Empfohlen
Weitere ähnliche Inhalte
Was ist angesagt?
Was ist angesagt? (20)
Ähnlich wie PHD_Thesis_presentation
Ähnlich wie PHD_Thesis_presentation (20)
PHD_Thesis_presentation
- 1. Interkingdom Signalling Via a LuxR- Family Protein in Plant-Associated Bacteria Juan F. González
- 2. 2 Trieste
- 3. ICGEB The International Centre for Genetic Engineering and Biotechnology provides a scientific and educational environment of the highest standard and conducts innovative research in life sciences for the benefit of developing countries. It strengthens the research capability of its Members through training and funding programmes and advisory services and represents a comprehensive approach to promoting biotechnology internationally. Components: Trieste, Italy: 15 labs, 400 people New Delhi, India Cape Town, South Africa • • • 60 Member States
- 4. Cell-Cell Communication in Bacteria Solitary / Planktonic Vulnerable Community Biofilm Antibiotics Virulence Swarming Symbiotic relationships Communication = chemical signalling Introduction 4
- 5. Time Growth Low cell density Quorum sensing Introduction 5 High cell density Target genes
- 7. luxI homologues gene homologues geneluxR LuxR homolog Modified from: AHL-LuxR homolog complex threshold concentration Proteolytic degradation(1) Formation of AHL-LuxR homolog complex (2) Dimerization of + lux box LuxR homolog-dependent promoters target genes Introduction Quorum sensing 7
- 8. Non AHL-ProducersAHL-Producers LuxR solos LuxR-type proteins that are not paired with a cognate LuxI-type synthase luxRS pipx b ca luxRS b ca luxR luxI b ca LuxI SdiA S. enterica, E. coli PsoR P. fluorescens OryR X. oryzae • • • QscR P. aeruginosa ExpR S. meliloti BisR R. leguminosarum pv. viciae • • • Introduction 8
- 9. xccR pipx b ca Inter-kingdom signalling: Interactions between bacteria and their eukaryotic hosts Introduction RSM 9
- 10. Inter-kingdom signaling: Interactions between bacteria and their eukaryotic hosts Introduction Best studied cases of inter-kingdom signalling in plant-associated bacteria: Rhizobia-legume plants signalling to initiate nodulation Agrobacterium pathogenesis and plant tumor development Emerging field of research • • 10
- 11. LuxR solos Subfamily of LuxR solos from plant- associated bacteria (PAB) Introduction LuxR superfamily11 PAB LuxR solos
- 12. AHL-binding HTH LuxR (V. fisheri) W57 Y61 D70 P71 W85 G113 E178 L182 G188 PsoR (P. flurorescens) W W D P W G E L G OryR (X. oryzae) M W D P W G E L G XccR (X. campestris) M W D P W G E L G NesR (S. meliloti) M W D P W G E L G Introduction LuxR solos 12
- 13. New subfamily of LuxR solos from plant-associated bacteria LuxR solos Introduction 13
- 14. LuxR solos Introduction TCCGAGCCATTCAAACCTGTGAGATTTGCCAGTTAACGCCAGTCGGCCCGCTCGCTAGGCTCGGGGCACATCATTGCCGCAGGCAGGCGCAGGTCATG Luxbox 14 New subfamily of LuxR solos from plant-associated bacteria
- 15. Introduction XccR of Xanthomonas campestris Pip promoter activated by XccR in planta Xcc contains a LuxR solo named XccR Xcc does not produce AHLs xccR is genetically linked to the pip gene XccR and PIP are important for virulence • • • • 15 XccR binds pip promoter Gel mobility shift Supershift
- 16. LuxR solos in plant-associated bacteria OryR PsoR Introduction 16
