SlideShare a Scribd company logo
1 of 21
Monitoring the quality of
data in the clinical use of
pathogen genomes
Dr Tom Conway
IBM Research Australia
Uses of Microbial Genomes: Public Health
Infected Food Microbiological
Investigation
Cluster
Analysis
Uses of Microbial Genomes: Clinical
Antibiotic
Resistance Test
Detecting
Resistance Genes
Current Practice Genomics Methods
Typical Genomics Workflow
Sample Prep
Sequencing
Sequence Data
Analytics
Reporting InterventionSequence Data
Measuring Sequence Quality
Using a Reference Sequence
alignment
Reference
Sequences
that failed to
align to
reference
x
x
x
x x o
x o
xo
x
x
Sequence fragment
Sequence Data as Words
1: imped, and shivered, and glafed, and growled; and
2: wind was rushing was the sea; and that the smwll
3: nd broad impression of thk identity of things seem
(from Great Expectations with apologies to Charles Dickens)
Sequence Data as Words
GTGGGTTTTTATCGGCTGGCACATGTGTTGGG
GTGGGT TTTATC GCTGGC CATGTG
TGGGTT TTATCG CTGGCA ATGTGT
GGGTTT TATCGG TGGCAC TGTGTT
GGTTTT ATCGGC GGCACA GTGTTG
GTTTTT TCGGCT GCACAT TGTTGG
TTTTTA CGGCTG CACATG GTTGGG
TTTTAT GGCTGG ACATGT
Accumulating Fragments: 10,000
#differentwords
word frequency
Accumulating Fragments: 20,000
#differentwords
word frequency
Accumulating Fragments: 50,000
#differentwords
word frequency
Accumulating Fragments: 100,000
#differentwords
word frequency
Accumulating Fragments: 200,000
#differentwords
word frequency
Accumulating Fragments: 500,000
#differentwords
word frequency
Accumulating Fragments: 1,000,000
#differentwords
word frequency
Accumulating Fragments: 1,000,000
#differentwords
word frequency
Differentiating True and False Words
#differentwords
word frequency
Estimated Genome Size
Isolate Number
EstimatedGenomeSize(Mbp)
Isolate Number
TrueWordFraction
True Word Fraction
Why This is Valuable
Quantifiable Robust
Efficient
Species
Independent
Actionable
Interpretable
The Team
Tom
Conway
Jeremy
Wazny
Justin
Bedo
Mahtab
Mirmomeni
Ben
Goudey
Kelly
Wyres
Natalie
Gunn
Hannah
Huckstep

More Related Content

What's hot

Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)
Tania Acuna
 
Single-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and ChallengesSingle-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and Challenges
inside-BigData.com
 
ZFN-Science-Rats
ZFN-Science-RatsZFN-Science-Rats
ZFN-Science-Rats
Greg Davis
 
PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6
Rita Auro
 

What's hot (20)

Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
 
Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)Ransbotyn et al PUBLISHED (1)
Ransbotyn et al PUBLISHED (1)
 
The Genomics Revolution: The Good, The Bad, and The Ugly
The Genomics Revolution: The Good, The Bad, and The UglyThe Genomics Revolution: The Good, The Bad, and The Ugly
The Genomics Revolution: The Good, The Bad, and The Ugly
 
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
The Genomics Revolution: The Good, The Bad, and The Ugly (UEOP16 Keynote)
 
Monarch Initiative Poster - Rare Disease Symposium 2015
Monarch Initiative Poster - Rare Disease Symposium 2015Monarch Initiative Poster - Rare Disease Symposium 2015
Monarch Initiative Poster - Rare Disease Symposium 2015
 
How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical information
 
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
2015. Bradley j. Till. Forward and reverse genetics for functional genomics a...
 
Comprehensive Exam Slides 11/13/2013
Comprehensive Exam Slides 11/13/2013Comprehensive Exam Slides 11/13/2013
Comprehensive Exam Slides 11/13/2013
 
Multigenic (mechanistic) biomarkers
Multigenic (mechanistic) biomarkersMultigenic (mechanistic) biomarkers
Multigenic (mechanistic) biomarkers
 
Single-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and ChallengesSingle-Cell Sequencing for Drug Discovery: Applications and Challenges
Single-Cell Sequencing for Drug Discovery: Applications and Challenges
 
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypesFocusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
 
