SlideShare ist ein Scribd-Unternehmen logo
1 von 29
Hoe technologie bijdraagt aan een
     betere behandeling van
        kankerpatiënten
           Bert Reijmerink
         Chief Executive Officer
                 Confidential      1
THE FIRST AND FASTESTS

    OPEN BIG MEDICAL DATA ANALYSIS PLATFORM
            INTEGRATING & CORRELATION BIOMEDICAL DATA




2                       Copyright © 2012 Genalice B.V.
OUR DREAM
      TO SAVE LIVES
     AND IMPROVE
    QUALITY OF LIFE
OF CANCER PATIENTS
                  3
DNA technology is moving at high pace
                 Medical data is produced with high speed




13 Years                           2 months      8 days     <1 hour

$3,000,000,000                     $2,000,000    $10,000    $1,000


   2003                              2007                   2012
BUT… data ≠ knowledge & insights
         As is needed to improve patient care

TTTATCGGAATCCGATTTCGAAACTGGGTATATCCCGGGGAAATCTCGTATAG
CTCTCGAGCTCTCGCAAAATTTTTCTCCGCGCGCTTTGATGCATCGGCTACGA
TCGTAGCTACGACGATGCTACGCTAGTGGGGGTATTTCTATCACACACAAACA
CGATCGTAGCTGTTTTTTCCCCCGGGTGTGTACGATCAAACGACTGACTACGA
TCGATCGATCGATCAGCTAGCTACGACTGACTAGCTGACTAGCTAGCTAGCTA
GCTAGCTACGTAGCTACGATCGATCGATCGATCGATCGATCGATCGACGGATG
TGGTGTGTTTCTTTTTCTTCAAAAAACCAACACATCGATCGACTGTACGATCG
ATGCTACGTAGCATCGATCGATCACGTCAGATCGATGCTACGATCGCGATCGG
ATCGATCGATCGATGATCGATCATTTCGCGTCCATTTTCCGCTTCGGGATTTGA
TGATCGCGGTTTTATAGCTAGTTA…….   3 billion in total = 25 TB

                                                           5
At the brink of BIG changes
Enabled through advances in DNA production and by powerful data analysis




                              Confidential                            6
High-Throughput Sequencing goes global
     Approximate number of machines (by country)




                       Confidential                7
DNA data production is Skyrocketing
     Number of sequenced full human genomes




                    Confidential              8
Big change – Big opportunity
         According to McKinsey


U.S. healthcare sector could create
 more than $300 billion in value
 every year if it were to “use big
data” creatively and effectively to
    drive efficiency and quality

                             McKinsey, 2011
The medical BIG DATA challenge
Up to 45 TB of diagnostic data per patient from different sources


        Gene
      Expression                             DNA
                                           variations
             Proteomics


                           Clinical Data

                                                  Pathology
     Imaging                         Any other
                                      dataset




                            Confidential                       10
Research is still moving a slow pace
       Key issues that slow down clinical applications




Non-integrated             Selective               Separate




                          Confidential                        11
Technology is the solution
    To boost research and improved patient treatment


Integrated data processing & analysis software:

     Master the size
     Master the format
     Master the compute
     Facilitate cooperation



                        Confidential                   12
Reducing the size of DNA data
                        Enables high volume analyses



Full genome sequence:     Alignment output file:       Genalice format:
     ± 25 Terabytes           ± 1.2 Terabytes          ± 200 Megabytes




 DNA data production         Preprocessing         Downstream analysis




                                  Confidential                       13
Transform and uniform data
Allows for diagnostic multi-domain integration

                                       DNA
                                     variations


                   Gene
                 Expression




        Proteomics




       Imaging
                              INTEGRATION



        Clinical Data




              Pharmaco-
              genomics



                              Pathology




                                                  14
Integration of existing knowledge
              o
Provides a 360 view of a patient’s specific disease and boosts research


                                                  DNA
                                                variations


                              Gene
                            Expression




                   Proteomics




                  Imaging
                                         INTEGRATION



                  Clinical Data




                        Pharmaco-
                        genomics



                                         Pathology




                                                                          15
Unraveling multi-domain correlations
   Will boost discovery towards 1st time right treatment

                                           DNA
                                         variations


                       Gene
                     Expression




            Proteomics



                                  INTEGRATION
           Imaging                                      Cancer
                                                      Treatment
            Clinical Data