- 17. Introduction Organisms under study Xanthomonas oryzae pv. oryzae (Xoo) Vascular pathogen of the rice plant (Oryzae sativa) causal agent of bacterial blight of rice. Economically important pathogen mostly in Asia, but found world-wide Enters plants by way of hydathodes and wounds on the roots or leaves Model organism for studying plant- pathogenesis Pseudomonas fluorescens Found ubiquitously in soil, beneficial for plants Produce strong siderophore, ie: fluorescent pyoverdin Produces biocontrol agents like: 2,4-DAPG, pyrrolnitrin, hydrogen cyanide, and phenazine, and some secretion enzymes such as protease, phospholipase C, and chitinase Plant-growth promoting bacteria (PGPR) 17
- 18. OryR and PsoR Biosensors: X.oryzae does not produce AHLs Affinity chromatography: OryR is solubilized in the presence macerated rice, not of AHLs Promoter fusion: OryR activate target promoters in the presence of rice macerate, not AHLs • • • Ferluga et al, 2009. J Bact OryR Introduction 18Ferluga et al, 2007. Mol Plant Path Cucumber Rice Wheat PsoR P. fluorescens do not produce AHLs PsoR is solubilized in the presence of rice and wheat macerate but not cucumber or AHLs PsoR activates target XooPip promoter with rice and wheat but not cucumber. PsoR is important for biocontrol in wheat but not cucumber • • • • Subramoni et al; 2011 Appl Env Microbiol
- 19. LuxR ‘solos’ Organism Role of LuxR solo Binding molecule/ s Functions Regulated Reference XccR Xanthomonas campestris pv. campestris Virulence Plant Signal molecule Cabbage (+) Proline imino peptidase (pip) gene expression; Virulence on Cabbage Zhang et al., 2007 OryR Xanthomonas oryzae pv. oryzae Virulence Rice Signal molecule Rice (+) Proline imino peptidase (pip) gene expression; Virulence on rice, flagellation Ferluga et al., 2007;Ferluga et al., 2009;González et al., 2012 NesR Sinorhizobium meliloti Symbiosis Not determined Nutritional and environmental stress response, plant nodulation Patankar et al., 2009 PsoR Pseudomonas fluorescens Pf-5/ CHA0 Biocontrol Plant signal molecule Rice (+) Wheat (+) Cucumber (-) Anti-microbial agents 2,4-DAPG, chitinase Subramoni et al., 2011 XagR Xanthomonas axonopodis Virulence Plant signal molecule Soybean (+) Rice (+) Cabbage (+) Proline imino peptidase (pip) gene expression; Virulence on soybean; Adhesion Chatnaparat et al., 2012 Introduction 19
- 20. oryR pipx b ca Xanthomonas oryzae Pathogen OryR Plant signal molecule(s) Aim 1.1: Identify targets of OryR regulation 20
- 21. Microarray wt mut Xoo XKK12 Wild type Xoo XKK12 OryR mutant 2 biological replicates of both the wild type and an oryR mutant in rich media with rice macerate Results Established highest pip promoter activity at an OD600 of 2.0 21
- 22. Top negatively-regulated Microarray Results 330 genes regulated over 2 fold 22 Gene locus Fold Change Function XOO1701 34.75 hypothetical protein XOO1051 31.95 hypothetical protein XOO3951 24.33 methyltransferase homolog M.XphI XOO0608 23.24 endonuclease XOO1455 20.15 hypothetical protein XOO3472 13.30 hypothetical protein XOO0224 11.21 hypothetical protein XOO1452 9.93 hypothetical protein XOO3489 9.27 hypothetical protein XOO4759 8.22 hypothetical protein XOO1454 7.94 hypothetical protein XOO4758 7.85 hypothetical protein XOO0697 7.10 hypothetical protein XOO1774 6.54 hypothetical protein XOO1273 6.23 quinol oxidase, subunit I XOO0696 5.77 hypothetical protein XOO0599 5.72 phage integrase family site specific recombinase XOO3467 5.44 hypothetical protein XOO1580 5.02 RhsD protein XOO4885 5.02 hypothetical protein XOO0606 4.67 XorII very-short-patch-repair endonuclease XOO4439 4.58 hypothetical protein XOO0050 4.32 hypothetical protein 110 negatively-regulated genes over 2 fold
