SlideShare ist ein Scribd-Unternehmen logo
1 von 16
Downloaden Sie, um offline zu lesen
Secure the data – share the knowledge
Fiona Nielsen, DNAdigest founder and CEO
Eagle Genomics Symposium 2014.org
DNAdigest Eagle Genomics Symposium March 27, 2014
!
DNAdigest Eagle Genomics Symposium March 27, 2014
CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA
GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT
TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG
ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA
AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG
TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT
CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC
TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG
GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG
GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG
GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT
CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG
TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC
TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC
CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC
CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG
AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG
AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA
GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA
TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG
GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT
ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA
GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG
AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA
GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT
TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG
ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA
AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG
TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT
CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC
TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG
GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG
GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG
GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT
CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG
TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC
TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC
CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC
CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG
AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG
AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA
GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA
TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG
GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT
ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA
GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG
AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA
GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT
TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG
ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA
AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG
TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT
CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC
TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG
GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG
GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG
GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT
CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG
TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC
TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC
CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC
CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG
AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG
AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA
GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA
TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG
GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT
ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA
GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG
AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
Why is no more data available
to provide evidence-based
results?
Data Privacy vs Data Access
Restricted access
repositories
Open access
• Time-consuming
deposit
• Time-consuming
access
• Difficult to
discover data
• Requires consent
for open access
(PGP) or
• Details removed
(1k genomes)
deadlock
• Data discovery
• Data access
• Incentives
You are invited!
• Connectivity
• Aggregation
• Immediate access
DEMO
DNAdigest Eagle Genomics Symposium March 27, 2014
DNAdigest Eagle Genomics Symposium March 27, 2014
Secure the data – share the knowledge
@DNAdigest
Support our work at http://tiny.cc/funddna
.org

Weitere ähnliche Inhalte

Andere mochten auch

Alpha Cetauri B Discovery 2016+
Alpha Cetauri B Discovery 2016+ Alpha Cetauri B Discovery 2016+
Alpha Cetauri B Discovery 2016+ Avi Dey
 
How to prerare a MSDS
How to prerare a MSDSHow to prerare a MSDS
How to prerare a MSDSMor Teza
 
Speed is Essential for a Great Web Experience
Speed is Essential for a Great Web ExperienceSpeed is Essential for a Great Web Experience
Speed is Essential for a Great Web ExperienceAndy Davies
 
HR Tech Europe talk 2013
HR Tech Europe talk 2013HR Tech Europe talk 2013
HR Tech Europe talk 2013Lee Bryant
 
Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...
Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...
Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...Benoit Hardy-Vallée, Ph.D.
 
UI-паттерны. Веб-формы. Часть 1
UI-паттерны. Веб-формы. Часть 1UI-паттерны. Веб-формы. Часть 1
UI-паттерны. Веб-формы. Часть 1Anastasiya Shpakava
 
Presentación 22 de abril 2015.3
Presentación 22 de abril 2015.3Presentación 22 de abril 2015.3
Presentación 22 de abril 2015.3victoriacrespog
 
Turkey report-2015-final
Turkey report-2015-finalTurkey report-2015-final
Turkey report-2015-finalDiana Sirghi
 
Production & materials management
Production & materials managementProduction & materials management
Production & materials managementVaibhav Shah
 
Transforming Insurance Risk Assessment with Big Data: Choosing the Best Path
Transforming Insurance Risk Assessment with Big Data: Choosing the Best PathTransforming Insurance Risk Assessment with Big Data: Choosing the Best Path
Transforming Insurance Risk Assessment with Big Data: Choosing the Best PathCapgemini
 
How are we doing 2015 short version
How are we doing 2015 short versionHow are we doing 2015 short version
How are we doing 2015 short versionletskeepbuilding
 

Andere mochten auch (15)

Alpha Cetauri B Discovery 2016+
Alpha Cetauri B Discovery 2016+ Alpha Cetauri B Discovery 2016+
Alpha Cetauri B Discovery 2016+
 
How to prerare a MSDS
How to prerare a MSDSHow to prerare a MSDS
How to prerare a MSDS
 
Speed is Essential for a Great Web Experience
Speed is Essential for a Great Web ExperienceSpeed is Essential for a Great Web Experience
Speed is Essential for a Great Web Experience
 
HR Tech Europe talk 2013
HR Tech Europe talk 2013HR Tech Europe talk 2013
HR Tech Europe talk 2013
 
Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...
Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...
Community Economic Development/Revitalization, Utilizing Electrical Micro Gri...
 