                  Pharmaco-
                  genomics



                                  Pathology




                                                                  16
Micro parallel processing
                           Warrants high performance analysis


                 Weeks
Time to result




                                                            Seconds



                                        Confidential                  17
Micro parallel processing
                                        Warrants high performance analysis
Number of patients in one run




                                                                             100K-1M




                                10-50



                                                     Confidential                      18
Facilitating high volume data sharing
   A power multiplier for biomarker discovery projects




                                                         19
Biomarkers: from research to clinic
    High volume data internally validates digitally stored biomarkers

                                DNA
                              variations


            Gene
          Expression




 Proteomics
                       INTEGRATION




Imaging                                    RESEARCH                               Biomarker
                                           Biomarker                                Check
                                              Find                                  Clinic
Clinical Data

                                                                     validation
                                                       value value
      Any other
       dataset



                       Pathology




                                                                                              20
Game changing technology and approach
            Containing six patentable new techniques




   Uniform Format         Data Selection      Data Movement




 Causality/Correlation    Pattern Index      NB micro Scheduler



                            Confidential                          21
Our technology facilitates

                                            Faster Diagnosis (within 24 hrs)
Reliability
                                            Targeted Treatment (1st time right)
              Joint Effort
Efficiency
                                            Time/Resources gains in Research

Cost                                        Improved Drug Development




                             Confidential                                      22
Why is Genalice worth working with?

  Market at the brink to explode
  Best positioned company to capture major share
  Groundbreaking technology and approach
  Excellent team and network
  Potential use in other diseases & markets




                     Confidential                  23
Potential use in other diseases and markets
         As our software is a generic BIG DATA cruncher


1. Oncology market (largest medical segment)
2. Application for other diseases                McKinsey BIG DATA Report 2011


3. Other applications
    (outside the medical field)




                                  Confidential                             24
Partners & launching customers




                 University hospital
                 Maastricht




                             Amsterdam


             Confidential                25
Excellent team and network
                                     The Jockeys




   Bert Reijmerink                   Hans Karten               Jos Lunenberg
Chief Executive Officer        Chief Technology Officer     Chief Business Officer
Senior Business Developer IT    Senior Development Oracle    Master Degree Molecular
                                        11 patents                Biology & MBA
                                                             International Marketing
                                                                Health/Life Science



                                         Confidential                                  26
Excellent team and network
                        Our scientific advisory board




Amsterdam




                Prof. Gerrit Meijer                                 Prof. Edwin Cuppen
                 VUMC Amsterdam                                           UMC Utrecht
              PrincipaI Investigator TraIT (CTMM)                  Head of Research Medical Genetics




                                                    Confidential                                       27
Excellent team and network
      Our first board member




                            RONALD BRUS, MD
                            Former positions:
                            CEO of Crucell (sold to J&J for 2.4B)
                            Board member Galapagos (listed AMEX)

             Confidential                                     28
Genalice supports Alpe d’Huzes
        Chirurgen tegen kanker




               Confidential      29

Weitere ähnliche Inhalte

Was ist angesagt?

Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05
Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05
Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05Sage Base
 
Stephen Friend PRISME Forum 2011-05-04
Stephen Friend PRISME Forum 2011-05-04Stephen Friend PRISME Forum 2011-05-04
Stephen Friend PRISME Forum 2011-05-04Sage Base
 
智財法第八組期末報告V1.2
智財法第八組期末報告V1.2智財法第八組期末報告V1.2
智財法第八組期末報告V1.2Hsien-Yung Yi
 
Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24
Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24
Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24Sage Base
 
Stephen Friend Nature Genetics Colloquium 2012-03-24
Stephen Friend Nature Genetics Colloquium 2012-03-24Stephen Friend Nature Genetics Colloquium 2012-03-24
Stephen Friend Nature Genetics Colloquium 2012-03-24Sage Base
 
Dmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– PresentationDmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– PresentationWolfgang G. Hoeck
 
Artificial Intelligence in High Content Screening and Cervical Cancer Diagnosis
Artificial Intelligence in High Content Screening and Cervical Cancer DiagnosisArtificial Intelligence in High Content Screening and Cervical Cancer Diagnosis
Artificial Intelligence in High Content Screening and Cervical Cancer DiagnosisUniversity of Zurich
 
Ts111 Biomarker Solutions
Ts111 Biomarker SolutionsTs111 Biomarker Solutions
Ts111 Biomarker Solutionsgressero
 