- 23. Gene locus Fold Change Putative function XOO3196 32.56 PilY1 XOO0329 25.83 polyvinylalcohol dehydrogenase XOO0031 10.18 hypothetical protein XOO1391 9.56 hypothetical protein XOO0134 8.06 IS1479 transposase XOO3050 7.96 hypothetical protein XOO3195 7.14 type IV pilin XOO3062 6.95 hypothetical protein XOO3061 6.72 hypothetical protein XOO2834 6.44 hypothetical protein XOO1099 6.11 TonB-dependent receptor XOO0020 6.10 IS1479 transposase XOO1390 6.00 RtxA XOO2384 5.99 IS1595 transposase XOO0095 5.89 Hpa1 XOO3052 5.78 hypothetical protein XOO1098 5.77 amylosucrase or alpha amylase XOO3063 5.71 IS1404 transposase XOO2580 5.70 flagellar hook-associated protein FlgL XOO3051 5.29 hypothetical protein Top positively-regulated 220 positively-regulated genes over 2 fold• Microarray Results P value: 2.5 x 10-7 23
- 24. GENE Fold Change FUNCTION XOO2580 5.7 flagellar hook-associated protein FlgL XOO2583 4.93 flagellar protein XOO2622 4.57 chemotaxis protein XOO2611 4.27 flagellar biosynthesis protein FliP XOO2572 4.12 flagellar hook protein FlgE XOO2623 3.8 chemotaxis related protein XOO2558 3.78 chemotaxis protein XOO2857 3.71 chemotaxis protein methyltransferase XOO2579 3.48 flagellar hook-associated protein FlgK XOO2566 3.38 flagellar protein XOO2601 3.24 flagellar MS-ring protein XOO2833 3.19 chemotaxis protein XOO2574 3.15 flagellar basal body rod protein FlgF XOO2620 3.14 flagellar biosynthesis switch protein XOO2571 2.94 flagellar basal body rod modification protein XOO2570 2.87 flagellar basal body rod protein FlgC XOO2569 2.84 flagellar basal body rod protein FlgB XOO2577 2.83 flagellar basal body P-ring protein XOO2610 2.79 flagellar protein XOO2624 2.72 chemotaxis related protein XOO2604 2.72 flagellar protein XOO2619 2.67 flagellar biosynthesis regulator FlhF XOO2605 2.59 flagellar FliJ protein XOO2830 2.59 flagellar motor protein XOO2848 2.49 chemotaxis protein XOO2582 2.43 flagellar protein XOO2831 2.29 flagellar motor protein MotD XOO2607 2.27 flagellar protein XOO2606 2.26 flagellar protein XOO2608 2.24 flagellar motor switch protein FliM XOO2578 2.19 flagellar rod assembly protein/muramidase FlgJ XOO1468 2.16 chemotaxis protein XOO2575 2.16 flagellar basal body rod protein FlgG XOO2836 2.15 chemotaxis protein oryR 18% of positively regulated genes are associated with movement Flagellum (30 genes) Chemotaxis (9 genes) • • Microarray Results P value: 2.5 x 10-7 P value: 0.055 24
- 25. Class I Class II Class III fleQ rpon2 flgM fliEFGHIJK fliLMNOP fliQR flhBAF fliC fliD flgM Chemotactic Positively regulate genes Non regulated genes Non-flagellar genes Results Xoo flagellar genes 25
- 26. Gene ID Gene name MA fold difference SQ RT-PCR fold difference* P-value** Xoo3196 PilY1 32.56 13.60 ± 3.73 < 0.0001 Xoo0329 Polyvinylalcohol dehydrogenase 25.83 40.70 ± 8.60 0.0093 Xoo0031 Hypothetical protein 10.18 2.26 ± 0.03 0.0063 Xoo2580 Flagellar hook-associated protein flgL 5.70 2.46 ± 0.01 < 0.0001 Xoo2622 CheY 4.57 6.15 ± 1.99 0.0040 Xoo2581 FliC 4.02 3.96 ± 1.03 < 0.0001 Xoo2619 FlhF 2.67 3.67 ± 0.06 < 0.0001 Xoo0094 Hypothetical protein 2.36 3.15 ± 0.26 0.0002 Xoo0088 HrpB3 2.20 2.87 ± 0.39 0.0166 Xoo0752 Putative transposase 2.14 1.82 ± 0.18 0.0010 Xoo2696 Hypothetical protein 2.09 1.68 ± 0.49 0.0035 Xoo3164 Putative transposase 1.79 2.54 ± 0.13 < 0.0001 Xoo2761 Internal membrane transposase 1.55 2.04 ± 0.16 < 0.0001 Xoo1701 Hypothetical protein -34.75 -40.50 ± 2.54 0.0003 Xoo1580 