This document summarizes molecular pathology of pre-mRNA splicing and discusses how mutations can affect splicing, leading to disease. It describes various methods used to identify pathological splicing mutations experimentally, including RT-PCR to detect mutations. It also discusses how RNA secondary structure and bioinformatics tools can influence splicing and be used to predict structure. Finally, it outlines emerging therapies targeting pre-mRNA splicing, such as antisense oligonucleotides, to treat diseases.

1. Molecular Pathology of pre-mRNA splicing Part 1 International Centre for Genetic Engineering and Biotechnology. Trieste (Italy)

2. 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ AAAAAAAAAA aug uag Transcription 5’UTR ORF 3’UTR AAAAAAAAAA pre-mRNA splicing: Poly-A 5’cap PolII PolII PolII PolII Splicing Export and Translation DNA pre-mRNA mRNA protein aug uag

3. Local RNA secondary structure can change the way these sequences are displayed Basic recognition levels are determined by trans-acting factor(s) binding to consensus splicing regulatory sequences Internal exonic or nearby intronic regions (Splicing Regulatory Elements, SREs) can regulate these basic factors by attracting both negative and positive trans-acting factors -External stimuli/cellular stress -Spliceosomal rearrangements due to processing of upstream introns/exons -RNA Pol II Kinetics and Processivity -Variability of alternative splicing events in upstream exons 3’ss 5’ss BP SREs Fig.1 Combinatorial effect of splicing regulatory factors in exon inclusion/skipping decisions Inclusion Skipping

4. Disease-causing mutations can occur in all these types splicing controlling elements:

5. Splicing mutations can be found in virtually any intron-containing gene. The frequency depends on overall length and individual susceptibilities Baralle D. et al. EMBO Rep 2009; 10:810-816.

6. What happens when one of the basic elements is altered? ATM CFTR Herg NF-1 CFTR GBA

7. Summary of “wet” splicing methodologies to identify pathological splicing mutations: Baralle D. et al. EMBO Rep 2009; 10:810-816.

8. Direct mRNA amplification from patients

9. Marfan syndrome (MFS; MIM154700) is a relatively common autosomal dominant hereditary disorder of connective tissue with prominent manifestations in the skeletal, ocular, and cardiovascular systems. 13% of reported mutations consist of various classes of splicing errors, most commonly affecting canonical splice sequences at exon/intron boundaries

10. Development of RT-PCRs for detecting RNA splicing in the FBN1 gene Covering 24 UVs in 19 exons In collaboration with EURASNET (and in this case with Dr. Diana Baralle: 1kb plus e12F/e14R, 239bp, exon13- 1510T>C & exon14- 1633C>T e15F/e17R, 196bp, exon16- 1883G>A , - 1909T>C , - 1916G>A e19F/e21R, 173bp, exon19- 2293G>A & exon20- 2328T>A e20F/e24R, 465bp, exon22- 2645C>T e24F/e25R, 180bp, exon-25- 2927G>A e26F/e30R, 504bp, exon27- 3332G>A , exon28- 3422C>T , exon29- 3533A>G e32F/x35R, 532bp, exon33- 4069G>A , exon34- 4096G>A e44F/e48R, 474bp, exon46- 5627G>A & - 5789A>G e51F/e53R, 224bp, exon51- 6251G>C e54F/e57R, 357bp, exon55- 6694T>C , exon56- 6815A>G e60F/e63R, 363bp, exon60- 7379A>G , exon62- 7606G>A , - 7633C>T , - 7664G>T e63F/e65R, 402bp, exon64- 7916A>G Blank 1kb plus

11. Detection a RNA splicing mutation in FBN1 exons 60 & 62, by RT-PCR RT-PCR was performed on patients’ peripheral blood samples. The PCR primers are located in exon60 and exon63 to give a 363bp product. It covers 4 UVs in 2 exons: c.7606G>A in exon 60, and 3 UVs at c.7664G>T, c.7633C>T and c.7379A>G in exon 62. An extra PCR band was detected in lane 2 for patient with c.7606G>A. Lane 1: marker; Lane 2: c.7606G>A; e60 Lane 3: c.7664G>T; e62 Lane 4: c.7633C>T; e62 Lane 5: c.7379A>G; e62 Lane 6: normal buffy coat; Lane 7: PCR blank 1 2 3 4 5 6 7