Real-time Analysis of Next Generation Sequencing Data
Real-time Analysis of Next Generation Sequencing DataReal-time Analysis of Next Generation Sequencing Data
Real-time Analysis of Next Generation Sequencing DataMatthieu Schapranow
 
Applied Digital Pathology in Colon and Lung Cancer Research
Applied Digital Pathology in Colon and Lung Cancer ResearchApplied Digital Pathology in Colon and Lung Cancer Research
Applied Digital Pathology in Colon and Lung Cancer ResearchWilliam Baird
 

Was ist angesagt? (10)

Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05
Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05
Stephen Friend IMPAKT Breast Cancer Conference 2011-05-05
 
Stephen Friend PRISME Forum 2011-05-04
Stephen Friend PRISME Forum 2011-05-04Stephen Friend PRISME Forum 2011-05-04
Stephen Friend PRISME Forum 2011-05-04
 
智財法第八組期末報告V1.2
智財法第八組期末報告V1.2智財法第八組期末報告V1.2
智財法第八組期末報告V1.2
 
Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24
Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24
Stephen Friend Genetic Alliance 25th Anniversary 2011-06-24
 
Stephen Friend Nature Genetics Colloquium 2012-03-24
Stephen Friend Nature Genetics Colloquium 2012-03-24Stephen Friend Nature Genetics Colloquium 2012-03-24
Stephen Friend Nature Genetics Colloquium 2012-03-24
 
Dmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– PresentationDmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– Presentation
 
Artificial Intelligence in High Content Screening and Cervical Cancer Diagnosis
Artificial Intelligence in High Content Screening and Cervical Cancer DiagnosisArtificial Intelligence in High Content Screening and Cervical Cancer Diagnosis
Artificial Intelligence in High Content Screening and Cervical Cancer Diagnosis
 
Ts111 Biomarker Solutions
Ts111 Biomarker SolutionsTs111 Biomarker Solutions
Ts111 Biomarker Solutions
 
Real-time Analysis of Next Generation Sequencing Data
Real-time Analysis of Next Generation Sequencing DataReal-time Analysis of Next Generation Sequencing Data
Real-time Analysis of Next Generation Sequencing Data
 
Applied Digital Pathology in Colon and Lung Cancer Research
Applied Digital Pathology in Colon and Lung Cancer ResearchApplied Digital Pathology in Colon and Lung Cancer Research
Applied Digital Pathology in Colon and Lung Cancer Research
 

Andere mochten auch

Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...
Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...
Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...AlmereDataCapital
 
Arjan Hassing (Ernst & Young) - Kosten besparen op big data storage
Arjan Hassing (Ernst & Young) - Kosten besparen op big data storageArjan Hassing (Ernst & Young) - Kosten besparen op big data storage
Arjan Hassing (Ernst & Young) - Kosten besparen op big data storageAlmereDataCapital
 
Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...
Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...
Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...AlmereDataCapital
 
Nicky Hekster (IBM) - Watson for Health
Nicky Hekster (IBM) - Watson for HealthNicky Hekster (IBM) - Watson for Health
Nicky Hekster (IBM) - Watson for HealthAlmereDataCapital
 
Freek Bomhof (TNO) - Big Data en kansen in de zorg
Freek Bomhof (TNO) - Big Data en kansen in de zorgFreek Bomhof (TNO) - Big Data en kansen in de zorg
Freek Bomhof (TNO) - Big Data en kansen in de zorgAlmereDataCapital
 
Carlijn Nouwen (McKinsey) - Keynote: Big Data in de Zorg
Carlijn Nouwen (McKinsey) - Keynote: Big Data in de ZorgCarlijn Nouwen (McKinsey) - Keynote: Big Data in de Zorg
Carlijn Nouwen (McKinsey) - Keynote: Big Data in de ZorgAlmereDataCapital
 
Lex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdata
Lex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdataLex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdata
Lex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdataAlmereDataCapital
 
Dr. Piet Daas (CBS) - Statistiek en grote data bestanden
Dr. Piet Daas (CBS) - Statistiek en grote data bestandenDr. Piet Daas (CBS) - Statistiek en grote data bestanden
Dr. Piet Daas (CBS) - Statistiek en grote data bestandenAlmereDataCapital
 

Andere mochten auch (8)

Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...
Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...
Gerard Jansen (CEO Alan Turing Institute) - Alan Turing Institute: brengt dat...
 
