![BrachyBio! Linking Teachers, Students and Scientists in Plant Research ,[object Object],[object Object],[object Object],[object Object]](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)
Empfohlen
Empfohlen
Weitere ähnliche Inhalte
Was ist angesagt?
Was ist angesagt? (20)
Ähnlich wie Brachybio!
Ähnlich wie Brachybio! (20)
Kürzlich hochgeladen
Kürzlich hochgeladen (20)
Brachybio!
- 1. Tiffany Fleming, Boyce Thompson Institute Charles Bender, Guilderland High School Kim LaCelle, Wheatland-Chili Central School Tom Brutnell, Associate Scientist, BTI Amanda Romag, Research Technician Hugues Barbier, Postdoctoral Associate Ying Rong, Research Technician BRACHYBIO! LINKING TEACHERS, STUDENTS AND SCIENTISTS IN PLANT RESEARCH
- 3. BrachyBio! Goals Bring real scientific topics to the classroom Students can understand the importance of plant science by relating to the roles that plants play in their daily lives as sources of food and energy. Maize Wheat Rice Barley
- 5. BrachyBio! Goals Scientific inquiry can help solve important social & environmental problems Current Plant Science Research Challenge Meet the population’s demand for food
- 6. Meeting Agricultural Research Goals Maize Wheat Rice Barley Large plants Long growing seasons with specific growth requirements Regulated food crops
- 8. C 4 C 3 Common descent Maize 2.5 billion bp Rice 420 million bp Wheat 17 billion bp Brachy 270 million bp Setaria 510 million bp Phylogeny of the grasses
- 9. Phylogeny of the grasses Slide courtesy of Toby Kellogg
- 10. DNA: The Molecule of Life DNA Sequence Observable Phenotype Genes Color, Architecture, Disease Resistance, Etc
- 11. DNA: The Molecule of Life DNA Sequence Observable Phenotype Genes Color, Architecture, Disease Resistance, Etc CCCTTGATATGCTGCACGACGT Plant trait?
- 12. GATCGTCGACCGGTGC CTAGCAGCTGGCCACG GATCGTCGACC A GTGC CTAGCAGCTGG T CACG Mutagenesis Ethyl Methanesulfonate (EMS) CH3SO3C2H5 Produces random mutations in genetic material by nucleotide substitution
- 13. BTI Scientists Treat Seeds with EMS and build mutant seed populations Generation 1 Brachy Seeds Generations 1 Plant Gerations 3 seed population Grow M1 & Harvest Overnight EMS Treatment + GA Plant M2 Harvest seeds Generations 2 plants BrachyBio! Seed Stock
- 14. Students Find and Catalogue Mutants Family #000931 Phenotype Category Phenotype Subcategory Mutant Descriptions First Screen Family # #mutants #germinated Color White Albino 00931 3/12 Architecture Size Small 00931 3/12
- 18. Students Upload pictures in the Mutant Library 000874 Virescent Class/School name Scientists Can Access Library and Order Seeds Search: Virescent Results: 000874 Students join the Research Community
- 23. Acknowledgements Tom Brutnell, Scientist Amanda Romag, Research Technician Hugues Barbier, Postdoctoral Associate Ying Rong, Research Technician Tiffany Fleming, Boyce Thompson Institute Charles Bender, Guilderland High School Kim LaCelle, Wheatland-Chili Central School
Hinweis der Redaktion
- I’ll provide project overview, Mandy will provide more detailed information the content that we present to Teacher and student. Also illustrate how classroom research links to the BTI science The BrachyBio! project is a collaboration between the Boyce Thompson Institute for Plant Research, Cornell University and High School and Middle School students from across New York State and beyond. The purpose of this large-scale experiment to understand gene function in plants, particularly crop plants. Students will learn to grow, observe and identify mutant Brachypodium plants. Scientists will then use DNA sequencing technologies to determine the genes altered by mutations.
- . The purpose of this large-scale experiment to understand gene function in plants, particularly crop plants.
- Grasses provide the bulk of human nutrition, and highly productive grasses are a promising sources of sustainable energy. They might be learning for the first time that these plants are part of their daily lives. These plants are also the subjects of lots of research. Plant science research really does revolve around human needs. These cereal crops are highly demanded.
