SlideShare a Scribd company logo
1 of 16
Download to read offline
East Coast fever – outlook for a new 
vaccine 
Vish Nene 
Workshop on the distribution, delivery and improvement of the 
Infection and Treatment Method vaccine for East Coast fever 
Nairobi, 19-20 August 2014
A live vaccine via ITM for the control of ECF 
A live infection and treatment based method of vaccination 
Caused by Theileria parva – a tick transmitted pathogen 
Vaccination method developed by KARI and ILRI in mid-1970’s 
The Muguga cocktail a commercial enterprise at CTTBD
Entry points for subunit vaccine intervention 
Infected R. appendiculatus ticks 
schizont-infected cells 
sporozoites 
piroplasms 
merogony 
Antigenic diversity - a hallmark of T. parva 
sporozoite 
neutralizing Abs 
sporozoite 
bovine cell 
schizont-specific CD8 
killer T-cells (CTLs) 
CTL 
P 
CTL 
P
Technical advances in DNA/RNA/protein sequencing, glycomics, molecular & cellular biology, immunology, bioinformatics, nano-tech, computational biology, structural biology, microbiomes, etc. 
New paradigms in science are accelerating vaccine development research 
1.Identification of candidate vaccine antigens 
2.Immunogenicity studies with antigens 
3.Laboratory challenge studies 
4.Contained field trials
p67N 
p67M 
p67C 
21 225 
226 571 
572 651 
9 709 
Average 
sporozoite 
bovine cell 
Parasite neutralizing Abs 
Antibodies to p67 mediate immunity to ECF
A novel human antibody discovery platform
T-cell antigen discovery pipeline at ILRI - I ACTGGTACGTAGGGCATCGATCGACATGATAGAGCATATAGCATGACGATGCGATCGACAGTCGACAGCTGACAGCTGAGGGTGACACCAGCTGCCAGCTGGACCACCATTAGGACAGATGACCACACACAAATAGACGATTAGGACCAGATGAGCCACATTTTAGGAGGACACACACCA Bioinformatics tools Predict ~ 5000 gene sequences & list candidate vaccine antigens Clone genes of vaccine interest Filter genes via IFN-g ELISPOT and lytic assays T. parva genome sequence A Random cDNA library B Candidate CTL antigens Map CTL epitopes
T-cell antigen discovery pipeline at ILRI - II 
By Anne Mølgaard 
High information 
positions 
HLA-A0201 
Pep de	in	MHC	groove	 Pep des	exhibit	a	mo f	 
Various	algorithms	available	for	predic on	of	pep de	epitopes	 
[Peptide] 
Control 
BoLA-N*04101/ 
no peptide BoLA-N*04101/Tp227-37 BoLA-N*04101/Tp229-37 
CD8+ (PerCP) 
Flow cytometry assay
Mapped parasite CTL antigens/epitopes 
CTL epitope 
Peptide sequence 
MHC class I gene 
BoLA sero-type 
Tp1214-224 
VGYPKVKEEML 
N*01301 
A18 (HD6) 
Tp227-37 
SHEELKKLGML 
T2b~ 
Tp249-59 
KSSHGMGKVGK 
N*01201 
A10 (T2a) 
Tp296-104 
FAQSLVCVL 
T2c~ 
Tp298-106 
QSLVCVLMK 
N*01201 
A10 (T2a) 
Tp4328-336 
TGASIQTTL 
N*00101 
A10 (5.1) 
Tp587-95 
SKADVIAKY 
T5~ 
Tp7206-214 
EFISFPISL 
T7~ 
Tp8379-387 
CGAELNHFL 
N*00101 
A10 (5.1)
East Coast fever vaccine trials in cattle 
One candidate B-cell vaccine antigen 
~50% cattle immune to challenge in lab trials 
How can this be improved? 
Twelve candidate T-cell vaccine antigens 
~30% cattle immune to challenge in lab trials 
How can this be improved?
An East Coast fever R & D consortium 
Inception workshop: 27-29th Jan 2014
Antibodies 
Killer T-cells (CTLs) 
Map new pathogen antigens 
Map host response to infection & vaccination 
Comparative pathogen genomics 
Fill knowledge gaps for vaccine development & proof-of-concept (POC) 
Compare different vaccination systems
Improve live vaccine – sporozoite counts 
1.Enumerate live sporozoites 
2.Relate sporozoite counts to infectivity 
3.Relate sporozoite counts to immunogenicity 
Guava easyCyte™ 5 high power laser (Merck-Millipore)
Vaccines? 
Novel acaricides? 
Anti-tick? 
A role for vector control?
ECF Consortium -POC – in four years 
1.Best bet sporozoite antigens 
2.Best bet schizont antigens 
3.Best bet delivery systems 
4.Combination of sporozoite and schizont antigens 
Phase 1: 70~80% immunity to defined parasite challenge/defined cattle 
Phase 2: broad-spectrum immunity
The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI. 
better lives through livestock 
ilri.org

