SlideShare ist ein Scribd-Unternehmen logo

Robots are Team Members, Too!

•
•
Atlassian
Atlassian

The Genome Sequencing Operations group at the Broad Institute rely on JIRA to manage laboratory operations and instilled a high level of collaboration and communication between lab techs, project managers, and even robots! Learn how these robots use REST APIs to become active collaborators in a number of JIRA projects, and how you can integrate your own external applications to automate your interactions with JIRA in exciting and useful ways.

TechnologieBusiness
1 von 161
Downloaden Sie, um offline zu lesen
Friday, June 15, 12
We track lots of things: 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
We track lots of things: 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
We track lots of things: $$$$ 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
We track lots of things: $$$$ 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) or 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
Friday, June 15, 12
Robots are Team Members Too! Jim Meldrim and John Stalker The Broad Institute of MIT and Harvard Genome Sequencing Platform Friday, June 15, 12
The Broad Institute Established 2004 - Eli and Edythe Broad Joint Collaboration MIT Harvard University Affiliated Hospitals Beth Israel Deaconess Medical Center Brigham and Women’s Hospital Children’s Hospital Dana-Farber Cancer Institute Massachusetts General Hospital Friday, June 15, 12
Organization Programs (Science) Platforms (Technology) Chemical Biology Genome Sequencing Medical and Population Genetics Biological Samples Cell Circuits Chemical Biology Epigenomics Genetic Analysis Genome Sequencing and Analysis Imaging Cancer Metabolite Profiling Infectious Diseases Proteomics Metabolism RNAi Psychiatric Disease Therapeutics Discovery and Development Friday, June 15, 12
Organization Programs (Science) Platforms (Technology) Chemical Biology Genome Sequencing Medical and Population Genetics Biological Samples Cell Circuits Chemical Biology Epigenomics Genetic Analysis Genome Sequencing and Analysis Imaging Cancer Metabolite Profiling Infectious Diseases Proteomics Metabolism RNAi Psychiatric Disease Therapeutics Discovery and Development Friday, June 15, 12
Genome Sequencing Background Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 $3 billion 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 $3 billion 30K $1,000 20K $100 Automated 10K $10 Sequencing ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 Next Gen $3 billion $1,000 Sequencing 30K Illumina GA 20K $100 Automated 10K $10 Sequencing ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 Next Gen $3 billion $1,000 Sequencing 30K Illumina GA 20K $100 Automated Current SofA 10K $10 Sequencing Illumina HiSeq ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K Cumulative  Number  of  Samples $100,000 50K Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K Cumulative  Number  of  Samples $100,000 50K Cost  per  Genome 40K $10,000 30K $1,000 LCSET-1 1st JIRA tracked libraries 20K $100 5/17/2010 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
Genome Sequencing 101 Friday, June 15, 12
Genome Sequencing 101 Friday, June 15, 12
Genome Sequencing 101 Cell Nucleus Friday, June 15, 12
Genome Sequencing 101 Friday, June 15, 12
Genome Sequencing 101 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y Friday, June 15, 12
Genome Sequencing 101 Mom 1 2 3 4 5 Pop 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y Friday, June 15, 12
Genome Sequencing 101 X Y Friday, June 15, 12
Genome Sequencing 101 JIRA is in our DNA! Friday, June 15, 12
Genome Sequencing 101 Friday, June 15, 12
Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix Friday, June 15, 12
Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix • Described in 1953 by James Watson and Francis Crick Friday, June 15, 12
Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix • Described in 1953 by James Watson and Francis Crick • Carries the genetic code - the instructions for life Friday, June 15, 12
Genome Sequencing 101 Adenine Thymine Guanine Cytosine Friday, June 15, 12
Genome Sequencing 101 Friday, June 15, 12
Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCG Friday, June 15, 12
Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT 3 Billion Bases Long! Friday, June 15, 12
Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Friday, June 15, 12
Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Normal TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Friday, June 15, 12
Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Normal TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT Tumor TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT Friday, June 15, 12
Lab Process Tracking with Friday, June 15, 12
Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Cancer HIV E. Coli Ice Core Friday, June 15, 12
Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Friday, June 15, 12
Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Lab Operations Coordinator Friday, June 15, 12
Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Lab Operations Coordinator Friday, June 15, 12
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!