RhsD protein -5.02 -6.84 ± 0.02 0.0004 Xoo0281 Cellulase -4.29 -1.78 ± 0.30 0.0203 Xoo3033 Hypothetical protein -3.09 3.80 ± 0.2 < 0.0001 Xoo0869 Hypothetical protein -3.26 -2.36 ± 0.14 < 0.0001 Xoo2423 Carbonic anhydrase -2.61 -3.85 ± 0.62 0.0002 Xoo2925 Hypothetical protein -2.11 2.43 ± 0.41 0.0005 Xoo2664 Gaa -2.05 -1.81 ± 0.05 < 0.0001 Xoo3227 NADH dehydrogenase subunit I -2.00 -1.85 ± 0.13 0.0515 *Mean from three independent RNA isolations ± standard deviation (SD); **two-tailed Student t-test Microarray validation Results SQ-RT PCR 23 genes evenly distributed among the positively and negatively regulated 26
- 27. Is OryR’s transcriptional regulation reflected on motility-related phenotypes? Swimming Swarming Flagellin content • • • 27
- 28. Phenotypes Swimming WT OryR- SM 3 biological replicates Results SM+ Rice 28
- 29. Swarming WT Mut SM 3 biological replicates Results Phenotypes SM+Rice 29
- 30. In planta proteomicsRank Accession Description Unique/Mr 1 gi|58583319 | outer membrane protein [Xanthomonas oryzae pv. oryzae KACC10331]. 3864.7 2 gi|16189898 4161898984| flagellin oryzaeKACC10331]. 2970.3 3 gi|58581227 | ferric enterobactin receptor [Xanthomonas oryzae pv. oryzae KACC10331]. 2185.8 4 gi|58583210 | elongation factor Tu [Xanthomonas oryzae pv. oryzae KACC10331]. 2088.2 5 gi|58581525 | hypothetical protein XOO1902 [Xanthomonas oryzae pv. oryzae KACC10331]. 1829.3 6 gi|58584079 | organic hydroperoxide resistance protein [Xanthomonas oryzae pv. oryzae KACC10331]. 1630.4 7 gi|58579754 | VirK [Xanthomonas oryzae pv. oryzae KACC10331]. 1621.6 8 gi|58583889 | hypothetical protein XOO4266 [Xanthomonas oryzae pv. oryzae KACC10331]. 1606.4 9 gi|58581407 | TonB-dependent receptor [Xanthomonas oryzae pv. oryzae KACC10331]. 1519.8 10 gi|12287931 5| 1,4-beta-cellobiosidase [Xanthomonas oryzae pv. oryzae KACC10331]. 1512.6 11 gi|58583822 | hypothetical protein XOO4199 [Xanthomonas oryzae pv. oryzae KACC10331]. 1369.9 12 gi|58581654 | molecular chaperone DnaK [Xanthomonas oryzae pv. oryzae KACC10331]. 1310.0 Xoo XKK12 wild type Rank Accession Description Unique/Mr 1 gi|58583319| outer membrane protein [Xanthomonas oryzae pv. oryzae KACC10331]. 3864.7 2 gi|58581525| hypothetical protein XOO1902 [Xanthomonas oryzae pv. oryzae KACC10331]. 3658.5 3 gi|58583210| elongation factor Tu [Xanthomonas oryzae pv. oryzae KACC10331]. 2552.2 4 gi|58580722| TonB-dependent receptor [Xanthomonas oryzae pv. oryzae KACC10331]. 2168.7 5 gi|58583775| 30S ribosomal protein S9 [Xanthomonas oryzae pv. oryzae KACC10331]. 2069.0 6 gi|58583889| hypothetical protein XOO4266 [Xanthomonas oryzae pv. oryzae KACC10331]. 2008.0 7 gi|58583822| hypothetical protein XOO4199 [Xanthomonas oryzae pv. oryzae KACC10331]. 1826.5 8 gi|58581227| ferric enterobactin receptor [Xanthomonas oryzae pv. oryzae KACC10331]. 1748.6 9 gi|58583102| hypothetical protein XOO3479 [Xanthomonas oryzae pv. oryzae KACC10331]. 1666.7 organic hydroperoxide 49 gi|58582344| 746.3 50 gi|161898984| flagellin [Xanthomonas oryzae pv. oryzae KACC10331]. 742.6 51 gi|58580420| phosphoglucomutase; phosphomannomutas e [Xanthomonas oryzae pv. oryzae KACC10331]. 731.3 53 gi|122879275| 30S ribosomal protein S12 [Xanthomonas oryzae pv. oryzae KACC10331]. 729.9 Xoo XKK12 OryR mutant In collaboration with Mike Myers from the Protein Networks Group ICGEB and Monica Höfte at Ghent University Maldi Tof-Tof Results 30
- 31. Is OryR’s involvement in flagellar motility direct or indirect? Motility OryR OryR Additional regulators Motility Plant signal molecule 31