Global surveillance One World – One Health
Global surveillance  One World – One HealthGlobal surveillance  One World – One Health
Global surveillance One World – One Health
 
Bioinformatics in dermato-oncology
Bioinformatics in dermato-oncologyBioinformatics in dermato-oncology
Bioinformatics in dermato-oncology
 
Resume
ResumeResume
Resume
 
The server of the Spanish Population Variability
The server of the Spanish Population VariabilityThe server of the Spanish Population Variability
The server of the Spanish Population Variability
 
ZFN-Science-Rats
ZFN-Science-RatsZFN-Science-Rats
ZFN-Science-Rats
 
PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6PNAS-2013-Barr-10771-6
PNAS-2013-Barr-10771-6
 
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
 
Metagenomics
MetagenomicsMetagenomics
Metagenomics
 
Microbial Metagenomics and Human Health
Microbial Metagenomics and Human HealthMicrobial Metagenomics and Human Health
Microbial Metagenomics and Human Health
 

Similar to Monitoring the quality of data in the clinical use of pathogen genomes

Transcriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDFTranscriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDF
Janaya Shelly
 
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike SnyderPersonalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
The Hive
 
Gardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in MedicineGardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in Medicine
Amanda Natalizio
 
1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdf1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdf
deepakangel
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009
Ian Foster
 
Moving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel DudleyMoving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
CityAge
 

Similar to Monitoring the quality of data in the clinical use of pathogen genomes (20)

Transcriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDFTranscriptome Analysis of Spontaneous PDF
Transcriptome Analysis of Spontaneous PDF
 
Dna microarray mehran- u of toronto
Dna microarray  mehran- u of torontoDna microarray  mehran- u of toronto
Dna microarray mehran- u of toronto
 
Genomics2 Phenomics Complete
Genomics2 Phenomics CompleteGenomics2 Phenomics Complete
Genomics2 Phenomics Complete
 
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
Morphologomics - Challenges for Surgical Pathology in the Genomic Age by Dr. ...
 
ACC Cancer Cell May 2016
ACC Cancer Cell May 2016ACC Cancer Cell May 2016
ACC Cancer Cell May 2016
 
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike SnyderPersonalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
 
Big data biology for pythonistas: getting in on the genomics revolution
Big data biology for pythonistas: getting in on the genomics revolutionBig data biology for pythonistas: getting in on the genomics revolution
Big data biology for pythonistas: getting in on the genomics revolution
 
Gardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in MedicineGardner and Song_2015_Genetics in Medicine
Gardner and Song_2015_Genetics in Medicine
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...
 
1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdf1)patterns of genetic variability in human mitochondria show evidenc.pdf
1)patterns of genetic variability in human mitochondria show evidenc.pdf
 
The Human Genome Project
The Human Genome Project The Human Genome Project
The Human Genome Project
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattle
 
Teresa Coque Hospital Universitario Ramón y Cajal.
Teresa Coque  Hospital Universitario Ramón y Cajal. Teresa Coque  Hospital Universitario Ramón y Cajal.
Teresa Coque Hospital Universitario Ramón y Cajal.
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009
 
Madrid icgc pcawg_2016_slideshare
Madrid icgc pcawg_2016_slideshareMadrid icgc pcawg_2016_slideshare
Madrid icgc pcawg_2016_slideshare
 
Plos
PlosPlos
Plos
 
Moving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel DudleyMoving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
Moving from Big Data to Better Models of Disease and Drug Response - Joel Dudley
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
JALANov2000
JALANov2000JALANov2000
JALANov2000
 
4. HGP.pptx
4. HGP.pptx4. HGP.pptx
4. HGP.pptx
 

More from Health Informatics New Zealand

More from Health Informatics New Zealand (20)

The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...
 
Shaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voiceShaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voice
 
Surveillance of social media: Big data analytics
Surveillance of social media: Big data analyticsSurveillance of social media: Big data analytics
Surveillance of social media: Big data analytics
 
The Power of Surface Modelling
The Power of Surface ModellingThe Power of Surface Modelling
The Power of Surface Modelling
 
Laptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health serviceLaptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health service
 
Making surgical practice improvement easy
Making surgical practice improvement easyMaking surgical practice improvement easy
Making surgical practice improvement easy
 
Safe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thingSafe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thing
 
Beyond EMR - so you've got an EMR - what next?
Beyond EMR - so you've got an EMR - what next?Beyond EMR - so you've got an EMR - what next?
Beyond EMR - so you've got an EMR - what next?
 