Empfohlen

Volatile IOCs for Fast Incident Response
Volatile IOCs for Fast Incident ResponseVolatile IOCs for Fast Incident Response
Volatile IOCs for Fast Incident ResponseTakahiro Haruyama
 
Swamp Thing--Draining Technical Debt - Atlassian Summit 2012
Swamp Thing--Draining Technical Debt - Atlassian Summit 2012Swamp Thing--Draining Technical Debt - Atlassian Summit 2012
Swamp Thing--Draining Technical Debt - Atlassian Summit 2012Atlassian
 
Atlas Hugged: How Atlassian Tools Enabled a Software Internalization Team
Atlas Hugged: How Atlassian Tools Enabled a Software Internalization TeamAtlas Hugged: How Atlassian Tools Enabled a Software Internalization Team
Atlas Hugged: How Atlassian Tools Enabled a Software Internalization TeamAtlassian
 
Aligning Continuous Integration Deployment: Automated Validation of OpenStack...
Aligning Continuous Integration Deployment: Automated Validation of OpenStack...Aligning Continuous Integration Deployment: Automated Validation of OpenStack...
Aligning Continuous Integration Deployment: Automated Validation of OpenStack...Atlassian
 
Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012
Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012
Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012Atlassian
 
GreenHopper State of the Union
GreenHopper State of the UnionGreenHopper State of the Union
GreenHopper State of the UnionAtlassian
 
Connecting Cross-functional Teams During Product Development with Confluence
Connecting Cross-functional Teams During Product Development with ConfluenceConnecting Cross-functional Teams During Product Development with Confluence
Connecting Cross-functional Teams During Product Development with ConfluenceAtlassian
 
Keynote Day 1 - Atlassian Summit 2012
Keynote Day 1 - Atlassian Summit 2012Keynote Day 1 - Atlassian Summit 2012
Keynote Day 1 - Atlassian Summit 2012Atlassian
 

Empfohlen

Volatile IOCs for Fast Incident Response
Volatile IOCs for Fast Incident ResponseVolatile IOCs for Fast Incident Response
Volatile IOCs for Fast Incident ResponseTakahiro Haruyama
 
Swamp Thing--Draining Technical Debt - Atlassian Summit 2012
Swamp Thing--Draining Technical Debt - Atlassian Summit 2012Swamp Thing--Draining Technical Debt - Atlassian Summit 2012
Swamp Thing--Draining Technical Debt - Atlassian Summit 2012Atlassian
 
Atlas Hugged: How Atlassian Tools Enabled a Software Internalization Team
Atlas Hugged: How Atlassian Tools Enabled a Software Internalization TeamAtlas Hugged: How Atlassian Tools Enabled a Software Internalization Team
Atlas Hugged: How Atlassian Tools Enabled a Software Internalization TeamAtlassian
 
Aligning Continuous Integration Deployment: Automated Validation of OpenStack...
Aligning Continuous Integration Deployment: Automated Validation of OpenStack...Aligning Continuous Integration Deployment: Automated Validation of OpenStack...
Aligning Continuous Integration Deployment: Automated Validation of OpenStack...Atlassian
 
Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012
Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012
Moneypenny Speaks! Getting the Most From (Bamboo) Agents - Atlassian Summit 2012Atlassian
 
GreenHopper State of the Union
GreenHopper State of the UnionGreenHopper State of the Union
GreenHopper State of the UnionAtlassian
 
Connecting Cross-functional Teams During Product Development with Confluence
Connecting Cross-functional Teams During Product Development with ConfluenceConnecting Cross-functional Teams During Product Development with Confluence
Connecting Cross-functional Teams During Product Development with ConfluenceAtlassian
 
Keynote Day 1 - Atlassian Summit 2012
Keynote Day 1 - Atlassian Summit 2012Keynote Day 1 - Atlassian Summit 2012
Keynote Day 1 - Atlassian Summit 2012Atlassian
 
인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)
인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)
인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)Yoon Sup Choi
 
Funding Deep Tech Startups
Funding Deep Tech StartupsFunding Deep Tech Startups
Funding Deep Tech Startupssosv
 