- 32. FlhF flagellar regulator CTCCGGAGCGAACGCAGGACTTGGAACAACGACCGGGACAGGCACCTCATGACGCTGGCAACACACCCACATTCATCGCGCACCCGTCCGGCGTCCGGCGGGTCCCGTTCCTCGAGGCAATTCGCATG -72 RBSPutative luxbox Results Luxbox search 32
- 33. FlhF Flagellar regulator Important but not crucial for motility in Xoo (Shen et al. 2001.MPMI) Directs correct placement of flagella in P. aeruginosa (Dasgupta et al. 2003. Mol Microbiol) and is essential for swimming and swarming (Murray & Kazmierczak. 2006. J Bact) Mutations in flhF in P. putida change flagellation from polar to peritrichous flagellation, and over-expression results in a multiflagellated phenotype (Pandza et al. 2000. Mol Microbiol) • • •
- 34. flhF transcriptional fusion Results OryR activates flhF promoter 34
- 35. Aim 1.2: Identify targets of PsoR regulation psoR pipx 35
- 36. Biocontrol Results Sujatha Subramoni 2-4 DAPG operon Chitinase 291+ regulated 410 - regulated 36
- 37. Results Iron acquisition Is PsoR important for iron acquisition in Pseudomonas fluorescens? 37 Grow assay: wild type, PsoR mutant and PsoR over-expressing strains in the presence of the iron chelator 2,2’$dipyridil+in+order+to+evaluate the+role+of+PsoR+under+iron+stress Indirect evidence that PsoR plays a role in iron acquisition in P. fluorescens 100 uM FeCl3
- 38. Classical promoter library screening method Powerful: Heterologous E. coli system identifies direct targets of regulation Promoter trapping Results 38 pBBR PsoR E. coli (pBBRPsoR) pQF50 lacZ Blue colony White colony Possible target of PsoR regulation - Blue colony White colony Constitutive promoter Possible target of PsoR regulation Plate on X-gal Plate on X-gal E. coli pQF50 lacZ pBBR
- 39. After sequencing: found two additional targets of PsoR: PFL_0133 large adhesive protein (lapA) PFL_4057 Sensory box histidine kinase/response regulator XagR of X. axonopodis found to be important for adhesion (Chatnaparat et al., 2012 MPMI) Promoter trapping E. coli (pBBRPsoR) E. coli (pBBR)
- 40. OryR is involved in the regulation of motility-related genes in response to a plant molecule OryR mutants show reduced swimming and swarming in media supplemented with rice macerate Flagellin production in planta is reduced in the OryR mutant. OryR probably acts through the regulation of the flhF flagellar regulator through a luxbox-like element PsoR is important for iron transport/acquisition • • • • • Summary OryR and PsoR regulons 40
- 41. Xanthomonas oryzae Pathogen Model Motility Virulence oryR pipx psoR pipx Antimicrobial Iron-acquisition41 Pseudomonas fluorescens Beneficial Proximity sensors
- 42. How different are the new group of plant associated solo LuxRs to classical QS LuxRs? • Aim 2: Evaluate the degree of conservation and exchangeability between QS-LuxRs and PAB-LuxRs 42
- 43. Promoter switching QS Inter-kingdom luxI b caluxR Solo pip y zx 43
- 44. Promoter switching Solo Reporter luxI prom Rice molecule QS luxR Reporter Xoo pip prom AHLs R protein Organism Cognate AHL PssR Pseudomonas savastanoi OC6, OC8 PagR Pantoea agglomerans C4, C6 XenR Burkholderia xenovorans OC14,OC12 UnaR Burkholderia unamae OC14,OC12 BraR Burkholderia kururiensis OC14,OC12 XenR2 Burkholderia xenovorans OHC8, OHC6, OC8 I promoter Organism PmeI Pseudomonas mediterranea BgluI Burkorderia glumae Cvi Chromobacterium violaceum PpuI Pseudomonas putida LasI Pseudomonas aeruginosa E. coli heterologuos system Results 44