Arjan Hassing (Ernst & Young) - Kosten besparen op big data storage
Arjan Hassing (Ernst & Young) - Kosten besparen op big data storageArjan Hassing (Ernst & Young) - Kosten besparen op big data storage
Arjan Hassing (Ernst & Young) - Kosten besparen op big data storage
 
Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...
Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...
Maurice Bouwhuis (SARA/Vancis) - Hoe big data te begrijpen door ze te visuali...
 
Nicky Hekster (IBM) - Watson for Health
Nicky Hekster (IBM) - Watson for HealthNicky Hekster (IBM) - Watson for Health
Nicky Hekster (IBM) - Watson for Health
 
Freek Bomhof (TNO) - Big Data en kansen in de zorg
Freek Bomhof (TNO) - Big Data en kansen in de zorgFreek Bomhof (TNO) - Big Data en kansen in de zorg
Freek Bomhof (TNO) - Big Data en kansen in de zorg
 
Carlijn Nouwen (McKinsey) - Keynote: Big Data in de Zorg
Carlijn Nouwen (McKinsey) - Keynote: Big Data in de ZorgCarlijn Nouwen (McKinsey) - Keynote: Big Data in de Zorg
Carlijn Nouwen (McKinsey) - Keynote: Big Data in de Zorg
 
Lex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdata
Lex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdataLex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdata
Lex Pater (Flevoziekenhuis) - Slim omgaan met ziekenhuisdata
 
Dr. Piet Daas (CBS) - Statistiek en grote data bestanden
Dr. Piet Daas (CBS) - Statistiek en grote data bestandenDr. Piet Daas (CBS) - Statistiek en grote data bestanden
Dr. Piet Daas (CBS) - Statistiek en grote data bestanden
 

Ähnlich wie Bert Reijmerink (Genalice) - Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten

Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsDr. Gerry Higgins
 
Novel network pharmacology methods for drug mechanism of action identificatio...
Novel network pharmacology methods for drug mechanism of action identificatio...Novel network pharmacology methods for drug mechanism of action identificatio...
Novel network pharmacology methods for drug mechanism of action identificatio...laserxiong
 
Forum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeForum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeJoaquin Dopazo
 
Mining Gene Expression Data Focusing Cancer Therapeutics: A Digest
Mining Gene Expression Data Focusing Cancer Therapeutics: A DigestMining Gene Expression Data Focusing Cancer Therapeutics: A Digest
Mining Gene Expression Data Focusing Cancer Therapeutics: A DigestKaashivInfoTech Company
 
Stephen Friend Food & Drug Administration 2011-07-18
Stephen Friend Food & Drug Administration 2011-07-18Stephen Friend Food & Drug Administration 2011-07-18
Stephen Friend Food & Drug Administration 2011-07-18Sage Base
 
Hinf6230 Technology Assessment Gideon Presentation Abel Sunil
Hinf6230 Technology Assessment Gideon Presentation Abel SunilHinf6230 Technology Assessment Gideon Presentation Abel Sunil
Hinf6230 Technology Assessment Gideon Presentation Abel SunilAbel Gebreyesus
 
BioVariance Services Flyer
BioVariance Services FlyerBioVariance Services Flyer
BioVariance Services FlyerJosef Scheiber
 
Emerging Trends in Clinical Data Management
Emerging Trends in Clinical Data ManagementEmerging Trends in Clinical Data Management
Emerging Trends in Clinical Data ManagementArshad Mohammed
 
Self Organizing Genomes with Real Time Consent - DNA Guide
Self Organizing Genomes with Real Time Consent - DNA GuideSelf Organizing Genomes with Real Time Consent - DNA Guide
Self Organizing Genomes with Real Time Consent - DNA GuideDNA Compass
 
DNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhd
DNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhdDNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhd
DNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhdMusaMusa68
 
Friend NIGM 2012-05-23
Friend NIGM 2012-05-23Friend NIGM 2012-05-23
Friend NIGM 2012-05-23Sage Base
 
NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth Alira Health
 
Genomics In Personal Care Product Development
Genomics In Personal Care Product DevelopmentGenomics In Personal Care Product Development
Genomics In Personal Care Product DevelopmentGenemarkers
 
IntOGen, Integrative Oncogenomics for Personal Cancer Genomes
IntOGen, Integrative Oncogenomics for Personal Cancer GenomesIntOGen, Integrative Oncogenomics for Personal Cancer Genomes
IntOGen, Integrative Oncogenomics for Personal Cancer Genomeschristian.perez
 