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...Dmitriy Filippov
 
Services For Science April 2009
Services For Science April 2009Services For Science April 2009
Services For Science April 2009Ian Foster
 
BioData World Basel 2018
BioData World Basel 2018BioData World Basel 2018
BioData World Basel 2018Anne Deslattes Mays
 
Nanotechnology: New Prospects for Jobs in Houston, Texas
Nanotechnology: New Prospects for Jobs in Houston, TexasNanotechnology: New Prospects for Jobs in Houston, Texas
Nanotechnology: New Prospects for Jobs in Houston, Texastonya.m.britton
 
Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10PICNIC Festival
 
Humanizing bioinformatics
Humanizing bioinformaticsHumanizing bioinformatics
Humanizing bioinformaticsJan Aerts
 
Introduction to Nanotechnology: Part 4
Introduction to Nanotechnology: Part 4Introduction to Nanotechnology: Part 4
Introduction to Nanotechnology: Part 4glennfish
 
Data analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsData analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsmikaelhuss
 
Automating cell-based screening with open source, robotics and AI
Automating cell-based screening with open source, robotics and AIAutomating cell-based screening with open source, robotics and AI
Automating cell-based screening with open source, robotics and AIOla Spjuth
 
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...Kim Solez ,
 
Sol padis dec10-llp-2013
Sol padis dec10-llp-2013Sol padis dec10-llp-2013
Sol padis dec10-llp-2013Stanford University
 
Jax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuJax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuAnne Deslattes Mays
 
Living in a World of Nanobioinfotechnology
Living in a World of NanobioinfotechnologyLiving in a World of Nanobioinfotechnology
Living in a World of NanobioinfotechnologyLarry Smarr
 
Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Ed Dodds
 
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...InsideScientific
 
Bringing NGS Testing In-House
Bringing NGS Testing In-HouseBringing NGS Testing In-House
Bringing NGS Testing In-HouseJosh Forsythe
 
Evolution of Knowledge Discovery and Management
Evolution of Knowledge Discovery and Management Evolution of Knowledge Discovery and Management
Evolution of Knowledge Discovery and Management inscit2006
 
AI & Bio Medical Presentation @JoshArnold et al
AI & Bio Medical Presentation @JoshArnold et alAI & Bio Medical Presentation @JoshArnold et al
AI & Bio Medical Presentation @JoshArnold et alClinton Arnold
 
International Women's Day 2020
International Women's Day 2020International Women's Day 2020
International Women's Day 2020Atlassian
 
10 emerging trends that will unbreak your workplace in 2020
10 emerging trends that will unbreak your workplace in 202010 emerging trends that will unbreak your workplace in 2020
10 emerging trends that will unbreak your workplace in 2020Atlassian
 

Weitere ähnliche Inhalte

Ähnlich wie Robots are Team Members, Too!

인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)
인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)
인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)Yoon Sup Choi
 
Funding Deep Tech Startups
Funding Deep Tech StartupsFunding Deep Tech Startups
Funding Deep Tech Startupssosv
 
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...Dmitriy Filippov
 
Services For Science April 2009
Services For Science April 2009Services For Science April 2009
Services For Science April 2009Ian Foster
 
Nanotechnology: New Prospects for Jobs in Houston, Texas
Nanotechnology: New Prospects for Jobs in Houston, TexasNanotechnology: New Prospects for Jobs in Houston, Texas
Nanotechnology: New Prospects for Jobs in Houston, Texastonya.m.britton
 
Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10PICNIC Festival
 
Humanizing bioinformatics
Humanizing bioinformaticsHumanizing bioinformatics
Humanizing bioinformaticsJan Aerts
 
Introduction to Nanotechnology: Part 4
Introduction to Nanotechnology: Part 4Introduction to Nanotechnology: Part 4
Introduction to Nanotechnology: Part 4glennfish
 
Data analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsData analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsmikaelhuss
 
Automating cell-based screening with open source, robotics and AI
Automating cell-based screening with open source, robotics and AIAutomating cell-based screening with open source, robotics and AI
Automating cell-based screening with open source, robotics and AIOla Spjuth
 
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...Kim Solez ,
 
Jax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuJax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuAnne Deslattes Mays
 