- 45. Promoter switching Both OryR and PsoR can activate the lasI promoter of P. aeruginosa None of the QS LuxR proteins tested activated the Xoo pip promoter Results 45
- 46. Point mutations AHL-binding HTH Consensus W57 Y61 D70 P71 W85 G113 E178 L182 G188 PsoR M Y D P W G E L G ∆PsoR W Y D P W G E L G OryR M W D P W G E L G ∆OryR W Y D P W G E L G ∆OryR X. oryzae oryR- ∆PsoR P. fluorescens psoR- Results 46 ∆Solo Reporter Xoo pip prom AHLs X. oryzae oryR- / P. fluorescens psoR-Recover ability to bind AHLs? Point mutations did not recover AHL binding capacities or affect rice-binding
- 47. HTH Rice molecule Helix-turn-helix domain Expression E. coli heterologuos system Results Reporter Xoo pip prom HTH domain of some QS LuxRs can activate transcription Strain Avg M.U. SD E. coli M15 (pMPXoopip) 33.3 3.4 E. coli M15 (pMPXoopip) (pQEOryRHTH) 37.8 6.1 E. coli M15 (pMPXoopip) 26.6 5.5 E. coli M15 (pMPXoopip) (pQEPsoRHTH) 28.0 2.8 HTH domain of PAB LuxRs cannot activate transcription of target Xoo pip gene 47
- 48. Summary plant associated luxR solos: QS LuxR proteins do not induce activation of Solo LuxR target pip promoter OryR and PsoR can activate QS-target lasI promoter of P. aeruginosa LuxR solos contain substitutions in 1 or 2 key amino acids in the autoinducer binding domain, reverting to consensus QS LuxR sequence does not recover AHL binding. The HTH domains of OryR and PsoR cannot activate target promoters on their own • • • • 48
- 49. Aim 3: Method Developed to analyze X. oryzae in planta expressed proteins Giuliano Degrassi Mike Myers 49 IF: 4.878
- 50. In planta proteomics Xoo cells can easily be retrieved from infected plants More accurately detects real set of proteins being expressed by Xoo in planta. • • Results 50
- 51. In planta proteomics 64 Sample1 Sample 2 Sample3 324 unique proteins total Sample 1: 180 Sample 2: 291 Sample 3: 190 64 proteins shared • • • Results 51
- 52. In planta proteomics Results Found most reported Xoo virulence factors Hydrolytic enzymes Cellulases 1,4,-beta cellobiosidase Cysteine protease Lipase/esterase Motility/chemotaxis Adhesion Iron acquisition • • • • Robust method for analyzing in planta expressed proteins of vascular pathogens 52 17 hypothetical proteins; 36/64 proteins with known (or putative) function in virulence or plant-bacteria interactions
- 53. In planta proteomics Results Generated mutants of 10 unreported/hypothetical proteins to determine their role in virulence Accession ORF Putative function gi122879019 XOO0439 peptidase gi122879107 XOO1487 cysteine protease gi122879038 XOO0680 protease gi58581605 XOO1982 protein U gi58581474 XOO1851 periplasmic protease MucD gi58579630 XOO0007 hypothetical protein gi58584205 XOO4582 outer membrane protein ompP1 gi58581372 XOO1749 twitching motility protein pilJ gi58583149 XOO3526 hypothetical protein gi58581428 XOO1805 hypothetical protein 53
- 54. In planta proteomics Results Virulence assay on mutants vs. wild type 54
- 55. In planta proteomics Results Protein U mutant significantly less virulent than wild type Virulence partially restored by in trans complementation Shows some similarity to a spore coat/pili formation protein from Myxococcus xanthus but its role in the G- Xoo is unknown; putative signal peptide 55
- 56. In planta proteomics Results Role of Protein U in planta 56 MW PY+ Rice PY M9+ Rice M9 Slight increase of PrU in supernatants of cultures of Xoo with rice macerate Protein U promoter activity significantly increases in media supplemented with rice Protein U Gus promoter fusion Protein U has a role in planta