UI-паттерны. Веб-формы. Часть 1
UI-паттерны. Веб-формы. Часть 1UI-паттерны. Веб-формы. Часть 1
UI-паттерны. Веб-формы. Часть 1
 
Presentación 22 de abril 2015.3
Presentación 22 de abril 2015.3Presentación 22 de abril 2015.3
Presentación 22 de abril 2015.3
 
Turkey report-2015-final
Turkey report-2015-finalTurkey report-2015-final
Turkey report-2015-final
 
Senzations’15: 10 years retrospective
Senzations’15: 10 years retrospectiveSenzations’15: 10 years retrospective
Senzations’15: 10 years retrospective
 
Production & materials management
Production & materials managementProduction & materials management
Production & materials management
 
#8Marzo2016 - Tutti i numeri delle donne nel mondo dell'Istruzione
#8Marzo2016 - Tutti i numeri delle donne nel mondo dell'Istruzione#8Marzo2016 - Tutti i numeri delle donne nel mondo dell'Istruzione
#8Marzo2016 - Tutti i numeri delle donne nel mondo dell'Istruzione
 
Koreference
KoreferenceKoreference
Koreference
 
Transforming Insurance Risk Assessment with Big Data: Choosing the Best Path
Transforming Insurance Risk Assessment with Big Data: Choosing the Best PathTransforming Insurance Risk Assessment with Big Data: Choosing the Best Path
Transforming Insurance Risk Assessment with Big Data: Choosing the Best Path
 
Voyageestimating
VoyageestimatingVoyageestimating
Voyageestimating
 
How are we doing 2015 short version
How are we doing 2015 short versionHow are we doing 2015 short version
How are we doing 2015 short version
 

Mehr von Fiona Nielsen

EICT Summer School August 2023 - Things I never knew I never knew - about bu...
EICT Summer School August 2023 - Things I never knew  I never knew - about bu...EICT Summer School August 2023 - Things I never knew  I never knew - about bu...
EICT Summer School August 2023 - Things I never knew I never knew - about bu...Fiona Nielsen
 
Challenges with pre-clinical studies in immuno oncology - by Fiona Nielsen
Challenges with pre-clinical studies in immuno oncology - by Fiona NielsenChallenges with pre-clinical studies in immuno oncology - by Fiona Nielsen
Challenges with pre-clinical studies in immuno oncology - by Fiona NielsenFiona Nielsen
 
AIDR2019 - standards - tools - incentives - what does it take to enable data ...
AIDR2019 - standards - tools - incentives - what does it take to enable data ...AIDR2019 - standards - tools - incentives - what does it take to enable data ...
AIDR2019 - standards - tools - incentives - what does it take to enable data ...Fiona Nielsen
 
Genomics for the public is coming - are you ready or not?
Genomics for the public is coming - are you ready or not?Genomics for the public is coming - are you ready or not?
Genomics for the public is coming - are you ready or not?Fiona Nielsen
 
Investing in innovation for genomic medicine - sept 5 2017
Investing in innovation for genomic medicine - sept 5 2017Investing in innovation for genomic medicine - sept 5 2017
Investing in innovation for genomic medicine - sept 5 2017Fiona Nielsen
 
Investing in innovation for genomic medicine - the journey of Repositive
Investing in innovation for genomic medicine - the journey of RepositiveInvesting in innovation for genomic medicine - the journey of Repositive
Investing in innovation for genomic medicine - the journey of RepositiveFiona Nielsen
 
From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016
From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016
From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016Fiona Nielsen
 
ICG-11 - genomic data projects around the world - nov 5 2016
ICG-11 - genomic data projects around the world - nov 5 2016ICG-11 - genomic data projects around the world - nov 5 2016
ICG-11 - genomic data projects around the world - nov 5 2016Fiona Nielsen
 