Living in a World of Nanobioinfotechnology
Living in a World of NanobioinfotechnologyLiving in a World of Nanobioinfotechnology
Living in a World of NanobioinfotechnologyLarry Smarr
 
Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Ed Dodds
 
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...InsideScientific
 
Bringing NGS Testing In-House
Bringing NGS Testing In-HouseBringing NGS Testing In-House
Bringing NGS Testing In-HouseJosh Forsythe
 
Evolution of Knowledge Discovery and Management
Evolution of Knowledge Discovery and Management Evolution of Knowledge Discovery and Management
Evolution of Knowledge Discovery and Management inscit2006
 
AI & Bio Medical Presentation @JoshArnold et al
AI & Bio Medical Presentation @JoshArnold et alAI & Bio Medical Presentation @JoshArnold et al
AI & Bio Medical Presentation @JoshArnold et alClinton Arnold
 

Ähnlich wie Robots are Team Members, Too! (20)

인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)
인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)
인공지능은 의료를 어떻게 혁신할 것인가 (ver 2)
 
Funding Deep Tech Startups
Funding Deep Tech StartupsFunding Deep Tech Startups
Funding Deep Tech Startups
 
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...
Биоплазмоника - биочипы для экспресс-диагностики патологий организма и заболе...
 
Services For Science April 2009
Services For Science April 2009Services For Science April 2009
Services For Science April 2009
 
BioData World Basel 2018
BioData World Basel 2018BioData World Basel 2018
BioData World Basel 2018
 
Nanotechnology: New Prospects for Jobs in Houston, Texas
Nanotechnology: New Prospects for Jobs in Houston, TexasNanotechnology: New Prospects for Jobs in Houston, Texas
Nanotechnology: New Prospects for Jobs in Houston, Texas
 
Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10
 
Humanizing bioinformatics
Humanizing bioinformaticsHumanizing bioinformatics
Humanizing bioinformatics
 
Introduction to Nanotechnology: Part 4
Introduction to Nanotechnology: Part 4Introduction to Nanotechnology: Part 4
Introduction to Nanotechnology: Part 4
 
Data analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsData analysis & integration challenges in genomics
Data analysis & integration challenges in genomics
 
Automating cell-based screening with open source, robotics and AI
Automating cell-based screening with open source, robotics and AIAutomating cell-based screening with open source, robotics and AI
Automating cell-based screening with open source, robotics and AI
 
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...
Jack Tuszynski Accelerating Chemotherapy Drug Discovery with Analytics and Hi...
 
Sol padis dec10-llp-2013
Sol padis dec10-llp-2013Sol padis dec10-llp-2013
Sol padis dec10-llp-2013
 
Jax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuJax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbu
 
Living in a World of Nanobioinfotechnology
Living in a World of NanobioinfotechnologyLiving in a World of Nanobioinfotechnology
Living in a World of Nanobioinfotechnology
 
Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...
 
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...
How to Create CRISPR-Edited T Cells More Efficiently for Tomorrow's Cell Ther...
 
Bringing NGS Testing In-House
Bringing NGS Testing In-HouseBringing NGS Testing In-House
Bringing NGS Testing In-House
 
Evolution of Knowledge Discovery and Management
Evolution of Knowledge Discovery and Management Evolution of Knowledge Discovery and Management
Evolution of Knowledge Discovery and Management
 
AI & Bio Medical Presentation @JoshArnold et al
AI & Bio Medical Presentation @JoshArnold et alAI & Bio Medical Presentation @JoshArnold et al
AI & Bio Medical Presentation @JoshArnold et al
 

Mehr von Atlassian

International Women's Day 2020
International Women's Day 2020International Women's Day 2020
International Women's Day 2020Atlassian
 
10 emerging trends that will unbreak your workplace in 2020
10 emerging trends that will unbreak your workplace in 202010 emerging trends that will unbreak your workplace in 2020
10 emerging trends that will unbreak your workplace in 2020Atlassian
 
Forge App Showcase
Forge App ShowcaseForge App Showcase
Forge App ShowcaseAtlassian
 