Empowered Health
Empowered HealthEmpowered Health
Empowered Health
 
Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...
 
Using the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsisUsing the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsis
 
Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?
 
Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...
 
Overview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information SystemOverview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information System
 
Nhitb wednesday 9am plenary (sadhana first)
Nhitb wednesday 9am plenary (sadhana first)Nhitb wednesday 9am plenary (sadhana first)
Nhitb wednesday 9am plenary (sadhana first)
 
Oncology treatment patterns in the South Island
Oncology treatment patterns in the South IslandOncology treatment patterns in the South Island
Oncology treatment patterns in the South Island
 
Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...
 
Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...
 
"Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of..."Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of...
 
The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?
 

Recently uploaded

science quiz bee questions.doc FOR ELEMENTARY SCIENCE
science quiz bee questions.doc FOR ELEMENTARY SCIENCEscience quiz bee questions.doc FOR ELEMENTARY SCIENCE
science quiz bee questions.doc FOR ELEMENTARY SCIENCE
maricelsampaga
 
❤️ Zirakpur Call Girl Service ☎️9878799926☎️ Call Girl service in Zirakpur ☎...
❤️ Zirakpur Call Girl Service  ☎️9878799926☎️ Call Girl service in Zirakpur ☎...❤️ Zirakpur Call Girl Service  ☎️9878799926☎️ Call Girl service in Zirakpur ☎...
❤️ Zirakpur Call Girl Service ☎️9878799926☎️ Call Girl service in Zirakpur ☎...
daljeetkaur2026
 
Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...
Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...
Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...
Sheetaleventcompany
 
❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...
❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...
❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...
daljeetkaur2026
 
💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...
Sheetaleventcompany
 

Recently uploaded (20)

❤️ Call Girls service In Panchkula☎️9815457724☎️ Call Girl service in Panchku...
❤️ Call Girls service In Panchkula☎️9815457724☎️ Call Girl service in Panchku...❤️ Call Girls service In Panchkula☎️9815457724☎️ Call Girl service in Panchku...
❤️ Call Girls service In Panchkula☎️9815457724☎️ Call Girl service in Panchku...
 
💞 Safe And Secure Call Girls Prayagraj 🧿 9332606886 🧿 High Class Call Girl Se...
💞 Safe And Secure Call Girls Prayagraj 🧿 9332606886 🧿 High Class Call Girl Se...💞 Safe And Secure Call Girls Prayagraj 🧿 9332606886 🧿 High Class Call Girl Se...
💞 Safe And Secure Call Girls Prayagraj 🧿 9332606886 🧿 High Class Call Girl Se...
 
💸Cash Payment No Advance Call Girls Kolkata 🧿 9332606886 🧿 High Class Call Gi...
💸Cash Payment No Advance Call Girls Kolkata 🧿 9332606886 🧿 High Class Call Gi...💸Cash Payment No Advance Call Girls Kolkata 🧿 9332606886 🧿 High Class Call Gi...
💸Cash Payment No Advance Call Girls Kolkata 🧿 9332606886 🧿 High Class Call Gi...
 
💞 Safe And Secure Call Girls Coimbatore 🧿 9332606886 🧿 High Class Call Girl S...
💞 Safe And Secure Call Girls Coimbatore 🧿 9332606886 🧿 High Class Call Girl S...💞 Safe And Secure Call Girls Coimbatore 🧿 9332606886 🧿 High Class Call Girl S...
💞 Safe And Secure Call Girls Coimbatore 🧿 9332606886 🧿 High Class Call Girl S...
 
science quiz bee questions.doc FOR ELEMENTARY SCIENCE
science quiz bee questions.doc FOR ELEMENTARY SCIENCEscience quiz bee questions.doc FOR ELEMENTARY SCIENCE
science quiz bee questions.doc FOR ELEMENTARY SCIENCE
 
Independent Call Girls Service Chandigarh Sector 17 | 8868886958 | Call Girl ...
Independent Call Girls Service Chandigarh Sector 17 | 8868886958 | Call Girl ...Independent Call Girls Service Chandigarh Sector 17 | 8868886958 | Call Girl ...
Independent Call Girls Service Chandigarh Sector 17 | 8868886958 | Call Girl ...
 