SciDataCon - How to increase accessibility and reuse for clinical and persona...
SciDataCon - How to increase accessibility and reuse for clinical and persona...SciDataCon - How to increase accessibility and reuse for clinical and persona...
SciDataCon - How to increase accessibility and reuse for clinical and persona...Fiona Nielsen
 
Workshop - finding and accessing data - Cambridge August 22 2016
Workshop - finding and accessing data - Cambridge August 22 2016Workshop - finding and accessing data - Cambridge August 22 2016
Workshop - finding and accessing data - Cambridge August 22 2016Fiona Nielsen
 
Data dialogue - Human Genomic Data Discovery
Data dialogue - Human Genomic Data DiscoveryData dialogue - Human Genomic Data Discovery
Data dialogue - Human Genomic Data DiscoveryFiona Nielsen
 
Genome sharing projects around the world - Open Access is not enough
Genome sharing projects around the world - Open Access is not enough Genome sharing projects around the world - Open Access is not enough
Genome sharing projects around the world - Open Access is not enough Fiona Nielsen
 
From Bioinformatics Scientist to Entrepreneur
From Bioinformatics Scientist to EntrepreneurFrom Bioinformatics Scientist to Entrepreneur
From Bioinformatics Scientist to EntrepreneurFiona Nielsen
 
Workshop finding and accessing data - fiona nadia charlotte - cambridge apr...
Workshop   finding and accessing data - fiona nadia charlotte - cambridge apr...Workshop   finding and accessing data - fiona nadia charlotte - cambridge apr...
Workshop finding and accessing data - fiona nadia charlotte - cambridge apr...Fiona Nielsen
 
Session 3 - big (biomedical) data
Session 3 - big (biomedical) dataSession 3 - big (biomedical) data
Session 3 - big (biomedical) dataFiona Nielsen
 
Workshop finding and accessing data - fiona - lunteren april 18 2016
Workshop   finding and accessing data - fiona - lunteren april 18 2016Workshop   finding and accessing data - fiona - lunteren april 18 2016
Workshop finding and accessing data - fiona - lunteren april 18 2016Fiona Nielsen
 
Why i left my job in genomics R&D - Lunteren - april 18 - 2016
Why i left my job in genomics R&D - Lunteren - april 18 - 2016Why i left my job in genomics R&D - Lunteren - april 18 - 2016
Why i left my job in genomics R&D - Lunteren - april 18 - 2016Fiona Nielsen
 
Genome sharing projects around the world nijmegen oct 29 - 2015
Genome sharing projects around the world   nijmegen oct 29 - 2015Genome sharing projects around the world   nijmegen oct 29 - 2015
Genome sharing projects around the world nijmegen oct 29 - 2015Fiona Nielsen
 
Overcoming barriers for genomic data sharing yaac presentation may 23 2015
Overcoming barriers for genomic data sharing   yaac presentation may 23 2015Overcoming barriers for genomic data sharing   yaac presentation may 23 2015
Overcoming barriers for genomic data sharing yaac presentation may 23 2015Fiona Nielsen
 
The need to redefine genomic data sharing - moving towards Open Science Oct ...
The need to redefine genomic data sharing - moving towards Open Science  Oct ...The need to redefine genomic data sharing - moving towards Open Science  Oct ...
The need to redefine genomic data sharing - moving towards Open Science Oct ...Fiona Nielsen
 

Mehr von Fiona Nielsen (20)

EICT Summer School August 2023 - Things I never knew I never knew - about bu...
EICT Summer School August 2023 - Things I never knew  I never knew - about bu...EICT Summer School August 2023 - Things I never knew  I never knew - about bu...
EICT Summer School August 2023 - Things I never knew I never knew - about bu...
 
Challenges with pre-clinical studies in immuno oncology - by Fiona Nielsen
Challenges with pre-clinical studies in immuno oncology - by Fiona NielsenChallenges with pre-clinical studies in immuno oncology - by Fiona Nielsen
Challenges with pre-clinical studies in immuno oncology - by Fiona Nielsen
 
AIDR2019 - standards - tools - incentives - what does it take to enable data ...
AIDR2019 - standards - tools - incentives - what does it take to enable data ...AIDR2019 - standards - tools - incentives - what does it take to enable data ...
AIDR2019 - standards - tools - incentives - what does it take to enable data ...
 