- Show the relationship between science community and student community. Keep a focus on linking the three audiences. Create a mutually-beneficial partnership where all groups are able to learn with and from one another to advance scientific understanding of plants
- Demonstrate to students and teachers that scientific inquiry is relevant and can be used to solve important social and environmental problems Incorporate real world scientific issues into ordinary lesson plans. Connect students to current events in agriculture. Help students understand the real applications of basic scientific research. Current issues in Food Security Pathogens Climate change Increasing population ***Wheat stem rust riot in the middle east ***scientific emergency ***global impacts ***food prices rising look for graph
- Explain in detail the challenges that scientists face when researching large complex plants. Introduce the idea of simplifying the research to lead into the model system of Brachy
- The ‘What’ Introduce Brachypodium Commonly called purple false brome, is a grass species native to southern Europe, northern Africa and southwestern Asia east to India. Explain the meaning of a few terms: ‘Genome’ ‘base pairs’
- The ‘Why’ Why is Brachy an important plant for research ( relationship to other crops) It is related to the major cereal grain species wheat, barley, oats, maize, rice, rye, sorghum, and millet. C4 bundle sheath cell, more efficient, hot climate. CO2 is first incorporated into a 4-carbon compound. Stomata are open during the day. Uses PEP Carboxylase for the enzyme involved in the uptake of CO2. This enzyme allows CO2 to be taken into the plant very quickly, and then it "delivers" the CO2 directly to RUBISCO for photsynthesis. Photosynthesis takes place in inner cells (requires special anatomy called Kranz Anatomy) Faster then C3 Photosynthesizes faster than C3 plants under high light intensity and high temperatures because the CO2 is delivered directly to RUBISCO, not allowing it to grab oxygen and undergo photorespiration. Has better Water Use Efficiency because PEP Carboxylase brings in CO2 faster and so does not need to keep stomata open as much (less water lost by transpiration) for the same amount of CO2 gain for photosynthesis. Ribulose-1,5-bisphosphate ( RuBP ) C3
- Contrast science image to student image
- Introduce the basis of Genetics research. Desired Plant Traits Drought tolerance Disease resistance High yield Etc Explain that a change in one = a change in the other Explain that targeted changes require knowledge of what the gense are. Ex. Baking goods. Make it sweeter using sugar… what if you didn’t know which ingredient makes it sweeter?
- Introduce the basis of Genetics research. Desired Plant Traits Drought tolerance Disease resistance High yield Etc Explain that a change in one = a change in the other Explain that targeted changes require knowledge of what the gense are. Ex. Baking goods. Make it sweeter using sugar… what if you didn’t know which ingredient makes it sweeter?
- Introduce mutagenesis The ‘How’ >2500 plant varieties created by mutation breeding Crop genome data together with mutation breeding creates great potential for scientific discovery Use of induced mutations to create variability Explain that these mutations lead to phenotypic changes. Mutations are heritable, or passed on from generation to generation. Scie Witness an accelerated example of evolution in plants containing inherited point mutations Observe the relationship between genotype and phenotype Understand the importance of genetic manipulation to scientific discovery
- Restate the heritability of mutations. Introduce the ‘family’
- Student activity. Explain student observations and data collections.
- Extension Activities: Possible classroom experiments may include: Extract DNA Amplify DNA via Polymerase Chain Reaction Compost plants using vermicompost or other method Extract other compounds from plants Plant Anatomy Dissect leaves Microscopy Xylem, phloem, midvein, stomates Plant cell and cell components
- Mutations may also be valuable for use in agribusiness Classrooms contribute to developing an important tool for future gene discovery. A library of mutants of this model plant will assist scientists in understanding the function of important genes throughout the genome. This findings will facilitate research on the important cereal crops.
- The BrachyBio! website ( www.bti.cornell.edu/brachybio ) and curriculum materials have been developed by teachers, scientists and science educators for use in the middle and high school science classroom. The curriculum may be taught as a stand-along unit, or integrated into existing units including genetics and heredity, photosynthesis, or growth and development, all using scientific inquiry.
- BrachyBio! provides an inquiry-based and interdisciplinary learning opportunity for students. Students not only learn to conduct research and communicate their results, but they discover first hand how genes and environment interact to shape the physical characteristics (and molecular processes) of living things.
- The research that students conduct in their classrooms generates data that scientists are using to identify genes that regulate key biological processes in plants including photosynthesis , flowering time, seed set, cell wall biosynthesis and environmental stress response . Some of these mutations will be of interest to plant breeders and geneticists who plan to identify those genes and their functions as well as locate where genes sequences reside in the genome, through a process called mapping. Characterizing the genome of this model plant is an international effort and will assist scientists in understanding the function of important genes throughout the genome.