Let's Build an Editor Macro with Forge UI
Let's Build an Editor Macro with Forge UILet's Build an Editor Macro with Forge UI
Let's Build an Editor Macro with Forge UIAtlassian
 
Meet the Forge Runtime
Meet the Forge RuntimeMeet the Forge Runtime
Meet the Forge RuntimeAtlassian
 
Forge UI: A New Way to Customize the Atlassian User Experience
Forge UI: A New Way to Customize the Atlassian User ExperienceForge UI: A New Way to Customize the Atlassian User Experience
Forge UI: A New Way to Customize the Atlassian User ExperienceAtlassian
 
Take Action with Forge Triggers
Take Action with Forge TriggersTake Action with Forge Triggers
Take Action with Forge TriggersAtlassian
 
Observability and Troubleshooting in Forge
Observability and Troubleshooting in ForgeObservability and Troubleshooting in Forge
Observability and Troubleshooting in ForgeAtlassian
 
Trusted by Default: The Forge Security & Privacy Model
Trusted by Default: The Forge Security & Privacy ModelTrusted by Default: The Forge Security & Privacy Model
Trusted by Default: The Forge Security & Privacy ModelAtlassian
 
Designing Forge UI: A Story of Designing an App UI System
Designing Forge UI: A Story of Designing an App UI SystemDesigning Forge UI: A Story of Designing an App UI System
Designing Forge UI: A Story of Designing an App UI SystemAtlassian
 
Forge: Under the Hood
Forge: Under the HoodForge: Under the Hood
Forge: Under the HoodAtlassian
 
Access to User Activities - Activity Platform APIs
Access to User Activities - Activity Platform APIsAccess to User Activities - Activity Platform APIs
Access to User Activities - Activity Platform APIsAtlassian
 
Design Your Next App with the Atlassian Vendor Sketch Plugin
Design Your Next App with the Atlassian Vendor Sketch PluginDesign Your Next App with the Atlassian Vendor Sketch Plugin
Design Your Next App with the Atlassian Vendor Sketch PluginAtlassian
 
Tear Up Your Roadmap and Get Out of the Building
Tear Up Your Roadmap and Get Out of the BuildingTear Up Your Roadmap and Get Out of the Building
Tear Up Your Roadmap and Get Out of the BuildingAtlassian
 
Nailing Measurement: a Framework for Measuring Metrics that Matter
Nailing Measurement: a Framework for Measuring Metrics that MatterNailing Measurement: a Framework for Measuring Metrics that Matter
Nailing Measurement: a Framework for Measuring Metrics that MatterAtlassian
 
Building Apps With Color Blind Users in Mind
Building Apps With Color Blind Users in MindBuilding Apps With Color Blind Users in Mind
Building Apps With Color Blind Users in MindAtlassian
 
Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...
Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...
Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...Atlassian
 
Beyond Diversity: A Guide to Building Balanced Teams
Beyond Diversity: A Guide to Building Balanced TeamsBeyond Diversity: A Guide to Building Balanced Teams
Beyond Diversity: A Guide to Building Balanced TeamsAtlassian
 
The Road(map) to Las Vegas - The Story of an Emerging Self-Managed Team
The Road(map) to Las Vegas - The Story of an Emerging Self-Managed TeamThe Road(map) to Las Vegas - The Story of an Emerging Self-Managed Team
The Road(map) to Las Vegas - The Story of an Emerging Self-Managed TeamAtlassian
 
Building Apps With Enterprise in Mind
Building Apps With Enterprise in MindBuilding Apps With Enterprise in Mind
Building Apps With Enterprise in MindAtlassian
 

Mehr von Atlassian (20)

International Women's Day 2020
International Women's Day 2020International Women's Day 2020
International Women's Day 2020
 
10 emerging trends that will unbreak your workplace in 2020
10 emerging trends that will unbreak your workplace in 202010 emerging trends that will unbreak your workplace in 2020
10 emerging trends that will unbreak your workplace in 2020
 
Forge App Showcase
Forge App ShowcaseForge App Showcase
Forge App Showcase
 
Let's Build an Editor Macro with Forge UI
Let's Build an Editor Macro with Forge UILet's Build an Editor Macro with Forge UI
Let's Build an Editor Macro with Forge UI
 