Genomics for the public is coming - are you ready or not?
Genomics for the public is coming - are you ready or not?Genomics for the public is coming - are you ready or not?
Genomics for the public is coming - are you ready or not?
 
Investing in innovation for genomic medicine - sept 5 2017
Investing in innovation for genomic medicine - sept 5 2017Investing in innovation for genomic medicine - sept 5 2017
Investing in innovation for genomic medicine - sept 5 2017
 
Investing in innovation for genomic medicine - the journey of Repositive
Investing in innovation for genomic medicine - the journey of RepositiveInvesting in innovation for genomic medicine - the journey of Repositive
Investing in innovation for genomic medicine - the journey of Repositive
 
From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016
From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016
From bioinformatics scientist to entrepreneur - Women in Omics - ICG11 - 2016
 
ICG-11 - genomic data projects around the world - nov 5 2016
ICG-11 - genomic data projects around the world - nov 5 2016ICG-11 - genomic data projects around the world - nov 5 2016
ICG-11 - genomic data projects around the world - nov 5 2016
 
SciDataCon - How to increase accessibility and reuse for clinical and persona...
SciDataCon - How to increase accessibility and reuse for clinical and persona...SciDataCon - How to increase accessibility and reuse for clinical and persona...
SciDataCon - How to increase accessibility and reuse for clinical and persona...
 
Workshop - finding and accessing data - Cambridge August 22 2016
Workshop - finding and accessing data - Cambridge August 22 2016Workshop - finding and accessing data - Cambridge August 22 2016
Workshop - finding and accessing data - Cambridge August 22 2016
 
Data dialogue - Human Genomic Data Discovery
Data dialogue - Human Genomic Data DiscoveryData dialogue - Human Genomic Data Discovery
Data dialogue - Human Genomic Data Discovery
 
Genome sharing projects around the world - Open Access is not enough
Genome sharing projects around the world - Open Access is not enough Genome sharing projects around the world - Open Access is not enough
Genome sharing projects around the world - Open Access is not enough
 
From Bioinformatics Scientist to Entrepreneur
From Bioinformatics Scientist to EntrepreneurFrom Bioinformatics Scientist to Entrepreneur
From Bioinformatics Scientist to Entrepreneur
 
Workshop finding and accessing data - fiona nadia charlotte - cambridge apr...
Workshop   finding and accessing data - fiona nadia charlotte - cambridge apr...Workshop   finding and accessing data - fiona nadia charlotte - cambridge apr...
Workshop finding and accessing data - fiona nadia charlotte - cambridge apr...
 
Session 3 - big (biomedical) data
Session 3 - big (biomedical) dataSession 3 - big (biomedical) data
Session 3 - big (biomedical) data
 
Workshop finding and accessing data - fiona - lunteren april 18 2016
Workshop   finding and accessing data - fiona - lunteren april 18 2016Workshop   finding and accessing data - fiona - lunteren april 18 2016
Workshop finding and accessing data - fiona - lunteren april 18 2016
 
Why i left my job in genomics R&D - Lunteren - april 18 - 2016
Why i left my job in genomics R&D - Lunteren - april 18 - 2016Why i left my job in genomics R&D - Lunteren - april 18 - 2016
Why i left my job in genomics R&D - Lunteren - april 18 - 2016
 
Genome sharing projects around the world nijmegen oct 29 - 2015
Genome sharing projects around the world   nijmegen oct 29 - 2015Genome sharing projects around the world   nijmegen oct 29 - 2015
Genome sharing projects around the world nijmegen oct 29 - 2015
 
Overcoming barriers for genomic data sharing yaac presentation may 23 2015
Overcoming barriers for genomic data sharing   yaac presentation may 23 2015Overcoming barriers for genomic data sharing   yaac presentation may 23 2015
Overcoming barriers for genomic data sharing yaac presentation may 23 2015
 
The need to redefine genomic data sharing - moving towards Open Science Oct ...
The need to redefine genomic data sharing - moving towards Open Science  Oct ...The need to redefine genomic data sharing - moving towards Open Science  Oct ...
The need to redefine genomic data sharing - moving towards Open Science Oct ...
 

