interfaces
Developing R Graphical User InterfacesDeveloping R Graphical User Interfaces
Developing R Graphical User Interfaces
 
Academia vs industry
Academia vs industryAcademia vs industry
Academia vs industry
 
Gene sebuah nikmat Allah
Gene sebuah nikmat AllahGene sebuah nikmat Allah
Gene sebuah nikmat Allah
 

Kürzlich hochgeladen

Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
fonyou31
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
QucHHunhnh
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
QucHHunhnh
 

Kürzlich hochgeladen (20)

Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room service
 
The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13
 
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdf
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot Graph
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SD
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 

Gene expression introduction

  • 1. Analysis of Gene Expression An overview Setia Pramana
  • 2. Outline •  Biological  background   –  Central  Dogma   –  DNA     –  Genes   •  Genomics   •  Microarrays   •  Gene  Expression  data  analysis  pipeline   •  What’s  next  ??   Gene  expression  analysis  
  • 3. Central Dogma http://compbio.pbworks.com Gene  expression  analysis  
  • 4. DeoxyriboNucleic Acid (DNA) •  DNA  is  the  organic  molecule  that  carries  the  informaBon   used  by  a  cell  to  build  the  proteins  that  carry  out  most  of   the  biological  processes  in  a  cell.   •  Double  helix   •  Pair:  G  ≡  C,A  =  T     •  Example  sequence:              ATGCTGATCGATGCAGAATCGATC   wikipedia •  Length  of  human  DNA  is  about                3  ×  109  base  pair  (bp)   •  Between  us,  DNA    99.9  %  the  same,   •  Our  DNA  99  %  the  same  chimpanzees.  analysis   Gene  expression      
  • 5. Gene •  The  full  DNA  sequence  of  an  organism  is  called  its   genome   •  A  segment  that  specifies  the  sequence  of  a  protein.   •  Length:  1000-­‐3000  bases     •  Approximately  around  20,000  -­‐25,000  genes     Gene  expression  analysis   h(p://www.dna-­‐sequencing-­‐service.com/dna-­‐sequencing/gene-­‐dna/
  • 6. Genetic Code •  NucleoBde  sequence  of  a  mRNA  is  translated  into  the   amino  acid  sequence  of  the  corresponding  protein.   Gene  expression  analysis                                                                hp://www.cs.tau.ac.il/~rshamir/  
  • 7. Genomics •  Genomics  is  the  study  of  all  the  genes  of  a  cell,  or  Bssue,   at  :   –  the  DNA  (genotype),  e.g.,  GWAS  SNP,  CNV  etc…   –  mRNA  (transcriptomics),    Gene  expression,   –  or  protein  levels  (proteomics).   •  FuncBonal  Genomics:  study  of  the  funcBonality  of   specific  genes,  their  relaBons  to  diseases,  their   associated  proteins  and  their  parBcipaBon  in  biological   processes.       Gene  expression  analysis    
  • 8. Gene Expression •  Different  Bssues  in  the  same  human  may  express  different  genes,   according  to  their  role  in  the  human  body.   •  The  same  cell  may  express  different  genes  under  different  circumstances   (stress,  nutriBon,  etc.).   •  Cells  express  different  genes  during  lifeBme  (for  instance,  embryonic  gene   expression  differs  from  adult  gene  expression).   •  Technologies  for  measuring  mRNA  assume:   –  The  level  of  mRNA  in  the  cell  is  an  indicaBon  of  the  protein  level  in  the   cell,  since  the  major  regularity  is  on  the  subscripBon  process,  and  not   the  transcripBon  process.   –  Genes  are  expressed  only  when  needed.   Gene  expression  analysis  