- 57. Summary in planta proteomics This is an effective method for identifying Xoo proteins expressed in planta A total of 324 unique proteins were detected, of these 64 shared among all biological replicates Protein U is involved in rice virulence, these effects are plant-dependent • • • 57
- 58. Conclusions: OryR and PsoR belong to a sub-family of LuxR proteins found only in plant associated bacteria and represent a novel group of proteins involved in inter-kingdom signaling between plants and bacteria. Xanthomonas oryzae is a vascular pathogen, apparently OryR plays a role in informing the bacteria of its proximity to the plant and initiates fast movement to allow rapid colonization of the vascular system. PsoR of Pseudomonas fluorescens is a LuxR solo shown to be important for antimicrobial properties including iron-acquisition • • • 58
- 59. The subfamily of plant-associated bacteria LuxR solos share common characteristics with QS LuxRs but represent a separate cluster binding to a different molecule. Although they use a similar DNA promoter region, for the most part have diverged enough to not be interchangeable Proteomics analysis is a robust method for analyzing in planta expressed proteins of vascular pathogens Protein U is a novel virulence-associated factor in Xanthomonas oryzae • • • Conclusions: 59
- 60. Future perspectives: (i) Identify the structure of the plant signal molecule(s). Once identified it will allow answering questions such as the nature of the interaction with the solo. It will also reveal whether the molecule(s) or family of molecule(s) is widespread or specific to a certain group of plants. (ii) It would also be interesting to find additional targets of OryR and PsoR, possibly in different conditions, more representative of the interactions between the plant and the bacteria (ie: in vivo). In addition the role of the hypothetical proteins regulated by OryR and PsoR could reveal new loci involved in plant-bacterial interactions. (iii) A more complete picture of OryR and PsoR regulation could be obtained by further studies in respect to the nature of this regulation, whether it is direct or indirect with the use of protein/DNA approaches like gel-mobility shift experiments. 60
- 61. (iv) It would be interesting to follow the action of OryR and its targets (such as pip) in planta through the use of techniques like as fluorescence microscopy in order to elucidate the time/place of maximum PAB-solo activity. (v) Electron microscopy could be used to elucidate the function of protein U by observing possible changes in surface structure. (vi) Finally, broaden study to other bacterial species in order to establish how plant- associated bacteria from different phylogenetic groups use this novel inter-kingdom signaling system. Future perspectives: 61
- 62. Thank you Bacteriology group ICGEB Vittorio Venturi Giuliano Degrassi Giulia Devescovi Iris Bertani Daniel Passos Bruna Goncalves Coutinho Hitendra Patel Veronica Parisi Previous members: Sara Ferluga Zulma Suarez Sujatha Subramoni Carlos Nieto Maja Grabusic Giacomo Roman Mike Myers Protein Networks group Sandor Pongor Protein Structure and Bioinformatics Ghent University, Belgium Monica Höfte David De Vleesschauwer University of Nova Gorica, Slovenia Elsa Fabbretti
- 63. Non-polar / hydrophobic - (G), A, V, L, I, P, Y, F, W, M, C•