Meet the Forge Runtime
Meet the Forge RuntimeMeet the Forge Runtime
Meet the Forge Runtime
 
Forge UI: A New Way to Customize the Atlassian User Experience
Forge UI: A New Way to Customize the Atlassian User ExperienceForge UI: A New Way to Customize the Atlassian User Experience
Forge UI: A New Way to Customize the Atlassian User Experience
 
Take Action with Forge Triggers
Take Action with Forge TriggersTake Action with Forge Triggers
Take Action with Forge Triggers
 
Observability and Troubleshooting in Forge
Observability and Troubleshooting in ForgeObservability and Troubleshooting in Forge
Observability and Troubleshooting in Forge
 
Trusted by Default: The Forge Security & Privacy Model
Trusted by Default: The Forge Security & Privacy ModelTrusted by Default: The Forge Security & Privacy Model
Trusted by Default: The Forge Security & Privacy Model
 
Designing Forge UI: A Story of Designing an App UI System
Designing Forge UI: A Story of Designing an App UI SystemDesigning Forge UI: A Story of Designing an App UI System
Designing Forge UI: A Story of Designing an App UI System
 
Forge: Under the Hood
Forge: Under the HoodForge: Under the Hood
Forge: Under the Hood
 
Access to User Activities - Activity Platform APIs
Access to User Activities - Activity Platform APIsAccess to User Activities - Activity Platform APIs
Access to User Activities - Activity Platform APIs
 
Design Your Next App with the Atlassian Vendor Sketch Plugin
Design Your Next App with the Atlassian Vendor Sketch PluginDesign Your Next App with the Atlassian Vendor Sketch Plugin
Design Your Next App with the Atlassian Vendor Sketch Plugin
 
Tear Up Your Roadmap and Get Out of the Building
Tear Up Your Roadmap and Get Out of the BuildingTear Up Your Roadmap and Get Out of the Building
Tear Up Your Roadmap and Get Out of the Building
 
Nailing Measurement: a Framework for Measuring Metrics that Matter
Nailing Measurement: a Framework for Measuring Metrics that MatterNailing Measurement: a Framework for Measuring Metrics that Matter
Nailing Measurement: a Framework for Measuring Metrics that Matter
 
Building Apps With Color Blind Users in Mind
Building Apps With Color Blind Users in MindBuilding Apps With Color Blind Users in Mind
Building Apps With Color Blind Users in Mind
 
Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...
Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...
Creating Inclusive Experiences: Balancing Personality and Accessibility in UX...
 
Beyond Diversity: A Guide to Building Balanced Teams
Beyond Diversity: A Guide to Building Balanced TeamsBeyond Diversity: A Guide to Building Balanced Teams
Beyond Diversity: A Guide to Building Balanced Teams
 
The Road(map) to Las Vegas - The Story of an Emerging Self-Managed Team
The Road(map) to Las Vegas - The Story of an Emerging Self-Managed TeamThe Road(map) to Las Vegas - The Story of an Emerging Self-Managed Team
The Road(map) to Las Vegas - The Story of an Emerging Self-Managed Team
 
Building Apps With Enterprise in Mind
Building Apps With Enterprise in MindBuilding Apps With Enterprise in Mind
Building Apps With Enterprise in Mind
 

Kürzlich hochgeladen

Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsJoaquim Jorge
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024Results
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking MenDelhi Call girls
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityPrincipled Technologies
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
🐬 The future of MySQL is Postgres 🐘
🐬 The future of MySQL is Postgres 🐘🐬 The future of MySQL is Postgres 🐘
🐬 The future of MySQL is Postgres 🐘RTylerCroy
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Enterprise Knowledge
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking MenDelhi Call girls
 
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxFactors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxKatpro Technologies
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessPixlogix Infotech
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 

Kürzlich hochgeladen (20)

Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
🐬 The future of MySQL is Postgres 🐘
🐬 The future of MySQL is Postgres 🐘🐬 The future of MySQL is Postgres 🐘
🐬 The future of MySQL is Postgres 🐘
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men
 
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxFactors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your Business
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 

Robots are Team Members, Too!