More Related Content

What's hot

Veterinary Public Health in Khwisero
 Veterinary Public Health in Khwisero  Veterinary Public Health in Khwisero
Veterinary Public Health in Khwisero Nanyingi Mark
 
Current approach for pregnancy diagnosis in animals
Current approach for pregnancy diagnosis in animalsCurrent approach for pregnancy diagnosis in animals
Current approach for pregnancy diagnosis in animalsGangaram Chaudhary
 
Haemoparasites of Animals
Haemoparasites of AnimalsHaemoparasites of Animals
Haemoparasites of AnimalsDr. Fakhar
 
Poultry diseases
Poultry diseasesPoultry diseases
Poultry diseasesh89sam
 
Poultry reproduction
Poultry reproductionPoultry reproduction
Poultry reproductionparrc
 
Disease related to breeding bull reproductive system and its management
Disease related to breeding bull reproductive system and its managementDisease related to breeding bull reproductive system and its management
Disease related to breeding bull reproductive system and its managementBibhas Talukder
 
Selection and Preparation of the Mare and Stallion for Breeding
Selection and Preparation of the Mare and Stallion for BreedingSelection and Preparation of the Mare and Stallion for Breeding
Selection and Preparation of the Mare and Stallion for BreedingHorse SA
 
Ear new affection of ear and its treatment
Ear new affection of ear and its treatmentEar new affection of ear and its treatment
Ear new affection of ear and its treatmentBikas Puri
 
Strength and weaknesses of fmd control programme going on in india dr. kale b...
Strength and weaknesses of fmd control programme going on in india dr. kale b...Strength and weaknesses of fmd control programme going on in india dr. kale b...
Strength and weaknesses of fmd control programme going on in india dr. kale b...Bhoj Raj Singh
 
Animal reproduction and obstetrics
Animal reproduction and obstetricsAnimal reproduction and obstetrics
Animal reproduction and obstetricsjoreno
 
Andrology lecture 16 Semen collection from male animals and its evaluation
Andrology lecture 16 Semen collection from male animals and its evaluationAndrology lecture 16 Semen collection from male animals and its evaluation
Andrology lecture 16 Semen collection from male animals and its evaluationDrGovindNarayanPuroh
 
Presentation: Comparative Reproductive
Presentation: Comparative ReproductivePresentation: Comparative Reproductive
Presentation: Comparative ReproductiveFaisal A. Alshamiry
 
Lecture 8 anestrus in domestic animals
Lecture 8 anestrus in domestic animalsLecture 8 anestrus in domestic animals
Lecture 8 anestrus in domestic animalsDrGovindNarayanPuroh
 
Female Reproductive Tract Anatomy of Domestic Animals
Female Reproductive Tract Anatomy of Domestic AnimalsFemale Reproductive Tract Anatomy of Domestic Animals
Female Reproductive Tract Anatomy of Domestic AnimalsGarry D. Lasaga
 

What's hot (20)

Veterinary Public Health in Khwisero
 Veterinary Public Health in Khwisero  Veterinary Public Health in Khwisero
Veterinary Public Health in Khwisero
 
Current approach for pregnancy diagnosis in animals
Current approach for pregnancy diagnosis in animalsCurrent approach for pregnancy diagnosis in animals
Current approach for pregnancy diagnosis in animals
 
Haemoparasites of Animals
Haemoparasites of AnimalsHaemoparasites of Animals
Haemoparasites of Animals
 
Poultry diseases
Poultry diseasesPoultry diseases
Poultry diseases
 
Poultry reproduction
Poultry reproductionPoultry reproduction
Poultry reproduction
 
Downer cow syndrome
Downer cow syndromeDowner cow syndrome
Downer cow syndrome
 
Coccidiosis in poultry
Coccidiosis in poultry Coccidiosis in poultry
Coccidiosis in poultry
 