12. Minigenes and exon skipping in Neurofibromatosis

13. Hybrid minigenes transfection in different cell types 0.5 μ g DNA 300.000 cells 24 hours RT-PCR analysis of splicing products using specific oligonucleotides Our “in house” minigene system:  -globin gene promoter and SV40 enhancer sequences polyA site derived from the  -globin gene fibronectin exons  -globin exons

15. In NF-1 exon 37 a practical example of overlap between a coding and splicing mutation is represented by the C6792G mutation that for a long time was thought to be a translational mutation. Baralle et al. FEBS Lett. 2006 580: 4449-4456.

16. Using as a reference the results obtained from a patient’s lymphoblasts carrying the C6792G mutation we have investigated the importance of genomic context on reproducing the effects of splicing of this mutation: Baralle et al. FEBS Lett. 2006 580: 4449-4456.

17. Buratti et al. NAR 2006 34: 3494-3510. Baralle et al. FEBS Lett. 2006 580: 4449-4456. The importance of genomic context:

18. Long QT Syndrome and intron retention

20. One of the most important events in 5’ splice site definition is represented by base pairing of the U1snRNA component of U1snRNP with the 5’ splice site consensus sequence. A “T” in the +5 position is rather loosely conserved: C A G G U R A G U Zhang et al., 1998 Is a +6T>C change capable of affecting splicing?

21. NdeI NdeI Exon 7 Wt CTCATTGGCT/gtgagtgtc Exon 7 +6T>C CTCATTGGCT/gtgag c gtc Exon 7 HERG ex 7 Wt HERG ex 7 +6T>C HERG ex 7 +6T>C + U1 C>G Zhang et al., 2004. J Am Coll Cardiol; 44(6):1283-91 HERG The +6T>C is a mutation perturbs U1 snRNP interaction with the 5’ss and in a minigene system causes intron retention. 200 400 500 650 1650 850 1000

22. RNA secondary structure, pre-mRNA splicing, and disease

23. m 7 GpppG “ cap” AAAAA m 7 GpppG “ polyA” AAAAA “ polyA” In theory, mRNA molecules should be anything but linear: However, with the exception of the 3’UTR and 5’UTR regions of mRNAs which are sometimes known to fold in characteristic secondary structures the evidence gathered from many splicing systems suggests that secondary structure seldom needs to be invoked as a regulator of splicing. “ cap”

24. The notion that mRNA molecules may behave largely as linear molecules is based on the observation that a nascent trascript is often coated by many different proteins (mainly belonging to the hnRNP proteins family) which keep it in a linear conformation

25. Gevertz et al. RNA 2005; 11: 853-863 Percent of sequences in each pool that fold to linear structures (represented by solid line), structures with one branch (dashed line), and structures with two or more branches (dash-dotted line) Four antibiotic-binding aptamer structures and their tree graphs How easily does mRNA fold?.

26. The question still remains whether pre-mRNA molecules may retain some small structured “islands” and whether this structure can influence the splicing process. Buratti and Baralle MCB 2004; 24: 10505-10514

27. Over the years experimental evidence has suggested that RNA folding can affect the presentation/distance of 5’ss, 3’ss, branch-point elements Buratti and Baralle MCB 2004; 24: 10505-10514

28. ……… enhancer and silencer elements……….. Buratti and Baralle MCB 2004; 24: 10505-10514

29. …… ..by changing the overall architecture of the pre-mRNA………… Buratti and Baralle MCB 2004; 24: 10505-10514

30. Varani, L et al. (1999) Proc. Natl. Acad. Sci. USA 96, 8229-8234 In the tau gene RNA secondary structure has been proposed to be responsible for the occurrence of fronto-temporal dementia and Parkinsonism. Buratti and Baralle MCB 2004; 24: 10505-10514

31. Bioinformatics approaches

32. The bioinformatics connection:

33. Example of a program: Schwartz et al., NAR, 2009, 37:W189- 1 92

34. How good are bioinformatics programs?

35. How can RNA secondary structure be predicted?. Two main approaches are commonly used by researchers (both freely available on the web): Energy minimization: Probabilistic model + sequence comparison:

36. Random sequences can be generated at Bioinformatics.org/sms/rand_dna.html 2. Average number of predicted secondary structures for random RNA sequence groups of differing length grows rapidly with length. No. of structures within 5% suboptimality. Sequence length (nucleotides) Advantages and disadvantages of energy minimization approaches: 1. Fast, only requires the knowledge of the sequence of interest, is based on highly optimized energy minimization parameters and folding algorithms. 3. Prediction is highly dependent on the nucleotide “window” used for the analysis (changing the window by even a few nucleotides can profoundly change the output structure/energy). catggcatcaaatcttttccccgtaccgactatagg ggcta catgg catcaaatcttttccccgtaccgactataggggcta

37. 2. Requires the pre-requisite knowledge of many sequence that are already known to fold in a functionally-important structure. Any mistake in this choice can be fatal for the accuracy of the prediction. Advantages and disadvantages of sequence-comparison approaches: 1. Allows to take into account evolutionary pressure to maintain a selected RNA structure (ie. evolution is doing the work instead of you), and as a result can provide the researcher with a single potential structure: 3. It is highly dependent on the correct “alignment” process between these sequences Knudsen, B. et al. Nucl. Acids Res. 2003 31:3423-3428; doi:10.1093/nar/gkg614

39. Splicing therapy

40. A thalassemic allele of human -globin leads to production of a primary transcript that contains a cryptic exon, which is included in the majority of the -globin mRNAs. Antisense oligonucleotides (red arrows) can block the splice sites flanking the cryptic exon leading to a reduction in the inclusion of the cryptic exon. Similarly, antisense oligonucleotides can be used to reduce the ratio of exon 10 + to exon 10 - MAPT transcripts. The inset shows the mechanism of action of a 5' splice site blocking antisense oligonucleotide that prevents U1 snRNP binding. Garcia-Blanco et al. Nat.Biotechnol. (2004) 22:535-546.

41. Isoform-specific RNAi is presented in this panel. Exon-specific siRNAs (or micro RNAs) can be deployed to selectively destroy the mRNA encoding the anti-apoptotic Bcl-xL while not affecting the levels of the mRNA encoding the pro-apoptotic Bcl-xS. Garcia-Blanco et al. Nat.Biotechnol. (2004) 22:535-546.

42. This schematic shows the paralogs SMN2 and a mutant allele of the more telomeric smn1. The regions spanning exons 6 through 8 of the primary transcripts are shown. The C to U difference in exon 7 of the two transcripts is indicated. This difference leads to skipping of exon 7 in a significant proportion of SMN2 transcripts. The schematic summarizes the use of IFNs, valproic acid and sodium butyrate to enhance transcription of SMN2. Enhancement of exon 7 inclusion by treatment with valproic acid, sodium butyrate and acalrubicin, perhaps mediated by increases in levels of SR proteins, is also indicated. Green arrows indicate demonstrated effects and dashed green arrows (or dashed red inhibitory lines) indicate weak or presumed effects. Garcia-Blanco et al. Nat.Biotechnol. (2004) 22:535-546.

43. This schematic show variation of antisense oligonucleotides with the TOES and TOSS bifunctional reagent. One half of the therapeutic reagent targets it to the correct location within the primary transcript and the second component of the reagent provides either activating or silencing function. The inset provides schematics for the presumed mechanism of action. Garcia-Blanco et al. Nat.Biotechnol. (2004) 22:535-546.

44. Varani, L. et al. NAR 2000 28:710-719 Surface representation with electrostatic potential map of the human tau exon 10 splicing regulatory element (left) and of its complex with neomycin B (right). Binding causes a marked increase in the stability of the regulatory wild type and mutant elements. This kind or results represent a starting point for the development of small compounds aimed at developing new splicing-based therapies.

45. Conclusions: -Mutations affecting the pre-mRNA splicing process are a major cause of disease. -Pathological splicing mutations that affect the exonic splicing code are difficult to predict owing to the great complexity of the pre-mRNA splicing process in higher eukaryotes. -Presently, experimental analyses is still required to unambigously identify splicing-affecting mutations from harmless nucleotide variants. -Splicing mutations associated with disease are not limited to exonic sequences. -Better knowledge of splicing will offer new therapeutic opportunities to treat a great variety of diseases.