  • 2. We track lots of things: 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
  • 3. We track lots of things: 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
  • 4. We track lots of things: $$$$ 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
  • 5. We track lots of things: $$$$ 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) or 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendors Friday, June 15, 12
  • 7. Robots are Team Members Too! Jim Meldrim and John Stalker The Broad Institute of MIT and Harvard Genome Sequencing Platform Friday, June 15, 12
  • 8. The Broad Institute Established 2004 - Eli and Edythe Broad Joint Collaboration MIT Harvard University Affiliated Hospitals Beth Israel Deaconess Medical Center Brigham and Women’s Hospital Children’s Hospital Dana-Farber Cancer Institute Massachusetts General Hospital Friday, June 15, 12
  • 9. Organization Programs (Science) Platforms (Technology) Chemical Biology Genome Sequencing Medical and Population Genetics Biological Samples Cell Circuits Chemical Biology Epigenomics Genetic Analysis Genome Sequencing and Analysis Imaging Cancer Metabolite Profiling Infectious Diseases Proteomics Metabolism RNAi Psychiatric Disease Therapeutics Discovery and Development Friday, June 15, 12
  • 10. Organization Programs (Science) Platforms (Technology) Chemical Biology Genome Sequencing Medical and Population Genetics Biological Samples Cell Circuits Chemical Biology Epigenomics Genetic Analysis Genome Sequencing and Analysis Imaging Cancer Metabolite Profiling Infectious Diseases Proteomics Metabolism RNAi Psychiatric Disease Therapeutics Discovery and Development Friday, June 15, 12
  • 11. Genome Sequencing Background Friday, June 15, 12
  • 12. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 13. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 $3 billion 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 14. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 $3 billion 30K $1,000 20K $100 Automated 10K $10 Sequencing ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 15. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 Next Gen $3 billion $1,000 Sequencing 30K Illumina GA 20K $100 Automated 10K $10 Sequencing ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 16. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 Next Gen $3 billion $1,000 Sequencing 30K Illumina GA 20K $100 Automated Current SofA 10K $10 Sequencing Illumina HiSeq ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 17. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 18. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K Cumulative  Number  of  Samples $100,000 50K Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 19. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K Cumulative  Number  of  Samples $100,000 50K Cost  per  Genome 40K $10,000 30K $1,000 LCSET-1 1st JIRA tracked libraries 20K $100 5/17/2010 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moore's  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012 Friday, June 15, 12
  • 20. Genome Sequencing 101 Friday, June 15, 12
  • 22. Genome Sequencing 101 Cell Nucleus Friday, June 15, 12
  • 24. Genome Sequencing 101 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y Friday, June 15, 12
  • 25. Genome Sequencing 101 Mom 1 2 3 4 5 Pop 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y Friday, June 15, 12
  • 26. Genome Sequencing 101 X Y Friday, June 15, 12
  • 27. Genome Sequencing 101 JIRA is in our DNA! Friday, June 15, 12
  • 29. Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix Friday, June 15, 12
  • 30. Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix • Described in 1953 by James Watson and Francis Crick Friday, June 15, 12
  • 31. Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix • Described in 1953 by James Watson and Francis Crick • Carries the genetic code - the instructions for life Friday, June 15, 12
  • 32. Genome Sequencing 101 Adenine Thymine Guanine Cytosine Friday, June 15, 12
  • 34. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCG Friday, June 15, 12
  • 35. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT 3 Billion Bases Long! Friday, June 15, 12
  • 36. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Friday, June 15, 12
  • 37. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Normal TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Friday, June 15, 12
  • 38. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Normal TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT Tumor TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT Friday, June 15, 12
  • 39. Lab Process Tracking with Friday, June 15, 12
  • 40. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
  • 41. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
  • 42. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Cancer HIV E. Coli Ice Core Friday, June 15, 12
  • 43. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
  • 44. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
  • 45. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
  • 46. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Friday, June 15, 12
  • 47. Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Friday, June 15, 12
  • 48. Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Friday, June 15, 12
  • 49. Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Friday, June 15, 12
  • 50. Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Lab Operations Coordinator Friday, June 15, 12
  • 51. Outside the Genome Sequencing Platform Projects Group ? Our Process Project “The Players” Manager Scientist Lab Operations Coordinator Friday, June 15, 12