Disease related to breeding bull reproductive system and its management
Disease related to breeding bull reproductive system and its managementDisease related to breeding bull reproductive system and its management
Disease related to breeding bull reproductive system and its management
 
21 animal nutrition and feeds
21 animal nutrition and feeds21 animal nutrition and feeds
21 animal nutrition and feeds
 
Selection and Preparation of the Mare and Stallion for Breeding
Selection and Preparation of the Mare and Stallion for BreedingSelection and Preparation of the Mare and Stallion for Breeding
Selection and Preparation of the Mare and Stallion for Breeding
 
Ear new affection of ear and its treatment
Ear new affection of ear and its treatmentEar new affection of ear and its treatment
Ear new affection of ear and its treatment
 
Strength and weaknesses of fmd control programme going on in india dr. kale b...
Strength and weaknesses of fmd control programme going on in india dr. kale b...Strength and weaknesses of fmd control programme going on in india dr. kale b...
Strength and weaknesses of fmd control programme going on in india dr. kale b...
 
Enterotoxemia ppt
Enterotoxemia pptEnterotoxemia ppt
Enterotoxemia ppt
 
1. introduction
1. introduction1. introduction
1. introduction
 
Calf Coccidiosis
Calf CoccidiosisCalf Coccidiosis
Calf Coccidiosis
 
Animal reproduction and obstetrics
Animal reproduction and obstetricsAnimal reproduction and obstetrics
Animal reproduction and obstetrics
 
Andrology lecture 16 Semen collection from male animals and its evaluation
Andrology lecture 16 Semen collection from male animals and its evaluationAndrology lecture 16 Semen collection from male animals and its evaluation
Andrology lecture 16 Semen collection from male animals and its evaluation
 
Presentation: Comparative Reproductive
Presentation: Comparative ReproductivePresentation: Comparative Reproductive
Presentation: Comparative Reproductive
 
Lecture 8 anestrus in domestic animals
Lecture 8 anestrus in domestic animalsLecture 8 anestrus in domestic animals
Lecture 8 anestrus in domestic animals
 
Female Reproductive Tract Anatomy of Domestic Animals
Female Reproductive Tract Anatomy of Domestic AnimalsFemale Reproductive Tract Anatomy of Domestic Animals
Female Reproductive Tract Anatomy of Domestic Animals
 

Similar to East Coast fever—Outlook for a new vaccine

In silico analysis of potential human T Cell antigens from Mycobacterium tube...
In silico analysis of potential human T Cell antigens from Mycobacterium tube...In silico analysis of potential human T Cell antigens from Mycobacterium tube...
In silico analysis of potential human T Cell antigens from Mycobacterium tube...Santhi Devasundaram
 
JPT_Poster_EPS_2016_final
JPT_Poster_EPS_2016_finalJPT_Poster_EPS_2016_final
JPT_Poster_EPS_2016_finalPaul Von Hoegen
 
Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...
Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...
Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...ILRI
 
ProImmune Antigen Characterization Summit Sanja Selak
ProImmune Antigen Characterization Summit Sanja SelakProImmune Antigen Characterization Summit Sanja Selak
ProImmune Antigen Characterization Summit Sanja Selakamandacturner
 
USP CHOP Annie De Groot Presentation June 2013
USP CHOP Annie De Groot Presentation June 2013USP CHOP Annie De Groot Presentation June 2013
USP CHOP Annie De Groot Presentation June 2013Business EpiVax
 
Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...
Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...
Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...ILRI
 
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...Santhi Devasundaram
 
ProImmune Antigen Characterization Summit Gene Olinger
ProImmune Antigen Characterization Summit Gene OlingerProImmune Antigen Characterization Summit Gene Olinger
ProImmune Antigen Characterization Summit Gene Olingeramandacturner
 
Aeras schofield 21112013
Aeras schofield 21112013Aeras schofield 21112013
Aeras schofield 21112013AerasGlobalTB
 
Mci5004 biomarkers infectious diseases
Mci5004 biomarkers infectious diseasesMci5004 biomarkers infectious diseases
Mci5004 biomarkers infectious diseasesR Lin
 
IHI RETREAT 2012 BIOMEDICAL GROUP
IHI RETREAT 2012 BIOMEDICAL GROUPIHI RETREAT 2012 BIOMEDICAL GROUP
IHI RETREAT 2012 BIOMEDICAL GROUPGwamaka Moses
 
dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...
dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...
dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...dkNET
 