Ulhasnagar Call girl escort *88638//40496* Call me monika call girls 24*
Ulhasnagar Call girl escort *88638//40496* Call me monika call girls 24*Ulhasnagar Call girl escort *88638//40496* Call me monika call girls 24*
Ulhasnagar Call girl escort *88638//40496* Call me monika call girls 24*
 
❤️ Zirakpur Call Girl Service ☎️9878799926☎️ Call Girl service in Zirakpur ☎...
❤️ Zirakpur Call Girl Service  ☎️9878799926☎️ Call Girl service in Zirakpur ☎...❤️ Zirakpur Call Girl Service  ☎️9878799926☎️ Call Girl service in Zirakpur ☎...
❤️ Zirakpur Call Girl Service ☎️9878799926☎️ Call Girl service in Zirakpur ☎...
 
Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...
Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...
Lucknow Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Luckn...
 
Independent Call Girls Service Chandigarh | 8868886958 | Call Girl Service Nu...
Independent Call Girls Service Chandigarh | 8868886958 | Call Girl Service Nu...Independent Call Girls Service Chandigarh | 8868886958 | Call Girl Service Nu...
Independent Call Girls Service Chandigarh | 8868886958 | Call Girl Service Nu...
 
❤️Chandigarh Escort Service☎️9815457724☎️ Call Girl service in Chandigarh☎️ C...
❤️Chandigarh Escort Service☎️9815457724☎️ Call Girl service in Chandigarh☎️ C...❤️Chandigarh Escort Service☎️9815457724☎️ Call Girl service in Chandigarh☎️ C...
❤️Chandigarh Escort Service☎️9815457724☎️ Call Girl service in Chandigarh☎️ C...
 
❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...
❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...
❤️ Chandigarh Call Girls Service☎️9878799926☎️ Call Girl service in Chandigar...
 
❤️Amritsar Escort Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amrit...
❤️Amritsar Escort Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amrit...❤️Amritsar Escort Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amrit...
❤️Amritsar Escort Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amrit...
 
2024 PCP #IMPerative Updates in Rheumatology
2024 PCP #IMPerative Updates in Rheumatology2024 PCP #IMPerative Updates in Rheumatology
2024 PCP #IMPerative Updates in Rheumatology
 
💸Cash Payment No Advance Call Girls Surat 🧿 9332606886 🧿 High Class Call Girl...
💸Cash Payment No Advance Call Girls Surat 🧿 9332606886 🧿 High Class Call Girl...💸Cash Payment No Advance Call Girls Surat 🧿 9332606886 🧿 High Class Call Girl...
💸Cash Payment No Advance Call Girls Surat 🧿 9332606886 🧿 High Class Call Girl...
 
💸Cash Payment No Advance Call Girls Kanpur 🧿 9332606886 🧿 High Class Call Gir...
💸Cash Payment No Advance Call Girls Kanpur 🧿 9332606886 🧿 High Class Call Gir...💸Cash Payment No Advance Call Girls Kanpur 🧿 9332606886 🧿 High Class Call Gir...
💸Cash Payment No Advance Call Girls Kanpur 🧿 9332606886 🧿 High Class Call Gir...
 
💸Cash Payment No Advance Call Girls Pune 🧿 9332606886 🧿 High Class Call Girl ...
💸Cash Payment No Advance Call Girls Pune 🧿 9332606886 🧿 High Class Call Girl ...💸Cash Payment No Advance Call Girls Pune 🧿 9332606886 🧿 High Class Call Girl ...
💸Cash Payment No Advance Call Girls Pune 🧿 9332606886 🧿 High Class Call Girl ...
 
💸Cash Payment No Advance Call Girls Hyderabad 🧿 9332606886 🧿 High Class Call ...
💸Cash Payment No Advance Call Girls Hyderabad 🧿 9332606886 🧿 High Class Call ...💸Cash Payment No Advance Call Girls Hyderabad 🧿 9332606886 🧿 High Class Call ...
💸Cash Payment No Advance Call Girls Hyderabad 🧿 9332606886 🧿 High Class Call ...
 
Call Girls Service Amritsar Just Call 9352988975 Top Class Call Girl Service ...
Call Girls Service Amritsar Just Call 9352988975 Top Class Call Girl Service ...Call Girls Service Amritsar Just Call 9352988975 Top Class Call Girl Service ...
Call Girls Service Amritsar Just Call 9352988975 Top Class Call Girl Service ...
 
💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Jiya 📲🔝8868886958🔝Call Girls In Chandigarh No...
 

Monitoring the quality of data in the clinical use of pathogen genomes