Kürzlich hochgeladen

CI, CD -Tools to integrate without manual intervention
CI, CD -Tools to integrate without manual interventionCI, CD -Tools to integrate without manual intervention
CI, CD -Tools to integrate without manual interventionajayrajaganeshkayala
 
5 Ds to Define Data Archiving Best Practices
5 Ds to Define Data Archiving Best Practices5 Ds to Define Data Archiving Best Practices
5 Ds to Define Data Archiving Best PracticesDataArchiva
 
The Universal GTM - how we design GTM and dataLayer
The Universal GTM - how we design GTM and dataLayerThe Universal GTM - how we design GTM and dataLayer
The Universal GTM - how we design GTM and dataLayerPavel Šabatka
 
Cash Is Still King: ATM market research '2023
Cash Is Still King: ATM market research '2023Cash Is Still King: ATM market research '2023
Cash Is Still King: ATM market research '2023Vladislav Solodkiy
 
Strategic CX: A Deep Dive into Voice of the Customer Insights for Clarity
Strategic CX: A Deep Dive into Voice of the Customer Insights for ClarityStrategic CX: A Deep Dive into Voice of the Customer Insights for Clarity
Strategic CX: A Deep Dive into Voice of the Customer Insights for ClarityAggregage
 
CCS336-Cloud-Services-Management-Lecture-Notes-1.pptx
CCS336-Cloud-Services-Management-Lecture-Notes-1.pptxCCS336-Cloud-Services-Management-Lecture-Notes-1.pptx
CCS336-Cloud-Services-Management-Lecture-Notes-1.pptxdhiyaneswaranv1
 
Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024
Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024
Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024Guido X Jansen
 
ChistaDATA Real-Time DATA Analytics Infrastructure
ChistaDATA Real-Time DATA Analytics InfrastructureChistaDATA Real-Time DATA Analytics Infrastructure
ChistaDATA Real-Time DATA Analytics Infrastructuresonikadigital1
 
Mapping the pubmed data under different suptopics using NLP.pptx
Mapping the pubmed data under different suptopics using NLP.pptxMapping the pubmed data under different suptopics using NLP.pptx
Mapping the pubmed data under different suptopics using NLP.pptxVenkatasubramani13
 
How is Real-Time Analytics Different from Traditional OLAP?
How is Real-Time Analytics Different from Traditional OLAP?How is Real-Time Analytics Different from Traditional OLAP?
How is Real-Time Analytics Different from Traditional OLAP?sonikadigital1
 
Elements of language learning - an analysis of how different elements of lang...
Elements of language learning - an analysis of how different elements of lang...Elements of language learning - an analysis of how different elements of lang...
Elements of language learning - an analysis of how different elements of lang...PrithaVashisht1
 
Rock Songs common codes and conventions.pptx
Rock Songs common codes and conventions.pptxRock Songs common codes and conventions.pptx
Rock Songs common codes and conventions.pptxFinatron037
 
Master's Thesis - Data Science - Presentation
Master's Thesis - Data Science - PresentationMaster's Thesis - Data Science - Presentation
Master's Thesis - Data Science - PresentationGiorgio Carbone
 
Virtuosoft SmartSync Product Introduction
Virtuosoft SmartSync Product IntroductionVirtuosoft SmartSync Product Introduction
Virtuosoft SmartSync Product Introductionsanjaymuralee1
 
Optimal Decision Making - Cost Reduction in Logistics
Optimal Decision Making - Cost Reduction in LogisticsOptimal Decision Making - Cost Reduction in Logistics
Optimal Decision Making - Cost Reduction in LogisticsThinkInnovation
 
TINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptx
TINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptxTINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptx
TINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptxDwiAyuSitiHartinah
 

Kürzlich hochgeladen (16)

CI, CD -Tools to integrate without manual intervention
CI, CD -Tools to integrate without manual interventionCI, CD -Tools to integrate without manual intervention
CI, CD -Tools to integrate without manual intervention
 
5 Ds to Define Data Archiving Best Practices
5 Ds to Define Data Archiving Best Practices5 Ds to Define Data Archiving Best Practices
5 Ds to Define Data Archiving Best Practices
 
The Universal GTM - how we design GTM and dataLayer
The Universal GTM - how we design GTM and dataLayerThe Universal GTM - how we design GTM and dataLayer
The Universal GTM - how we design GTM and dataLayer
 