  • 9. Microarrays Gene  expression  analysis  
  • 10. Microarray Technologies •  Two  type  of  microarray  technologies:     –  Single  channel     –  Dual  channel     •  Plaforms:     –  Affymetrix,     –  Illumina,     –  Agilent   Gene  expression  analysis  
  • 11. Microarrays Applications •  Gene  expression  profiling  (our  focus)   •  SNP  arrays  for  studying  single  nucleoBde  polymorphisms  (SNP)  and  copy   number  variaBons  (CNV)  such  as  deleBons  or  inserBons.   •  Etc:     –  ChIP  on  chip  for  invesBgaBng  protein  binding  site  occupancy,   –  Exon  arrays  to  search  for  alternaBve  splicing  events   –  Tiling  arrays  for  idenBfying  novel  transcripts  that  are  either  coding  or   non-­‐coding.   Gene  expression  analysis  
  • 12. Microarrays Applications: MammaPrint •  MammaPrint-­‐  test,  can  determine  the  likelihood  of  breast  cancer   returning  within  10  years  aher  treatment.   •  First  FDA-­‐approved  molecular  test  that  is  based  on  microarray  technology.   •  Predict  whether  exisBng  cancer  will  metastasize.     •  InvesBgate  the  paerns  and  behavior  of  large  numbers  of  genes.     •  The  recurrence  of  cancer  is  partly  dependent  on  the  acBvaBon  and   suppression  of  certain  genes  located  in  the  tumor.   •  MammaPrint  can  measure  the  acBvity  of  those  genes,  then  it  can  predict     paBents’  odds  of  the  cancer  spreading.   Gene  expression  analysis  
  • 13. The Pipeline •  Experiment  design  à  Lab  work  à  Image  processing       •  à  Background  correcBon   •  à  NormalizaBon     •  à  Signal  summarizaBon  (GCRMA,  FARMS)  (for  affymetrix  plaform)   •  à  Data  Analysis:     –  DifferenBally  Expressed  genes   –  Clustering   –  ClassificaBon   –  Etc.   •  à  Network  /  Pathways    analysis  (GSEA  etc..)     •  à  Biological  interpretaBons   Gene  expression  analysis  
  • 14. Image Processing http://isda.ncsa.uiuc.edu/Microarrays/ Gene  expression  analysis  
  • 15. Log2 Intensity •  Response:  log2  Intensity  …….    why?   •  StaBsBcs:  Log-­‐transforming  the  data  makes  the  intensity  distribuBon  more   symmetric  and  bell-­‐shaped,  i.e.,  a  normal  distribuBon   •  Biology:  The  biological  processes  in  whole  individuals  presumably  act  in  a   mulBplicaBve  way.  Log-­‐transformaBon  exactly  makes  the  intensiBes  and   the  expression  levels  behave  in  a  mulBplicaBve  way.   Gene  expression  analysis  
  • 16. Normalization •  Process  to  remove  systemaBc  errors  which  can  cause   considerable  biases.     •  SystemaBc  errors  are  due  to:   –  Different  incorporaBon  efficiencies  of  dyes.     –  Different  amounts  of  mRNA  in  the  tested  sample,   causing  different  expression  levels.   –  Difference  in  experimenter  or  protocol  (if  data  were   gathered  in  different  labs).   –  Different  scanning  parameters   –  Differences  between  chips  created  in  different   producBon  batches.   •  Example:  QGene  expression  analysis   uanBle  normalizaBon  
  • 18. Microarrays, Data structure http://www.ebi.ac.uk Gene  expression  analysis  
  • 19. Microrrays, Applications •  IdenBfy  diseases  related  genes     •  ClassificaBon,  example  Mamaprint     •  Cluster  genes   •  Clusters  the  samples  (disease  stages,  Bssues)  :  class   discovery   •  Clusters  genes  and  samples     •  Pharmacogenomics:   –  Personalized  medicine:  individualize  therapies   –  Target  based  medicine:  More  effecBve  but  less  side   effect  dGene  expression  analysis   rugs.    