Next Gen Sequencing and Associated Big Data / AI problem
Next Gen Sequencing and Associated Big Data / AI problemNext Gen Sequencing and Associated Big Data / AI problem
Next Gen Sequencing and Associated Big Data / AI problemSubhendu Dey
 
Stephen Friend MIT 2011-10-20
Stephen Friend MIT 2011-10-20Stephen Friend MIT 2011-10-20
Stephen Friend MIT 2011-10-20Sage Base
 
Bioinformatics Applications in Biotechnology
Bioinformatics Applications in BiotechnologyBioinformatics Applications in Biotechnology
Bioinformatics Applications in BiotechnologyUshanandini Mohanraj
 
Stephen Friend AMIA Symposium 2012-03-21
Stephen Friend AMIA Symposium 2012-03-21Stephen Friend AMIA Symposium 2012-03-21
Stephen Friend AMIA Symposium 2012-03-21Sage Base
 

Ähnlich wie Bert Reijmerink (Genalice) - Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten (20)

Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomics
 
Novel network pharmacology methods for drug mechanism of action identificatio...
Novel network pharmacology methods for drug mechanism of action identificatio...Novel network pharmacology methods for drug mechanism of action identificatio...
Novel network pharmacology methods for drug mechanism of action identificatio...
 
ALTRABio presents WikiBioPath: new perspectives in biological data analysis
ALTRABio presents WikiBioPath: new perspectives in biological data analysisALTRABio presents WikiBioPath: new perspectives in biological data analysis
ALTRABio presents WikiBioPath: new perspectives in biological data analysis
 
Forum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeForum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decade
 
Mining Gene Expression Data Focusing Cancer Therapeutics: A Digest
Mining Gene Expression Data Focusing Cancer Therapeutics: A DigestMining Gene Expression Data Focusing Cancer Therapeutics: A Digest
Mining Gene Expression Data Focusing Cancer Therapeutics: A Digest
 
Stephen Friend Food & Drug Administration 2011-07-18
Stephen Friend Food & Drug Administration 2011-07-18Stephen Friend Food & Drug Administration 2011-07-18
Stephen Friend Food & Drug Administration 2011-07-18
 
Hinf6230 Technology Assessment Gideon Presentation Abel Sunil
Hinf6230 Technology Assessment Gideon Presentation Abel SunilHinf6230 Technology Assessment Gideon Presentation Abel Sunil
Hinf6230 Technology Assessment Gideon Presentation Abel Sunil
 
BioVariance Services Flyer
BioVariance Services FlyerBioVariance Services Flyer
BioVariance Services Flyer
 
Emerging Trends in Clinical Data Management
Emerging Trends in Clinical Data ManagementEmerging Trends in Clinical Data Management
Emerging Trends in Clinical Data Management
 
Self Organizing Genomes with Real Time Consent - DNA Guide
Self Organizing Genomes with Real Time Consent - DNA GuideSelf Organizing Genomes with Real Time Consent - DNA Guide
Self Organizing Genomes with Real Time Consent - DNA Guide
 
DNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhd
DNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhdDNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhd
DNA microarray.pdfghghvjjsjsjdhdhdhddhdhdjdhd
 
Complete Human Genome Sequencing
Complete Human Genome SequencingComplete Human Genome Sequencing
Complete Human Genome Sequencing
 
Friend NIGM 2012-05-23
Friend NIGM 2012-05-23Friend NIGM 2012-05-23
Friend NIGM 2012-05-23
 
NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth
 
Genomics In Personal Care Product Development
Genomics In Personal Care Product DevelopmentGenomics In Personal Care Product Development
Genomics In Personal Care Product Development
 
IntOGen, Integrative Oncogenomics for Personal Cancer Genomes
IntOGen, Integrative Oncogenomics for Personal Cancer GenomesIntOGen, Integrative Oncogenomics for Personal Cancer Genomes
IntOGen, Integrative Oncogenomics for Personal Cancer Genomes
 
Next Gen Sequencing and Associated Big Data / AI problem
Next Gen Sequencing and Associated Big Data / AI problemNext Gen Sequencing and Associated Big Data / AI problem
Next Gen Sequencing and Associated Big Data / AI problem
 