Cash Is Still King: ATM market research '2023
Cash Is Still King: ATM market research '2023Cash Is Still King: ATM market research '2023
Cash Is Still King: ATM market research '2023
 
Strategic CX: A Deep Dive into Voice of the Customer Insights for Clarity
Strategic CX: A Deep Dive into Voice of the Customer Insights for ClarityStrategic CX: A Deep Dive into Voice of the Customer Insights for Clarity
Strategic CX: A Deep Dive into Voice of the Customer Insights for Clarity
 
CCS336-Cloud-Services-Management-Lecture-Notes-1.pptx
CCS336-Cloud-Services-Management-Lecture-Notes-1.pptxCCS336-Cloud-Services-Management-Lecture-Notes-1.pptx
CCS336-Cloud-Services-Management-Lecture-Notes-1.pptx
 
Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024
Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024
Persuasive E-commerce, Our Biased Brain @ Bikkeldag 2024
 
ChistaDATA Real-Time DATA Analytics Infrastructure
ChistaDATA Real-Time DATA Analytics InfrastructureChistaDATA Real-Time DATA Analytics Infrastructure
ChistaDATA Real-Time DATA Analytics Infrastructure
 
Mapping the pubmed data under different suptopics using NLP.pptx
Mapping the pubmed data under different suptopics using NLP.pptxMapping the pubmed data under different suptopics using NLP.pptx
Mapping the pubmed data under different suptopics using NLP.pptx
 
How is Real-Time Analytics Different from Traditional OLAP?
How is Real-Time Analytics Different from Traditional OLAP?How is Real-Time Analytics Different from Traditional OLAP?
How is Real-Time Analytics Different from Traditional OLAP?
 
Elements of language learning - an analysis of how different elements of lang...
Elements of language learning - an analysis of how different elements of lang...Elements of language learning - an analysis of how different elements of lang...
Elements of language learning - an analysis of how different elements of lang...
 
Rock Songs common codes and conventions.pptx
Rock Songs common codes and conventions.pptxRock Songs common codes and conventions.pptx
Rock Songs common codes and conventions.pptx
 
Master's Thesis - Data Science - Presentation
Master's Thesis - Data Science - PresentationMaster's Thesis - Data Science - Presentation
Master's Thesis - Data Science - Presentation
 
Virtuosoft SmartSync Product Introduction
Virtuosoft SmartSync Product IntroductionVirtuosoft SmartSync Product Introduction
Virtuosoft SmartSync Product Introduction
 
Optimal Decision Making - Cost Reduction in Logistics
Optimal Decision Making - Cost Reduction in LogisticsOptimal Decision Making - Cost Reduction in Logistics
Optimal Decision Making - Cost Reduction in Logistics
 
TINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptx
TINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptxTINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptx
TINJUAN PEMROSESAN TRANSAKSI DAN ERP.pptx
 

DNAdigest Eagle Genomics Symposium March 27, 2014

Hinweis der Redaktion

  1. The data tsunami. That’s us!
  2. Latest prediction for 2015 based on the capacity of the planned delivery of HiSeqX systems for human genomes. Don’t panic!
  3. Promises of genomic medicine
  4. Rosy picture breaks when you cannot make sense of the data
  5. There is no limit to the number of data analysis programs available, but there is a serious bottleneck in access to data for comparison, filtering and testing of hypotheses
  6. Clinical pilot studies: max 25% WES and WGS enable diagnosisLittle overlap between interpretation, conclusion of different labs looking at the same dataClearly we are in an unwanted situation. Why is no more data available to provide evidence-based results?
  7. Trade-off: details are necessary for data re-use!Advantage: access to complete datasets of genetics and medical dataDisadvantage: cumbersome, timeconsuming and slow processing of application for accessDisadvantage: difficult to discover the data you need
  8. Not easy to discover dataNot easy to apply for access to dataNot easy to deal with bulk datasetsAs a consequence:Researchers do not cross-check their resultsData is not re-used for analysisResearchers duplicate existing workResults are published based on small sample sizeswhere
  9. Collaborative approach
  10. Collaborative approach
  11. Allow more knowledge to be generated from data
  12. Create new hope for genetic research