Dr Fazekas process for checking and editing DNA sequences before publishing on BOLD.

1. Plant DNA Barcoding:
data workflow
Aron Fazekas University of Guelph

2. Plant DNA Barcoding: data workflow
Workflow Outline:
raw sequence editing
data alignment
re-edit the sequence file
upload to BOLD
quality checks using BOLD / genbank

4. Sequence editing: primer trimming

5. Sequence editing: primer trimming
5’ GTTATGCATGAACGTAATGCTC
GAGCATTACGT….

6. Sequence editing: primer trimming

7. Sequence editing: editing miscalls

8. Sequence editing: congruence between
forward/ reverse
reads

9. Sequence Alignment
After editing: need to align the data
Kelchner (2000) Ann Missouri Bot
Gard
rbcL easy to align - most programs work well
matK tricky to align – TransAlign seems to do the
best job
trnH difficult (impossible between genera?)
ITS difficult (impossible between genera?)
Clustal www.clustal.org
TransAlign http://www.biomedcentral.com/1471-2105/6/156
K-Align http://www.ebi.ac.uk/Tools/msa/kalign/

10. Sequence Alignment
Problems to look for after alignment:
- primers not trimmed
- gaps at the ends
- gaps in the middle (protein coding)
- translation shows stop codons

11. - primers not trimmed trnH-psbA
- gaps at the ends Real data submitted for
publication

12. rbcL
- gaps in the middle of a data submitted for publication
coding region

13. Translate coding regions (rbcL, matK) to
ensure there are no stop codons present

14. Edit both the alignment file and the original sequence file

15. Can trnH-psbA (or other non-coding sequence) be aligned
across diverse species?

16. Upload to BOLD

17. After data is edited, aligned: use BOLD to
create a tree

19. • Check for misplaced taxa –
remove them from the dataset
• Check for singleton species – make a list

20. BOLD BLAST check

21. Genbank BLAST check

22. Genbank BLAST check

23. Genbank Blast

24. Acknowledgements
Sujeevan Ratnasingham &
Bold Team