2015 11 Inmunoterapia en nsclc
2015 11 Inmunoterapia en nsclc2015 11 Inmunoterapia en nsclc
2015 11 Inmunoterapia en nsclcMartín Lázaro
 
Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...
Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...
Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...QIAGEN
 

Similar to East Coast fever—Outlook for a new vaccine (20)

In silico analysis of potential human T Cell antigens from Mycobacterium tube...
In silico analysis of potential human T Cell antigens from Mycobacterium tube...In silico analysis of potential human T Cell antigens from Mycobacterium tube...
In silico analysis of potential human T Cell antigens from Mycobacterium tube...
 
JPT_Poster_EPS_2016_final
JPT_Poster_EPS_2016_finalJPT_Poster_EPS_2016_final
JPT_Poster_EPS_2016_final
 
Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...
Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...
Immunoinformatics and MHC-Tetramers, revolutionary technologies for vaccine d...
 
ProImmune Antigen Characterization Summit Sanja Selak
ProImmune Antigen Characterization Summit Sanja SelakProImmune Antigen Characterization Summit Sanja Selak
ProImmune Antigen Characterization Summit Sanja Selak
 
USP CHOP Annie De Groot Presentation June 2013
USP CHOP Annie De Groot Presentation June 2013USP CHOP Annie De Groot Presentation June 2013
USP CHOP Annie De Groot Presentation June 2013
 
Host pathogen interaction
Host pathogen interactionHost pathogen interaction
Host pathogen interaction
 
Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...
Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...
Discovery of novel CTL epitopes by peptide library screening of CTL lines fro...
 
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...
 
ProImmune Antigen Characterization Summit Gene Olinger
ProImmune Antigen Characterization Summit Gene OlingerProImmune Antigen Characterization Summit Gene Olinger
ProImmune Antigen Characterization Summit Gene Olinger
 
Aeras schofield 21112013
Aeras schofield 21112013Aeras schofield 21112013
Aeras schofield 21112013
 
Mci5004 biomarkers infectious diseases
Mci5004 biomarkers infectious diseasesMci5004 biomarkers infectious diseases
Mci5004 biomarkers infectious diseases
 
IHI RETREAT 2012 BIOMEDICAL GROUP
IHI RETREAT 2012 BIOMEDICAL GROUPIHI RETREAT 2012 BIOMEDICAL GROUP
IHI RETREAT 2012 BIOMEDICAL GROUP
 
Final dissertation 240211
Final dissertation 240211Final dissertation 240211
Final dissertation 240211
 
dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...
dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...
dkNET-HIRN Webinar "T Cell Antigen Discovery: Experimental and Computational ...
 
2015 11 Inmunoterapia en nsclc
2015 11 Inmunoterapia en nsclc2015 11 Inmunoterapia en nsclc
2015 11 Inmunoterapia en nsclc
 
TLR ligand functionalized nanocarriers to enhance immunogenicity of vaccines
TLR ligand functionalized nanocarriers to enhance immunogenicity of vaccinesTLR ligand functionalized nanocarriers to enhance immunogenicity of vaccines
TLR ligand functionalized nanocarriers to enhance immunogenicity of vaccines
 
Noi principii in vaccinare C Leclerc 2014
Noi principii in vaccinare C Leclerc  2014Noi principii in vaccinare C Leclerc  2014
Noi principii in vaccinare C Leclerc 2014
 
My CV_final
My CV_finalMy CV_final
My CV_final
 
Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...
Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...
Identification of antibiotic resistance genes in Klebsiella pneumoniae isolat...
 
Sales 2
Sales 2Sales 2
Sales 2
 

More from ILRI

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...ILRI
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...ILRI
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesILRI
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseaseILRI
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistanceILRI
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesILRI
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMICILRI
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaILRI
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldILRI
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaILRI
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwaILRI
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogsILRI
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...ILRI
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...ILRI
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformationILRI
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...ILRI
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsILRI
 

More from ILRI (20)

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne disease
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countries
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMIC
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern Africa
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the field
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in Uganda
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwa
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogs
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformation
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
 

Recently uploaded

IDENTIFICATION OF THE LIVING- forensic medicine
IDENTIFICATION OF THE LIVING- forensic medicineIDENTIFICATION OF THE LIVING- forensic medicine
IDENTIFICATION OF THE LIVING- forensic medicinesherlingomez2
 
Zoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfZoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfSumit Kumar yadav
 
Introduction,importance and scope of horticulture.pptx
Introduction,importance and scope of horticulture.pptxIntroduction,importance and scope of horticulture.pptx
Introduction,importance and scope of horticulture.pptxBhagirath Gogikar
 
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...ssuser79fe74
 
Module for Grade 9 for Asynchronous/Distance learning
Module for Grade 9 for Asynchronous/Distance learningModule for Grade 9 for Asynchronous/Distance learning
Module for Grade 9 for Asynchronous/Distance learninglevieagacer
 
Seismic Method Estimate velocity from seismic data.pptx
Seismic Method Estimate velocity from seismic  data.pptxSeismic Method Estimate velocity from seismic  data.pptx
Seismic Method Estimate velocity from seismic data.pptxAlMamun560346
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPirithiRaju
 
COST ESTIMATION FOR A RESEARCH PROJECT.pptx
COST ESTIMATION FOR A RESEARCH PROJECT.pptxCOST ESTIMATION FOR A RESEARCH PROJECT.pptx
COST ESTIMATION FOR A RESEARCH PROJECT.pptxFarihaAbdulRasheed
 
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Servicenishacall1
 
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...dkNET
 
Forensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfForensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfrohankumarsinghrore1
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Silpa
 
COMPUTING ANTI-DERIVATIVES (Integration by SUBSTITUTION)
COMPUTING ANTI-DERIVATIVES(Integration by SUBSTITUTION)COMPUTING ANTI-DERIVATIVES(Integration by SUBSTITUTION)
COMPUTING ANTI-DERIVATIVES (Integration by SUBSTITUTION)AkefAfaneh2
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPirithiRaju
 
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptxPSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptxSuji236384
 
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 60009654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000Sapana Sha
 
Bacterial Identification and Classifications
Bacterial Identification and ClassificationsBacterial Identification and Classifications
Bacterial Identification and ClassificationsAreesha Ahmad
 
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...chandars293
 
pumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit flypumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit flyPRADYUMMAURYA1
 

Recently uploaded (20)

IDENTIFICATION OF THE LIVING- forensic medicine
IDENTIFICATION OF THE LIVING- forensic medicineIDENTIFICATION OF THE LIVING- forensic medicine
IDENTIFICATION OF THE LIVING- forensic medicine
 
Zoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfZoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdf
 
Introduction,importance and scope of horticulture.pptx
Introduction,importance and scope of horticulture.pptxIntroduction,importance and scope of horticulture.pptx
Introduction,importance and scope of horticulture.pptx
 
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
 
Module for Grade 9 for Asynchronous/Distance learning
Module for Grade 9 for Asynchronous/Distance learningModule for Grade 9 for Asynchronous/Distance learning
Module for Grade 9 for Asynchronous/Distance learning
 
Seismic Method Estimate velocity from seismic data.pptx
Seismic Method Estimate velocity from seismic  data.pptxSeismic Method Estimate velocity from seismic  data.pptx
Seismic Method Estimate velocity from seismic data.pptx
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
 
COST ESTIMATION FOR A RESEARCH PROJECT.pptx
COST ESTIMATION FOR A RESEARCH PROJECT.pptxCOST ESTIMATION FOR A RESEARCH PROJECT.pptx
COST ESTIMATION FOR A RESEARCH PROJECT.pptx
 
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
 
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
 
Forensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfForensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdf
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.
 
COMPUTING ANTI-DERIVATIVES (Integration by SUBSTITUTION)
COMPUTING ANTI-DERIVATIVES(Integration by SUBSTITUTION)COMPUTING ANTI-DERIVATIVES(Integration by SUBSTITUTION)
COMPUTING ANTI-DERIVATIVES (Integration by SUBSTITUTION)
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
 
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptxPSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
 
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 60009654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
 
Bacterial Identification and Classifications
Bacterial Identification and ClassificationsBacterial Identification and Classifications
Bacterial Identification and Classifications
 
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
 
Site Acceptance Test .
Site Acceptance Test                    .Site Acceptance Test                    .
Site Acceptance Test .
 
pumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit flypumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit fly
 