Stephen Friend MIT 2011-10-20
Stephen Friend MIT 2011-10-20Stephen Friend MIT 2011-10-20
Stephen Friend MIT 2011-10-20
 
Bioinformatics Applications in Biotechnology
Bioinformatics Applications in BiotechnologyBioinformatics Applications in Biotechnology
Bioinformatics Applications in Biotechnology
 
Stephen Friend AMIA Symposium 2012-03-21
Stephen Friend AMIA Symposium 2012-03-21Stephen Friend AMIA Symposium 2012-03-21
Stephen Friend AMIA Symposium 2012-03-21
 

Mehr von AlmereDataCapital

Karel Thönissen (Garabit) @ PIDS seminar
Karel Thönissen (Garabit) @ PIDS seminarKarel Thönissen (Garabit) @ PIDS seminar
Karel Thönissen (Garabit) @ PIDS seminarAlmereDataCapital
 
Steven van der Linden (Qforce) @ PIDS seminar
Steven van der Linden (Qforce) @ PIDS seminarSteven van der Linden (Qforce) @ PIDS seminar
Steven van der Linden (Qforce) @ PIDS seminarAlmereDataCapital
 
Maarten Stultjens (Elephant Security) @ PIDS seminar
Maarten Stultjens (Elephant Security) @ PIDS seminarMaarten Stultjens (Elephant Security) @ PIDS seminar
Maarten Stultjens (Elephant Security) @ PIDS seminarAlmereDataCapital
 
Sampo Kellomäki (Synergetics) @ PIDS seminar
Sampo Kellomäki (Synergetics) @ PIDS seminarSampo Kellomäki (Synergetics) @ PIDS seminar
Sampo Kellomäki (Synergetics) @ PIDS seminarAlmereDataCapital
 
Jaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminar
Jaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminarJaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminar
Jaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminarAlmereDataCapital
 
Peter Kits (Holland Van Gijzen) @ PIDS seminar
Peter Kits (Holland Van Gijzen) @ PIDS seminarPeter Kits (Holland Van Gijzen) @ PIDS seminar
Peter Kits (Holland Van Gijzen) @ PIDS seminarAlmereDataCapital
 
Prof. mr. Sijmons (Universiteit Utrecht) @ PIDS seminar
Prof. mr. Sijmons (Universiteit Utrecht) @ PIDS seminarProf. mr. Sijmons (Universiteit Utrecht) @ PIDS seminar
Prof. mr. Sijmons (Universiteit Utrecht) @ PIDS seminarAlmereDataCapital
 
Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'
Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'
Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'AlmereDataCapital
 
Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...
Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...
Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...AlmereDataCapital
 
Harro Stokman (Euvision) - Big Brother Watches Big Data
Harro Stokman (Euvision) - Big Brother Watches Big DataHarro Stokman (Euvision) - Big Brother Watches Big Data
Harro Stokman (Euvision) - Big Brother Watches Big DataAlmereDataCapital
 
Prof. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe data
Prof. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe dataProf. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe data
Prof. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe dataAlmereDataCapital
 
Peter Walgemoed (Carelliance) - Businessmodels for Big Data
Peter Walgemoed (Carelliance) - Businessmodels for Big DataPeter Walgemoed (Carelliance) - Businessmodels for Big Data
Peter Walgemoed (Carelliance) - Businessmodels for Big DataAlmereDataCapital
 

Mehr von AlmereDataCapital (12)

Karel Thönissen (Garabit) @ PIDS seminar
Karel Thönissen (Garabit) @ PIDS seminarKarel Thönissen (Garabit) @ PIDS seminar
Karel Thönissen (Garabit) @ PIDS seminar
 
Steven van der Linden (Qforce) @ PIDS seminar
Steven van der Linden (Qforce) @ PIDS seminarSteven van der Linden (Qforce) @ PIDS seminar
Steven van der Linden (Qforce) @ PIDS seminar
 
Maarten Stultjens (Elephant Security) @ PIDS seminar
Maarten Stultjens (Elephant Security) @ PIDS seminarMaarten Stultjens (Elephant Security) @ PIDS seminar
Maarten Stultjens (Elephant Security) @ PIDS seminar
 
Sampo Kellomäki (Synergetics) @ PIDS seminar
Sampo Kellomäki (Synergetics) @ PIDS seminarSampo Kellomäki (Synergetics) @ PIDS seminar
Sampo Kellomäki (Synergetics) @ PIDS seminar
 
Jaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminar
Jaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminarJaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminar
Jaap-Henk Hoepman (Privacy & Identity Lab) @ PIDS seminar
 
Peter Kits (Holland Van Gijzen) @ PIDS seminar
Peter Kits (Holland Van Gijzen) @ PIDS seminarPeter Kits (Holland Van Gijzen) @ PIDS seminar
Peter Kits (Holland Van Gijzen) @ PIDS seminar
 
Prof. mr. Sijmons (Universiteit Utrecht) @ PIDS seminar
Prof. mr. Sijmons (Universiteit Utrecht) @ PIDS seminarProf. mr. Sijmons (Universiteit Utrecht) @ PIDS seminar
Prof. mr. Sijmons (Universiteit Utrecht) @ PIDS seminar
 
Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'
Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'
Roland Haeve (Atos): 'Using the Cloud for Big Data Analytics'
 
Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...
Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...
Sjaak van der Pouw (Siemens Healthcare) - Beeldexplosie: de mogelijkheden van...
 
Harro Stokman (Euvision) - Big Brother Watches Big Data
Harro Stokman (Euvision) - Big Brother Watches Big DataHarro Stokman (Euvision) - Big Brother Watches Big Data
Harro Stokman (Euvision) - Big Brother Watches Big Data
 
Prof. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe data
Prof. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe dataProf. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe data
Prof. Ard den Heeten (LRCB) - Brondata: kennis uit ruwe data
 
Peter Walgemoed (Carelliance) - Businessmodels for Big Data
Peter Walgemoed (Carelliance) - Businessmodels for Big DataPeter Walgemoed (Carelliance) - Businessmodels for Big Data
Peter Walgemoed (Carelliance) - Businessmodels for Big Data
 

Kürzlich hochgeladen

How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.Curtis Poe
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLScyllaDB
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxLoriGlavin3
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxA Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxLoriGlavin3
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubKalema Edgar
 
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxThe Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxLoriGlavin3
 
unit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptxunit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptxBkGupta21
 
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxLoriGlavin3
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupFlorian Wilhelm
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Commit University
 
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptxThe Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptxLoriGlavin3
 
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptxUse of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptxLoriGlavin3
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsSergiu Bodiu
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebUiPathCommunity
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsPixlogix Infotech
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024Stephanie Beckett
 

Kürzlich hochgeladen (20)

How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQL
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxA Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding Club
 
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxThe Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
 
unit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptxunit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptx
 
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project Setup
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!
 
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptxThe Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
 
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptxUse of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platforms
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio Web
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and Cons
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024
 

Bert Reijmerink (Genalice) - Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten

  • 1. Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten Bert Reijmerink Chief Executive Officer Confidential 1
  • 2. THE FIRST AND FASTESTS OPEN BIG MEDICAL DATA ANALYSIS PLATFORM INTEGRATING & CORRELATION BIOMEDICAL DATA 2 Copyright © 2012 Genalice B.V.
  • 3. OUR DREAM TO SAVE LIVES AND IMPROVE QUALITY OF LIFE OF CANCER PATIENTS 3
  • 4. DNA technology is moving at high pace Medical data is produced with high speed 13 Years 2 months 8 days <1 hour $3,000,000,000 $2,000,000 $10,000 $1,000 2003 2007 2012
  • 5. BUT… data ≠ knowledge & insights As is needed to improve patient care TTTATCGGAATCCGATTTCGAAACTGGGTATATCCCGGGGAAATCTCGTATAG CTCTCGAGCTCTCGCAAAATTTTTCTCCGCGCGCTTTGATGCATCGGCTACGA TCGTAGCTACGACGATGCTACGCTAGTGGGGGTATTTCTATCACACACAAACA CGATCGTAGCTGTTTTTTCCCCCGGGTGTGTACGATCAAACGACTGACTACGA TCGATCGATCGATCAGCTAGCTACGACTGACTAGCTGACTAGCTAGCTAGCTA GCTAGCTACGTAGCTACGATCGATCGATCGATCGATCGATCGATCGACGGATG TGGTGTGTTTCTTTTTCTTCAAAAAACCAACACATCGATCGACTGTACGATCG ATGCTACGTAGCATCGATCGATCACGTCAGATCGATGCTACGATCGCGATCGG ATCGATCGATCGATGATCGATCATTTCGCGTCCATTTTCCGCTTCGGGATTTGA TGATCGCGGTTTTATAGCTAGTTA……. 3 billion in total = 25 TB 5
  • 6. At the brink of BIG changes Enabled through advances in DNA production and by powerful data analysis Confidential 6
  • 7. High-Throughput Sequencing goes global Approximate number of machines (by country) Confidential 7
  • 8. DNA data production is Skyrocketing Number of sequenced full human genomes Confidential 8
  • 9. Big change – Big opportunity According to McKinsey U.S. healthcare sector could create more than $300 billion in value every year if it were to “use big data” creatively and effectively to drive efficiency and quality McKinsey, 2011
  • 10. The medical BIG DATA challenge Up to 45 TB of diagnostic data per patient from different sources Gene Expression DNA variations Proteomics Clinical Data Pathology Imaging Any other dataset Confidential 10
  • 11. Research is still moving a slow pace Key issues that slow down clinical applications Non-integrated Selective Separate Confidential 11
  • 12. Technology is the solution To boost research and improved patient treatment Integrated data processing & analysis software: Master the size Master the format Master the compute Facilitate cooperation Confidential 12
  • 13. Reducing the size of DNA data Enables high volume analyses Full genome sequence: Alignment output file: Genalice format: ± 25 Terabytes ± 1.2 Terabytes ± 200 Megabytes DNA data production Preprocessing Downstream analysis Confidential 13
  • 14. Transform and uniform data Allows for diagnostic multi-domain integration DNA variations Gene Expression Proteomics Imaging INTEGRATION Clinical Data Pharmaco- genomics Pathology 14
  • 15. Integration of existing knowledge o Provides a 360 view of a patient’s specific disease and boosts research DNA variations Gene Expression Proteomics Imaging INTEGRATION Clinical Data Pharmaco- genomics Pathology 15
  • 16. Unraveling multi-domain correlations Will boost discovery towards 1st time right treatment DNA variations Gene Expression Proteomics INTEGRATION Imaging Cancer Treatment Clinical Data Pharmaco- genomics Pathology 16
  • 17. Micro parallel processing Warrants high performance analysis Weeks Time to result Seconds Confidential 17
  • 18. Micro parallel processing Warrants high performance analysis Number of patients in one run 100K-1M 10-50 Confidential 18
  • 19. Facilitating high volume data sharing A power multiplier for biomarker discovery projects 19
  • 20. Biomarkers: from research to clinic High volume data internally validates digitally stored biomarkers DNA variations Gene Expression Proteomics INTEGRATION Imaging RESEARCH Biomarker Biomarker Check Find Clinic Clinical Data validation value value Any other dataset Pathology 20
  • 21. Game changing technology and approach Containing six patentable new techniques Uniform Format Data Selection Data Movement Causality/Correlation Pattern Index NB micro Scheduler Confidential 21
  • 22. Our technology facilitates Faster Diagnosis (within 24 hrs) Reliability Targeted Treatment (1st time right) Joint Effort Efficiency Time/Resources gains in Research Cost Improved Drug Development Confidential 22
  • 23. Why is Genalice worth working with? Market at the brink to explode Best positioned company to capture major share Groundbreaking technology and approach Excellent team and network Potential use in other diseases & markets Confidential 23
  • 24. Potential use in other diseases and markets As our software is a generic BIG DATA cruncher 1. Oncology market (largest medical segment) 2. Application for other diseases McKinsey BIG DATA Report 2011 3. Other applications (outside the medical field) Confidential 24
  • 25. Partners & launching customers University hospital Maastricht Amsterdam Confidential 25
  • 26. Excellent team and network The Jockeys Bert Reijmerink Hans Karten Jos Lunenberg Chief Executive Officer Chief Technology Officer Chief Business Officer Senior Business Developer IT Senior Development Oracle Master Degree Molecular 11 patents Biology & MBA International Marketing Health/Life Science Confidential 26
  • 27. Excellent team and network Our scientific advisory board Amsterdam Prof. Gerrit Meijer Prof. Edwin Cuppen VUMC Amsterdam UMC Utrecht PrincipaI Investigator TraIT (CTMM) Head of Research Medical Genetics Confidential 27
  • 28. Excellent team and network Our first board member RONALD BRUS, MD Former positions: CEO of Crucell (sold to J&J for 2.4B) Board member Galapagos (listed AMEX) Confidential 28
  • 29. Genalice supports Alpe d’Huzes Chirurgen tegen kanker Confidential 29