  • 20. Data Analysis Challenges •  The  curse  of  high-­‐dimensionality:   •  Obstacle  in  the  soluBon  of  classificaBon  and  clustering  problems   •  Problem  of  mulBple  tesBng  problem:  the  problem  of  having  an  increased   number  of  false  posiBve  results  because  the  same  hypothesis  is  tested   mulBple  Bmes.   •  MulBple  tesBng  correcBon:     –  FWER:  Bonferroni,  Holm.     –  FDR:  BH,  BY   Gene  expression  analysis  
  • 21. Identification of Differential Genes •  Discover  genes  with  different  expression  in  two  or  more  different  Bssues/ condiBons.   •  Fold  change   •  t-­‐type  test:   –  t-­‐  test   –  Modified  t-­‐test:  Significance      Analyss  of  Microarray  (SAM),                  t  -­‐  LIMMA   •  Linear  Models  for  Microarray  Data    (LIMMA)   Gene  expression  analysis  
  • 22. Clustering •  Clustering  genes  or  condiBons  or  both.   •  Deducing  funcBons  of  unknown  genes  from  known  genes  with  similar   expression  paerns.   •  IdenBfying  disease  profiles  -­‐  Bssues  with  similar  pathology  should  yield   similar  expression  profiles.     •  Co-­‐expression  of  genes  may  imply  co-­‐regulaBon.     •  ClassificaBon  of  biological  condiBons.     •  Drug  development     Gene  expression  analysis  
  • 23. Clustering Statistical Methods: Hierarchical clustering, K-means, CLICK (CLuster Identification via Connectivity Kernels), Biclustering, etc. More: http://www.bioconductor.org/help/course- materials/2002/Seattle02/Cluster/ cluster.pdf Gene  expression  analysis  
  • 24. Classification •  Classification of tumor malignancies into known classes : supervised learning; •  Identification of marker genes that characterize the different tumor classes: feature selection. Genes distinguishing ALL from AML (two types of leukemia). Gene  expression  analysis  
  • 25. Classification •  Methods:   –  Discriminant  analysis  :  LDA,  K  nearest  neighbor.   –  ClassificaBon  Tree   –  LogisBc  regression,  penalized  LR:  LASSO.   –  Neural  network   –  Support  vector  machines  (SVM)   –  Random  forest,  etc…..   A  survey  of  these  methods:   hp://www.ibiostat.be/publicaBons/phd/suzyvansanden.pdf   hp://www.stat.cmu.edu/~jiashun/Research/sohware/Data/papers/ dudoit.pdf   Gene  expression  analysis    
  • 26. Pathways Analysis •  We  discover  DE  genes,   what's  next?   •  IdenBfy  which  pathways   (e,g,.  GO  KEGG)  terms  are   most  commonly  associated   with  the    DE  genes.   •  Methods:  GEA,  GSEA,  NEA,   etc.   Gene  expression  analysis  
  • 27. What’s next •  Next-­‐generaBon  sequencing   +  No  need  to  know  the  sequence  of  the  transcript.   +  There  are  no  arBfacts  due  to  cross-­‐hybridizaBon   +  Beer  quanBtaBon  of  low  abundance  transcripts.   -­‐  New  data  types  and  huge  data  volumes.   -­‐  Quality   •  EpigeneBcs   –  The  study  of  heritable  changes  in  genome  funcBon   that  occur  without  a  change  in  DNA  sequence  ( hp://epigenome.eu/en/1,1,0  ).     –  DNA  methylaBon   Gene  expression  analysis  
  • 28. Reference •  Gohlmann,,  H.  and  Talloen,  W,  Gene  Expression  Studies  Using  Affymetrix   Microarrays,  Chapman  &  Hall/CRC  MathemaBcal  &  ComputaBonal   Biology,  2009.   •  hp://www.cs.tau.ac.il/~rshamir/ge/09/     Other  useful  books:   •  Gentleman  R,  Carey  V,  Huber  W,  Irizarry  R,  Dudoit  S,  editors:   BioinformaBcs  and  computaBonal  biology  soluBons  using  R  and   Bioconductor  .  Springer  Science,  New  York,  2005.   •  Amaratunga  D,  Cabrera  J:  ExploraBon  and  Analysis  of  DNA  Microarray  and   Protein  Array  Data.  Wiley-­‐Interscience,  2004.   Gene  expression  analysis