East Coast fever—Outlook for a new vaccine

  • 1. East Coast fever – outlook for a new vaccine Vish Nene Workshop on the distribution, delivery and improvement of the Infection and Treatment Method vaccine for East Coast fever Nairobi, 19-20 August 2014
  • 2. A live vaccine via ITM for the control of ECF A live infection and treatment based method of vaccination Caused by Theileria parva – a tick transmitted pathogen Vaccination method developed by KARI and ILRI in mid-1970’s The Muguga cocktail a commercial enterprise at CTTBD
  • 3. Entry points for subunit vaccine intervention Infected R. appendiculatus ticks schizont-infected cells sporozoites piroplasms merogony Antigenic diversity - a hallmark of T. parva sporozoite neutralizing Abs sporozoite bovine cell schizont-specific CD8 killer T-cells (CTLs) CTL P CTL P
  • 4. Technical advances in DNA/RNA/protein sequencing, glycomics, molecular & cellular biology, immunology, bioinformatics, nano-tech, computational biology, structural biology, microbiomes, etc. New paradigms in science are accelerating vaccine development research 1.Identification of candidate vaccine antigens 2.Immunogenicity studies with antigens 3.Laboratory challenge studies 4.Contained field trials
  • 5. p67N p67M p67C 21 225 226 571 572 651 9 709 Average sporozoite bovine cell Parasite neutralizing Abs Antibodies to p67 mediate immunity to ECF
  • 6. A novel human antibody discovery platform
  • 7. T-cell antigen discovery pipeline at ILRI - I ACTGGTACGTAGGGCATCGATCGACATGATAGAGCATATAGCATGACGATGCGATCGACAGTCGACAGCTGACAGCTGAGGGTGACACCAGCTGCCAGCTGGACCACCATTAGGACAGATGACCACACACAAATAGACGATTAGGACCAGATGAGCCACATTTTAGGAGGACACACACCA Bioinformatics tools Predict ~ 5000 gene sequences & list candidate vaccine antigens Clone genes of vaccine interest Filter genes via IFN-g ELISPOT and lytic assays T. parva genome sequence A Random cDNA library B Candidate CTL antigens Map CTL epitopes
  • 8. T-cell antigen discovery pipeline at ILRI - II By Anne Mølgaard High information positions HLA-A0201 Pep de in MHC groove Pep des exhibit a mo f Various algorithms available for predic on of pep de epitopes [Peptide] Control BoLA-N*04101/ no peptide BoLA-N*04101/Tp227-37 BoLA-N*04101/Tp229-37 CD8+ (PerCP) Flow cytometry assay
  • 9. Mapped parasite CTL antigens/epitopes CTL epitope Peptide sequence MHC class I gene BoLA sero-type Tp1214-224 VGYPKVKEEML N*01301 A18 (HD6) Tp227-37 SHEELKKLGML T2b~ Tp249-59 KSSHGMGKVGK N*01201 A10 (T2a) Tp296-104 FAQSLVCVL T2c~ Tp298-106 QSLVCVLMK N*01201 A10 (T2a) Tp4328-336 TGASIQTTL N*00101 A10 (5.1) Tp587-95 SKADVIAKY T5~ Tp7206-214 EFISFPISL T7~ Tp8379-387 CGAELNHFL N*00101 A10 (5.1)
  • 10. East Coast fever vaccine trials in cattle One candidate B-cell vaccine antigen ~50% cattle immune to challenge in lab trials How can this be improved? Twelve candidate T-cell vaccine antigens ~30% cattle immune to challenge in lab trials How can this be improved?
  • 11. An East Coast fever R & D consortium Inception workshop: 27-29th Jan 2014
  • 12. Antibodies Killer T-cells (CTLs) Map new pathogen antigens Map host response to infection & vaccination Comparative pathogen genomics Fill knowledge gaps for vaccine development & proof-of-concept (POC) Compare different vaccination systems
  • 13. Improve live vaccine – sporozoite counts 1.Enumerate live sporozoites 2.Relate sporozoite counts to infectivity 3.Relate sporozoite counts to immunogenicity Guava easyCyte™ 5 high power laser (Merck-Millipore)
  • 14. Vaccines? Novel acaricides? Anti-tick? A role for vector control?
  • 15. ECF Consortium -POC – in four years 1.Best bet sporozoite antigens 2.Best bet schizont antigens 3.Best bet delivery systems 4.Combination of sporozoite and schizont antigens Phase 1: 70~80% immunity to defined parasite challenge/defined cattle Phase 2: broad-spectrum immunity
  • 16. The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI. better lives through livestock ilri.org